Every repository with this icon (
Every repository with this icon (
tree 5edc5f68f74dd680a519100e03f66886b9f2b25a
parent e731c6e52bc9a672e4546eeca4f2d2d968bdba09
| name | age | message | |
|---|---|---|---|
| |
COPYING | Tue Aug 18 05:49:49 -0700 2009 | |
| |
COPYING.ja | Tue Aug 18 05:30:28 -0700 2009 | |
| |
ChangeLog | Tue Sep 01 23:24:00 -0700 2009 | |
| |
GPL | Tue Aug 18 05:30:28 -0700 2009 | |
| |
KNOWN_ISSUES.rdoc | Tue Feb 10 08:54:05 -0800 2009 | |
| |
LEGAL | Tue Aug 18 05:30:28 -0700 2009 | |
| |
LGPL | Tue Aug 18 05:30:28 -0700 2009 | |
| |
README.rdoc | Tue Aug 18 05:42:08 -0700 2009 | |
| |
README_DEV.rdoc | Mon Jun 23 12:49:18 -0700 2008 | |
| |
Rakefile | Tue Mar 17 00:08:35 -0700 2009 | |
| |
bin/ | Thu Jan 29 04:20:17 -0800 2009 | |
| |
bioruby.gemspec | Wed Sep 09 20:38:25 -0700 2009 | |
| |
bioruby.gemspec.erb | Thu Feb 19 04:20:53 -0800 2009 | |
| |
doc/ | Wed Mar 18 17:44:09 -0700 2009 | |
| |
etc/ | Wed Feb 19 17:56:02 -0800 2003 | |
| |
extconf.rb | Fri Jun 13 17:37:11 -0700 2003 | |
| |
lib/ | Wed Sep 09 20:38:25 -0700 2009 | |
| |
rdoc.zsh | Mon Feb 27 05:24:29 -0800 2006 | |
| |
sample/ | Wed Dec 03 20:56:52 -0800 2008 | |
| |
setup.rb | Sat Oct 18 22:06:41 -0700 2008 | |
| |
test/ | Fri Aug 28 06:56:26 -0700 2009 |
README.DEV
| Copyright: | Copyright (C) 2005, 2006 Toshiaki Katayama <k@bioruby.org> |
| Copyright: | Copyright (C) 2006, 2008 Jan Aerts <jandot@bioruby.org> |
HOW TO CONTRIBUTE TO THE BIORUBY PROJECT?
There are many possible ways to contribute to the BioRuby project, such as:
- Join the discussion on the BioRuby mailing list
- Send a bug report or write a bug fix patch
- Add and correct documentation
- Develop code for new features, etc.
All of these are welcome! However, this document describes the last option, how to contribute your code to the BioRuby distribution.
We would like to include your contribution as long as the scope of your module meets the field of bioinformatics.
Git
Bioruby is now under git source control at github.com/bioruby/bioruby. There are two basic ways to contribute: with patches or pull requests. Both are explained on the bioruby wiki at bioruby.open-bio.org/wiki.
LICENSE
If you would like your module to be included in the BioRuby distribution, you need to give us right to change the license of your module to make it compatible with other modules in BioRuby.
BioRuby was previously distributed under the LGPL license, but now is distributed under the same terms as Ruby.
CODING STYLE
You will need to follow the typical coding styles of the BioRuby modules:
Use the following naming conventions
- CamelCase for module and class names
- ‘_’-separated_lowercase for method names
- ‘_’-separated_lowercase for variable names
- all UPPERCASE for constants
Indentation must not include tabs
- Use 2 spaces for indentation.
- Don’t replace spaces to tabs.
Comments
Don’t use =begin and =end blocks for comments. If you need to add comments, include it in the RDoc documentation.
Documentation should be written in the RDoc format in the source code
The RDoc format is becoming the popular standard for Ruby documentation. We are now in transition from the previously used RD format to the RDoc format in API documentation.
Additional tutorial documentation and working examples are encouraged with your contribution. You may use the header part of the file for this purpose as demonstrated in the previous section.
Standard documentation
of files
Each file should start with a header, which covers the following topics:
- copyright
- license
- description of the file (not the classes; see below)
- any references, if appropriate
The header should be formatted as follows:
#
# = bio/db/hoge.rb - Hoge database parser classes
#
# Copyright:: Copyright (C) 2001, 2003-2005 Bio R. Hacker <brh@example.org>,
# Copyright:: Copyright (C) 2006 Chem R. Hacker <crh@example.org>
#
# License:: The Ruby License
#
# == Description
#
# This file contains classes that implement an interface to the Hoge database.
#
# == References
#
# * Hoge F. et al., The Hoge database, Nucleic. Acid. Res. 123:100--123 (2030)
# * http://hoge.db/
#
require 'foo'
module Bio
autoload :Bar, 'bio/bar'
class Hoge
:
end # Hoge
end # Bio
of classes and methods within those files
Classes and methods should be documented in a standardized format, as in the following example (from lib/bio/sequence.rb):
# == Description
#
# Bio::Sequence objects represent annotated sequences in bioruby.
# A Bio::Sequence object is a wrapper around the actual sequence,
# represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object.
# For most users, this encapsulation will be completely transparent.
# Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA
# objects using the same arguments and returning the same values (even though
# these methods are not documented specifically for Bio::Sequence).
#
# == Usage
#
# require 'bio'
#
# # Create a nucleic or amino acid sequence
# dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
# rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa')
# aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU')
#
# # Print in FASTA format
# puts dna.output(:fasta)
#
# # Print all codons
# dna.window_search(3,3) do |codon|
# puts codon
# end
#
class Sequence
# Create a new Bio::Sequence object
#
# s = Bio::Sequence.new('atgc')
# puts s # => 'atgc'
#
# Note that this method does not intialize the contained sequence
# as any kind of bioruby object, only as a simple string
#
# puts s.seq.class # => String
#
# See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto
# for methods to transform the basic String of a just created
# Bio::Sequence object to a proper bioruby object
# ---
# *Arguments*:
# * (required) _str_: String or Bio::Sequence::NA/AA object
# *Returns*:: Bio::Sequence object
def initialize(str)
@seq = str
end
# The sequence identifier. For example, for a sequence
# of Genbank origin, this is the accession number.
attr_accessor :entry_id
# An Array of Bio::Feature objects
attr_accessor :features
end # Sequence
Preceding the class definition (class Sequence), there is at least a description and a usage example. Please use the Description and Usage headings. If appropriate, refer to other classes that interact with or are related to the class.
The code in the usage example should, if possible, be in a format that a user can copy-and-paste into a new script to run. It should illustrate the most important uses of the class. If possible and if it would not clutter up the example too much, try to provide any input data directly into the usage example, instead of refering to ARGV or ARGF for input.
dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
Otherwise, describe the input shortly, for example:
# input should be string consisting of nucleotides dna = Bio::Sequence.auto(ARGF.read)
Methods should be preceded by a comment that describes what the method does, including any relevant usage examples. (In contrast to the documentation for the class itself, headings are not required.) In addition, any arguments should be listed, as well as the type of thing that is returned by the method. The format of this information is as follows:
# --- # *Arguments*: # * (required) _str_: String or Bio::Sequence::NA # * (optional) _nr_: a number that means something # *Returns*:: true or false
Attribute accessors can be preceded by a short description.
Exception handling
Don’t use
$stderr.puts "WARNING"
in your code. Instead, try to avoid printing error messages. For fatal errors, use raise with an appropriate message.
Testing code should use ‘test/unit’
Unit tests should come with your modules by which you can assure what you meant to do with each method. The test code is useful to make maintenance easy and ensure stability. The use of
if __FILE__ == $0
is deprecated.
Using autoload
To quicken the initial load time we have replaced most of ‘require’ to ‘autoload’ since BioRuby version 0.7. During this change, we have found some tips:
You should not separate the same namespace into several files.
- For example, if you have separated definitions of the Bio::Foo class into two files (e.g. ‘bio/foo.rb’ and ‘bio/bar.rb’), you need to resolve the dependencies (including the load order) yourself.
- If you have a defined Bio::Foo in ‘bio/foo.rb’ and a defined
Bio::Foo::Bar in ‘bio/foo/bar.rb’ add the following line in the
‘bio/foo.rb’ file:
autoload :Bar, 'bio/foo/bar'
You should not put several top level namespaces in one file.
- For example, if you have Bio::A, Bio::B and Bio::C in the file
‘bio/foo.rb’, you need
autoload :A, 'bio/foo' autoload :B, 'bio/foo' autoload :C, 'bio/foo'
to load the module automatically (instead of require ‘bio/foo’). In this case, you should put them under the new namespace like Bio::Foo::A, Bio::Foo::B and Bio::Foo::C in the file ‘bio/foo’, then use
autoload :Foo, 'bio/foo'
so autoload can be written in 1 line.
NAMESPACE
Your module should be located under the top-level module Bio and put under the ‘bioruby/lib/bio’ directory. The class/module names and the file names should be short and descriptive.
There are already several sub directories in ‘bioruby/lib’:
bio/*.rb -- general and widely used basic classes bio/appl/ -- wrapper and parser for the external applications bio/data/ -- basic biological data bio/db/ -- flatfile database entry parsers bio/io/ -- I/O interfaces for files, RDB, web services etc. bio/util/ -- utilities and algorithms for bioinformatics
If your module doesn’t match any of the above, please propose an appropriate directory name when you contribute. Please let the staff discuss on namespaces (class names), API (method names) before commiting a new module or making changes on existing modules.
MAINTENANCE
Finally, please maintain the code you’ve contributed. Please let us know (on the bioruby list) before you commit, so that users can discuss on the change.







