diff --git a/blogdump.gdf b/blogdump.gdf new file mode 100644 index 0000000..82fe3f5 --- /dev/null +++ b/blogdump.gdf @@ -0,0 +1,888 @@ +nodedef> name, label STRING, section VARCHAR +id75,Lab SAXS Template,Templates +id81,GFP solution 5 mg/ml,Materials +id82,GFP solution 2 mg/ml,Materials +id83,GFP solution 1 mg/ml,Materials +id79,Preparation of GFP solutions,Procedures +id86,Centrifuged 10 mg/mL GFP,Materials +id87,Centrifuged 2 mg/mL GFP,Materials +id88,Centrifuged 5 mg/mL GFP,Materials +id110,SAXS Run 02075,Data +id108,SAXS Run 02074,Data +id97,SAXS Run 02073,Data +id96,SAXS Run 02072,Data +id95,SAXS Run 02071,Data +id94,SAXS Run 02070,Data +id93,SAXS Run 02069,Data +id92,SAXS Run 02068,Data +id91,SAXS Run 02067,Data +id123,GFP SAXS data reduction,Procedures +id85,Centrifugation of 10 mg/mL GFP solution,Procedures +id131,GFP (10 mg/mL) in D2O buffer,Materials +id132,GFP 5 mg/mL in D2O buffer,Materials +id133,GFP 2 mg/mL in D2O buffer,Materials +id130,Preparation of GFP Samples for a quickie SANS experiment on LOQ,Procedures +id135,Lysozyme,Materials +id137,Lysozyme 10 mg/mL in D2O buffer,Materials +id138,Lysozyme 2mg/mL,Materials +id136,Preparation of lysozyme solutions for quickie SANS experiment,Procedures +id141,20 mM Phosphate buffer in D2O,Materials +id171,UV-Vis spectroscopy of GFP and Lysozyme samples,Procedures +id90,LOQ SANS data template,Templates +id174,44700 - 10mg/mL GFP on LOQ,Data +id178,44701 - 5mg/mL GFP on LOQ,Data +id182,44702 - 2mg/mL GFP on LOQ,Data +id186,44703 - 10mg/mL Lysozyme on LOQ,Data +id190,44704 - 2mg/mL Lysozyme on LOQ,Data +id195,Initial analysis of SANS data on GFP,Procedures +id156,UV-Vis spectrum of 2 mg/mL Lysozyme,Data +id153,UV-Vis spectrum of 10mg/mL Lysozyme,Data +id150,UV-Vis spectrum of 2mg/mL GFP,Data +id147,UV-Vis spectrum of 5mg/mL GFP,Data +id144,UV-Vis spectrum of 10mg/mL GFP,Data +id142,SANS on GFP concentration series,Procedures +id109,SAXS of GFP Samples,Procedures +id210,oligo template,Templates +id231,Planning preparation of DNA for Laser Tweezers experiment,Note +id240,Ethanol precipitated lambda DNA,Materials +id263,Phosphorylated TerR lam,Materials +id264,Phosporylated TerR,Materials +id265,Phosphorylated TerFlam,Materials +id269,Phosphorylated oligo-lambda-biotin,Materials +id275,Product of ligation of lambda to lambda-oligo-biotin,Materials +id262,Phosphorylated lambda DNA,Materials +id273,Ligation of oligo-biotin-lambda to lambda DNA,Procedures +id266,Phosphorylated TerF,Materials +id224,Oligo-lambda-biotin,Materials +id221,Oligo-TerRlam,Materials +id218,Oligo-TerR,Materials +id214,Oligo-TerFlam,Materials +id211,Oligo-TerF,Materials +id76,Sortase Buffer,Materials +id78,GFP solution 10 mg/mL,Materials +id77,Freeze dried GFP,Materials +id287,1:100 gly-OH modified silica beads,Materials +id288,1:1000 gly-OH modified silica beads,Materials +id289,1:10000 gly-OH modified silica beads,Materials +id290,1:100000 gly-OH modified silica beads,Materials +id295,TerF-lambda-biotin construct,Materials +id294,Ligation of Tus adaptors to biotin-modified lambda,Procedures +id300,1:100 gly-oh beads after ammonia treatment,Materials +id301,1:1000 gly-OH beads after ammonia treatment,Materials +id302,1:10000 gly-OH beads after ammonia treatment,Materials +id303,1:100,000 gly-OH beads after ammonia treatment,Materials +id291,Ammonia treatment of gly modified beads,Procedures +id305,Maria's analysis of the GFP SAXS data,Procedures +id298,TerR-lambda-biotin construct,Materials +id352,Bangs Labs streptavidin coated beads,Materials +id375,Preparing fresh polymer-DNA beads for lasers experiment,Procedures +id379,Examining silica beads for stickiness to surface,Note +id387,Octameric rck domain from MthK in D2O buffer,Materials +id140,SANS on LOQ template,Templates +id394,SANS on LOQ template,Procedures +id402,SANS runs on octameric RCK,Procedures +id405,Additional runs on octameric Rck,Procedures +id409,Octameric RCK plus Ca,Materials +id410,Buffer background for octameric RCK plus Ca,Materials +id408,Addition of Ca++ to octameric mthk sample,Procedures +id417,Dimeric RCK from gel filtration in pD 6.5 D2O buffer,Materials +id418,Buffer background for dimeric RCK,Materials +id419,SANS of dimeric RCK,Procedures +id412,SANS of octameric RCK plus Ca++,Procedures +id426,Octameric RCK plus Ca dialysed into pD6.5,Materials +id427,Octameric RCK plus (no Ca) dialysed into pD 6.5 buffer,Materials +id425,Dialysis of Octameric RCK samples,Procedures +id432,20 mM MES pD6.5 250 mM KCl in D2O,Materials +id433,20 mM MES pD6.5 250 mM KCl, 25 mM Ca2+ in D2O,Materials +id434,SANS of dialysed octameric RCK samples,Procedures +id374,Fresh beads for Laser Tweezers experiments,Procedures +id454,DNA sequence data from Southampton on pLLC064,Data +id474,Analysis of pLLC064 sequencing data,Procedures +id766,PCR template,Templates +id390,Buffer background for octameric rck domain,Materials +id765,KcsA plasmid from Southampton,Materials +id757,kcsa-sort-bwd,Materials +id756,kcsa-sort-fwd,Materials +id769,Test PCR to insert Sortase sequence within KcsA,Procedures +id353,First preparation of beads for laser tweezers experiment,Procedures +id261,Phosphorylation of DNA substrates for laser tweezers experiment,Procedures +id239,Ethanol precipitation of lambda DNA,Procedures +id2868,Further lysozyme runs,Procedures +id3226,UV-Vis of 5mg/mL Lysozyme,Data +id3229,UV-Vis of 2mg/mL Lysozyme,Data +id3230,UV-Vis of 20mg/mL GFP,Data +id3233,UV-Vis of 10mg/mL GFP,Data +id3236,UV-Vis of 5mg/mL GFP,Data +id3239,UV-Vis of 2mg/mL GFP,Data +id3219,UV-Vis of Lysozyme and GFP samples from I22 SAXS,Procedures +id3220,UV-Vis of 20mg/mL Lysozyme,Data +id3223,UV-Vis of 10mg/mL Lysozyme,Data +id2765,Preparation of DMPC vesicles,Procedures +id2774,Exchange of prBC into bOG,Procedures +id2778,Lysozyme (~20 mg/mL),Materials +id2782,GFP (~20 mg/mL),Materials +id2786,GFP (~10mg/mL),Materials +id2787,GFP (~5 mg/mL),Materials +id2788,GFP (~2 mg/mL),Materials +id2790,Lysozyme (~10 mg/mL),Materials +id2791,Lysozyme (~5 mg/mL),Materials +id2792,Lysozyme (~2 mg/mL),Materials +id2816,Tris-HCl pH 8.0 buffer,Materials +id2822,SAXS on Tris-HCl pH 8.0 buffer,Data +id2838,Lysozyme 10 mg/mL with attenutor,Data +id2834,Lysozyme 5mg/mL with attenuator,Data +id2835,Lysozyme 2mg/mL with attenuator,Data +id2833,Buffer with attentuator,Data +id2832,Lysozyme 20 mg/mL w/o attenutor,Data +id2831,Lysozyme 5mg/mL w/o attenuator,Data +id2824,First run on 2 mg/ml Lyzozyme,Data +id2837,Lysozyme 20 mg/mL with attenutor,Data +id2858,GFP 2mg/mL,Data +id2859,second 10 frames of 2 mg/mL GFP,Data +id2860,GFP 5 mg/mL,Data +id2872,0.25 mg/mL GluR0 with glutamate,Materials +id2874,0.5 mg/mL GluR0 with glutamate,Materials +id2863,GFP 10mg/mL,Data +id2864,GFP 20mg/mL,Data +id2825,SAXS on I22 template,Procedures +id2896,GluR0 buffer,Materials +id2886,SAXS runs of GluR0,Procedures +id2900,GluR0 1mg/mL no glutamate,Materials +id2903,0.5 mg/mL GluR0 no glutamate,Materials +id2904,0.25 mg/mL GluR0 no glutamate,Materials +id2881,SAXS of 0.5 mg/mL GluR0 with glutamate,Data +id2876,GluR0 SAXS 0.25 mg/mL + glu first run,Data +id2909,SAXS of GLuR0 buffer,Data +id2912,SAXS of 1 mg/mL GluR0 no glutamate,Data +id2915,SAXS of GluR0 0.5 mg/mL no glutamate,Data +id2921,SAXS on GluR) in capillaries,Procedures +id2920,SAXS of GluR0 0.25 mg/mL no glutamate,Data +id2926,Tus buffer,Materials +id2927,Tus unlabelled,Materials +id2928,Fluorescein labelled Tus,Materials +id2931,SAXS of unlabelled Tus,Data +id2932,SAXS of labelled Tus,Data +id2930,SAXS of Tus buffer,Data +id2937,SAXS of Tus samples,Procedures +id2940,JHL sample,Materials +id2941,JHL buffer,Materials +id2942,JHL 10mg/mL,Materials +id2944,JHL RP 5 mg/mL,Materials +id2945,JHL N 10 mg/mL,Materials +id2946,JHL N 5 mg/mL,Materials +id2943,SAXS for JHL,Procedures +id2948,ATIC - Buffer,Materials +id2949,ATIC 20 mg/mL,Materials +id2950,ATIC 10 mg/mL,Materials +id2951,ATIC 5 mg/mL,Materials +id2952,ATIC 2 mg/mL,Materials +id2954,SAX of ATIC buffer,Data +id2955,SAXS on ATIC 20 mg/mL,Data +id2958,SAXS on ATIC 2 mg/mL,Data +id2961,SAXS on ATIC 10 mg/mL,Data +id2964,SAXS on ATIC 5 mg/mL,Data +id2967,SAXS on ATIC,Procedures +id2971,20 mg/mL ATIC with inhibitor,Materials +id2972,10 mg/mL ATIC with inhibitor,Materials +id2970,Addition of inhibitor to ATIC solutions,Procedures +id2974,SAXS on 20 mg/mL ATIC plus inhibitor (2%),Data +id2975,SAXS on 10 mg/mL ATIC plus inhibitor (2%),Data +id2982,Second SAXS run on 10 mg/mL with inhibitor,Data +id2986,5 mg/mL ATIC + 10% inhibitor,Materials +id2987,10 mg/mL ATIC with 10% inhibitor,Materials +id2985,Further preparation of samples with inhibitor,Procedures +id2991,SAXS on 5 mg/mL ATIC with 10% inhibitor,Data +id2990,SAXS of 10 mg/mL ATIC with 10% inhibitor,Data +id3000,SAXS of ATIC with inhibitors,Procedures +id3002,Repeat SAXS of 10 mg/mL ATIC with 10% inhibitor,Data +id3005,Repeat SAXS of 20 mg/mL ATIC,Data +id3008,Repeat SAXS of ATIC buffer,Data +id3010,Continuing SAXS on ATIC with (and without) inhibitor,Procedures +id7501,test,Note +id2779,Preparation of lysozyme solutions,Procedures +id2783,Preparation of GFP solutions for I22 SAXS,Procedures +id11331,50 mM Hepes pH 7 Buffer in D2O,Materials +id11335,MurM sample,Materials +id11337,Dialysed MurM sample in D2O buffer,Materials +id11336,Dialysis of MurM into new buffer,Procedures +id11530,Test solution sample,Materials +id11510,Approaching the design of a dataset consisting of modelled data based on pdb structures,Note +id11338,Buffer blank dialysate for MurM,Materials +id2818,SAXS on I22 template,Templates +id11573,Reprocessed Glur0 buffer background,Data +id11576,Reprocessed Glur0 buffer background (Right),Data +id2820,I22 Data template,Templates +id11580,Reprocessed Glur0 data 1mg/mL (Left),Data +id11583,Reprocessed Glur0 data 1mg/mL (Right),Data +id11586,Reprocessing SAXS data from Feb 09,Procedures +id11587,Glur0 1mg/mL I vs Q (background subtracted and small linear displacement),Data +id11589,Initial analysis of reprocessed Glur0 Data,Procedures +id11621,Calculation of Scattering Length Densities for King/Frey Surfactants,Procedures +id11670,Purified GFP lyophilised,Materials +id386,SAS sample template,Templates +id11675,H2O Phosphate buffer,Materials +id11676,D2O Phosphate buffer,Materials +id11677,Preparing samples of GFP and Lysozyme for SANS2d experiment,Procedures +id11679,GFP in D2O Phosphate buffer,Materials +id11680,Lysozyme sample in H2O phosphate buffer,Materials +id11681,Lysozyme sample in D2O phosphate buffer,Materials +id11678,GFP in H2O Phosphate buffer,Materials +id11682,GFP in 70% D2O Phosphate buffer,Materials +id11683,Lysozyme sample in 70% D2O phosphate buffer,Materials +id11854,Luke's PinA data,Data +id11857,Quick analysis of Lukes PinA data,Procedures +id11910,GFP SANS Data from SANS2d - 6m D2O,Data +id11918,Lysozyme in D2O data from SANS2D,Data +id11921,Comparison of SANS2d and LOQ Lysozyme data,Procedures +id11913,Comparison of SANS2d and LOQ GFP data,Procedures +id11928,Some analysis of reflection data from Crisp Experiment,Procedures +id12130,Glur0 D2O Sample,Materials +id12132,10mM DM H2O Buffer,Materials +id12133,D2O Buffer for Glur0,Materials +id12134,H2O Buffer for Glur0,Materials +id12135,10mM DM D2O Buffer,Materials +id12139,3333-First Glur0 D2O reduced data,Data +id12125,Glur0 D2O Sample,Materials +id12126,Glur0 H2O Sample,Materials +id12150,Second set of GLur0 samples,Procedures +id12155,Comments on Glur0 experiment in progress,Note +id12156,Glur0 in 22% D2O buffer,Materials +id12157,22% D2O Buffer,Materials +id12153,Single run of Glur0 H2O,Procedures +id12169,Glur0 H2O summed data,Data +id12165,Glur0 D2O summed data,Data +id12145,GlurO + glutamate D2O,Materials +id12266,Transformation of pSOT092 and pLLC146 into BL21(DE3),Procedures +id12272,GFP Lysis Buffer,Materials +id12275,GFP Cleared lysate,Materials +id12277,GFP purification first filtrate,Materials +id12278,GFP purification second filtrate,Materials +id12283,GFP-Second resin wash,Materials +id12281,Ammon-Acetate 20 mM imidazole wash buffer,Materials +id12280,GFP-First resin wash,Materials +id12282,Ammonium-acetate 400 mM elution buffer,Materials +id12286,GFP-Third resin wash,Materials +id12273,Test purification of GFP,Procedures +id12298,GFP elution fraction 2,Materials +id12294,GFP-repurification flow through,Materials +id12295,GFP-repurification first wash,Materials +id12297,GFP elution fraction 1,Materials +id12299,GFP elution fraction 3,Materials +id12300,GFP elution fraction 4,Materials +id12301,GFP elution fraction 5,Materials +id12293,Further purification of GFP fractions,Procedures +id12304,Sortase cleared lysate,Materials +id12308,Sortase flow through fraction,Materials +id12314,Sortase elution fraction 4,Materials +id12296,fraction,Templates +id12309,Sortase first wash fraction,Materials +id12315,Sortase 20 mM imidazole wash fraction,Materials +id12312,Sortase elution fraction 2,Materials +id12313,Sortase elution fraction 3,Materials +id12311,Sortase elution fraction 1,Materials +id12320,Sortase elution fraction 6,Materials +id12321,Sortase elution fraction 7,Materials +id12322,Sortase elution fraction 8,Materials +id12323,Sortase elution fraction 9,Materials +id12324,Sortase elution fraction 10,Materials +id12303,Purification of Sortase,Procedures +id12319,Sortase elution fraction 5,Materials +id12328,Sigma Wide Range SDS-PAGE Marker,Materials +id12327,SDS-Page Gel,Templates +id12334,GFP purifcation gel2,Procedures +id12306,Concentration and exchange of GFP,Procedures +id12357,Frozen Sortase solution,Materials +id12332,GFP purification Gel,Procedures +id12329,Sortase purification SDS-Page Gel,Procedures +id12358,Freeze dried Sortase,Materials +id12345,Freeze dried GFP,Materials +id12344,Concentration and exchange of sortase,Procedures +id12131,SANS2d run template,Templates +id12137,First Glur0 runs - SANS2d,Procedures +id13150,Purification of Tus-Ter complex,Procedures +id13156,Purification of Tus-Ter(14mer) complex, Tus-NS(21mer), Tus-Ter(Ext),Procedures +id13169,Concentrated sample from Tus-NS(21mer) S75 column,Materials +id13168,Concentrated sample from Tus-Ter(14mer) S75 column,Materials +id13249,3339 - reduced SANS data,Data +id13250,3395 - reduced SANS data,Data +id13251,3397 - reduced SANS data,Data +id13252,3393 - reduced SANS data,Data +id13253,3345 - reduced SANS data,Data +id13254,SANS Data Reduction,Procedures +id13323,3361 - reduced SANS data,Data +id13324,3367 - reduced SANS data,Data +id13325,3377 - reduced SANS data,Data +id13326,3386 - reduced SANS data,Data +id13327,3395 - reduced SANS data,Data +id13328,SANS Data Reduction,Procedure +id13332,3362 - reduced SANS data,Data +id13333,3368 - reduced SANS data,Data +id13334,3378 - reduced SANS data,Data +id13335,3383 - reduced SANS data,Data +id13336,3387 - reduced SANS data,Data +id13337,3396 - reduced SANS data,Data +id13338,SANS Data Reduction,Procedure +id13247,Adding runs from March GLur0 SANS Expt,Procedures +id13346,3345 - reduced SANS data,Data +id13347,3393 - reduced SANS data,Data +id13348,3397 - reduced SANS data,Data +id13349,3395 - reduced SANS data,Data +id13350,3339 - reduced SANS data,Data +id13351,SANS Data Reduction,Procedure +id12160,uuluruwnbupbpchmwjht, online radio, FQGLFQT, [url=http://literadio.net/]radio online[/url], zlVcoey, http://literadio.net/ radio online, azcNVgO.,Data +id228,external,unknown +id272,external,unknown +id271,external,unknown +id445,external,unknown +id444,external,unknown +id259,external,unknown +id260,external,unknown +id228,external,unknown +id228,external,unknown +id2767,external,unknown +id2767,external,unknown +id2767,external,unknown +id2777,external,unknown +id650,external,unknown +id683,external,unknown +id11330,external,unknown +id4723,external,unknown +id2777,external,unknown +id2777,external,unknown +id12088,external,unknown +id12088,external,unknown +edgedef>node1,node2 +id81,id76 +id81,id79 +id82,id79 +id83,id79 +id79,id77 +id79,id76 +id79,id78 +id79,id76 +id79,id81 +id79,id82 +id79,id83 +id86,id85 +id87,id85 +id88,id85 +id123,id109 +id123,id91 +id123,id91 +id123,id110 +id123,id95 +id123,id108 +id123,id81 +id123,id94 +id85,id86 +id85,id88 +id85,id87 +id131,id130 +id132,id130 +id130,id77 +id130,id131 +id130,id132 +id130,id133 +id137,id136 +id138,id136 +id136,id135 +id136,id137 +id136,id138 +id171,id131 +id171,id144 +id171,id132 +id171,id147 +id171,id133 +id171,id150 +id171,id137 +id171,id153 +id171,id138 +id171,id156 +id195,id174 +id195,id178 +id195,id186 +id195,id182 +id195,id190 +id142,id141 +id142,id131 +id142,id174 +id142,id132 +id142,id178 +id142,id133 +id142,id182 +id142,id137 +id142,id186 +id142,id138 +id142,id190 +id109,id76 +id109,id91 +id109,id81 +id109,id92 +id109,id81 +id109,id93 +id109,id81 +id109,id94 +id109,id83 +id109,id95 +id109,id86 +id109,id96 +id109,id88 +id109,id97 +id109,id87 +id109,id108 +id109,id76 +id109,id110 +id231,id228 +id231,id224 +id231,id221 +id231,id218 +id231,id214 +id231,id211 +id240,id239 +id263,id261 +id264,id261 +id265,id261 +id269,id261 +id275,id273 +id262,id261 +id273,id262 +id273,id269 +id273,id272 +id273,id275 +id266,id261 +id78,id79 +id295,id294 +id294,id275 +id294,id271 +id294,id275 +id294,id266 +id294,id265 +id294,id295 +id294,id264 +id294,id263 +id294,id298 +id300,id291 +id301,id291 +id302,id291 +id303,id291 +id291,id287 +id291,id288 +id291,id289 +id291,id290 +id305,id123 +id298,id294 +id375,id352 +id375,id298 +id375,id352 +id375,id298 +id375,id224 +id379,id298 +id379,id224 +id379,id298 +id402,id387 +id402,id390 +id402,id387 +id402,id390 +id405,id387 +id405,id390 +id409,id408 +id410,id408 +id408,id387 +id408,id390 +id408,id409 +id408,id410 +id419,id417 +id419,id418 +id419,id417 +id419,id418 +id412,id409 +id412,id410 +id412,id409 +id412,id410 +id412,id409 +id412,id410 +id426,id425 +id425,id387 +id425,id409 +id425,id427 +id425,id426 +id434,id427 +id434,id432 +id434,id426 +id434,id433 +id434,id427 +id434,id432 +id434,id426 +id434,id433 +id434,id427 +id434,id432 +id434,id426 +id434,id433 +id374,id300 +id374,id300 +id374,id301 +id374,id445 +id374,id302 +id374,id444 +id374,id303 +id769,id765 +id769,id756 +id769,id757 +id769,id765 +id769,id756 +id769,id757 +id353,id300 +id353,id263 +id353,id352 +id261,id259 +id261,id260 +id261,id240 +id261,id262 +id261,id224 +id261,id269 +id261,id221 +id261,id263 +id261,id218 +id261,id264 +id261,id214 +id261,id265 +id261,id211 +id261,id266 +id239,id228 +id239,id228 +id239,id240 +id2868,id2790 +id2868,id2838 +id2868,id2778 +id2868,id2837 +id2868,id2788 +id2868,id2858 +id2868,id2788 +id2868,id2859 +id2868,id2787 +id2868,id2860 +id2868,id2786 +id2868,id2863 +id2868,id2782 +id2868,id2864 +id3226,id3219 +id3229,id3219 +id3230,id3219 +id3233,id3219 +id3236,id3219 +id3239,id3219 +id3219,id2778 +id3219,id3220 +id3219,id2790 +id3219,id3223 +id3219,id2791 +id3219,id3226 +id3219,id2792 +id3219,id3229 +id3219,id2782 +id3219,id3230 +id3219,id2786 +id3219,id3233 +id3219,id2787 +id3219,id3236 +id3219,id2788 +id3219,id3239 +id3220,id3219 +id3223,id3219 +id2774,id2767 +id2774,id2767 +id2774,id2767 +id2778,id2779 +id2782,id2783 +id2786,id2783 +id2787,id2783 +id2788,id2783 +id2790,id2779 +id2791,id2779 +id2792,id2779 +id2825,id2816 +id2825,id2822 +id2825,id2792 +id2825,id2824 +id2825,id2791 +id2825,id2778 +id2825,id2816 +id2825,id2816 +id2825,id2833 +id2825,id2792 +id2825,id2835 +id2825,id2791 +id2825,id2834 +id2886,id2872 +id2886,id2876 +id2886,id2874 +id2886,id2881 +id2921,id2896 +id2921,id2909 +id2921,id2900 +id2921,id2912 +id2921,id2903 +id2921,id2915 +id2921,id2904 +id2921,id2920 +id2937,id2926 +id2937,id2930 +id2937,id2926 +id2937,id2931 +id2937,id2927 +id2937,id2932 +id2943,id2940 +id2943,id2941 +id2943,id2942 +id2943,id2944 +id2943,id2945 +id2943,id2946 +id2967,id2948 +id2967,id2954 +id2967,id2949 +id2967,id2955 +id2967,id2952 +id2967,id2958 +id2967,id2950 +id2967,id2961 +id2967,id2951 +id2967,id2964 +id2971,id2970 +id2972,id2970 +id2970,id2949 +id2970,id2971 +id2970,id2950 +id2970,id2972 +id2986,id2985 +id2987,id2985 +id2985,id2949 +id2985,id2986 +id2985,id2950 +id2985,id2987 +id3000,id2971 +id3000,id2974 +id3000,id2972 +id3000,id2975 +id3000,id2972 +id3000,id2982 +id3010,id2987 +id3010,id2990 +id3010,id2986 +id3010,id2991 +id3010,id2987 +id3010,id3002 +id3010,id2949 +id3010,id3005 +id3010,id2948 +id3010,id3008 +id2779,id2777 +id2779,id2778 +id2779,id2778 +id2779,id2790 +id2779,id2778 +id2779,id2791 +id2779,id2778 +id2779,id2792 +id2783,id2782 +id2783,id2786 +id2783,id2786 +id2783,id2782 +id2783,id2787 +id2783,id2782 +id2783,id2788 +id11331,id650 +id11331,id683 +id11331,id11330 +id11337,id11336 +id11336,id11335 +id11336,id11331 +id11336,id11337 +id11336,id11338 +id11338,id11336 +id11586,id2909 +id11586,id11573 +id11586,id11576 +id11586,id2912 +id11586,id11580 +id11586,id11583 +id11587,id11589 +id11589,id11573 +id11589,id11576 +id11589,id11580 +id11589,id11583 +id11589,id11587 +id11589,id4723 +id11677,id2777 +id11677,id2777 +id11677,id11670 +id11677,id11670 +id11677,id11680 +id11677,id11681 +id11677,id11678 +id11677,id11679 +id11677,id11683 +id11677,id11682 +id11679,id11677 +id11680,id11677 +id11681,id11677 +id11678,id11677 +id11682,id11677 +id11683,id11677 +id11857,id11854 +id11921,id11918 +id11921,id186 +id11913,id11910 +id11913,id131 +id12130,id12088 +id12126,id12088 +id12150,id12145 +id12150,id12134 +id12150,id12133 +id12150,id12145 +id12150,id12125 +id12150,id12126 +id12150,id12134 +id12150,id12133 +id12150,id12145 +id12153,id12126 +id12275,id12273 +id12277,id12273 +id12278,id12273 +id12283,id12281 +id12280,id12273 +id12280,id12272 +id12286,id12273 +id12286,id12282 +id12273,id12272 +id12273,id12275 +id12273,id12277 +id12273,id12278 +id12273,id12272 +id12273,id12280 +id12273,id12281 +id12273,id12283 +id12273,id12282 +id12273,id12286 +id12298,id12293 +id12294,id12293 +id12295,id12293 +id12297,id12293 +id12299,id12293 +id12300,id12293 +id12301,id12293 +id12293,id12283 +id12293,id12294 +id12293,id12295 +id12293,id12297 +id12293,id12298 +id12293,id12299 +id12293,id12300 +id12293,id12301 +id12304,id12303 +id12308,id12303 +id12314,id12303 +id12296,id12303 +id12309,id12303 +id12315,id12303 +id12312,id12303 +id12313,id12303 +id12311,id12303 +id12320,id12303 +id12321,id12303 +id12322,id12303 +id12323,id12303 +id12324,id12303 +id12303,id12272 +id12303,id12304 +id12303,id12308 +id12303,id12309 +id12303,id12315 +id12303,id12311 +id12303,id12312 +id12303,id12313 +id12303,id12314 +id12303,id12319 +id12303,id12320 +id12303,id12321 +id12303,id12322 +id12303,id12323 +id12303,id12324 +id12319,id12303 +id12334,id12328 +id12334,id12283 +id12334,id12283 +id12334,id12297 +id12334,id12298 +id12334,id12299 +id12334,id12300 +id12306,id12334 +id12306,id12297 +id12306,id12298 +id12306,id12299 +id12306,id12300 +id12306,id12301 +id12306,id12286 +id12306,id12345 +id12357,id12344 +id12332,id12328 +id12332,id12275 +id12332,id12277 +id12332,id12278 +id12332,id12280 +id12332,id12280 +id12329,id12328 +id12329,id12308 +id12329,id12309 +id12329,id12315 +id12329,id12311 +id12329,id12312 +id12329,id12313 +id12329,id12314 +id12329,id12320 +id12329,id12322 +id12358,id12344 +id12345,id12306 +id12344,id12329 +id12344,id12308 +id12344,id12315 +id12344,id12311 +id12344,id12312 +id12344,id12313 +id12344,id12314 +id12344,id12357 +id12344,id12358 +id12137,id12133 +id12137,id12125 +id12137,id12126 +id12137,id12134 +id12137,id12133 +id12137,id12125 +id12137,id12126 +id13169,id13156 +id13168,id13156 +id13254,id13249 +id13254,id13250 +id13254,id13251 +id13254,id13252 +id13254,id13253 +id13328,id13323 +id13328,id13324 +id13328,id13325 +id13328,id13326 +id13328,id13327 +id13338,id13332 +id13338,id13333 +id13338,id13334 +id13338,id13335 +id13338,id13336 +id13338,id13337 +id13247,id12126 +id13247,id12156 +id13247,id12125 +id13247,id12132 +id13247,id12135 +id13351,id13346 +id13351,id13347 +id13351,id13348 +id13351,id13349 +id13351,id13350 diff --git a/blogdump.json b/blogdump.json new file mode 100644 index 0000000..2f19923 --- /dev/null +++ b/blogdump.json @@ -0,0 +1 @@ +[{"author": null, "timestamp": "2008-10-09T11:22:07+01:00", "section": "Templates", "title": "Lab SAXS Template", "content": {"html": "The following samples were run as described on the SAXSess instrument in the Edler group at the University of Bath. The samples were run in the capillary cell at a temperature of 25 C.


SampleExposure time (min)Run #Data
[[Blog]][[Box=5]][[Box=5]][[Blog]]
[[Blog]][[Box=5]][[Box=5]][[Blog]]
[[Blog]][[Box=5]][[Box=5]][[Blog]]
[[Blog]][[Box=5]][[Box=5]][[Blog]]
[[Blog]][[Box=5]][[Box=5]][[Blog]]
[[Blog]][[Box=5]][[Box=5]][[Blog]]
[[Blog]][[Box=5]][[Box=5]][[Blog]]
[[Blog]][[Box=5]][[Box=5]][[Blog]]

\n", "bbcode": "The following samples were run as described on the SAXSess instrument in the Edler group at the University of Bath. The samples were run in the capillary cell at a temperature of 25 C.\n\n[table]\n[row]Sample[col]Exposure time (min)[col]Run #[col]Data[/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Blog]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[/table]"}, "datestamp": "2008-10-09T11:22:07+01:00", "internal-links": [], "id": "75"}, {"author": null, "timestamp": "2008-10-09T11:32:10+01:00", "section": "Materials", "title": "GFP solution 5 mg/ml", "content": {"html": "Material: Solution
\nA 5mg/mL solution of GFP in Sortase Buffer prepared in Preparation of GFP solutions
This Post is Linked By: Preparation of GFP solutions;GFP SAXS data reduction;SAXS of GFP Samples;\n", "bbcode": "A 5mg/mL solution of GFP in [blog]76[/blog] prepared in [blog]79[/blog]"}, "datestamp": "2008-10-09T11:32:10+01:00", "internal-links": ["76", "79"], "id": "81"}, {"author": null, "timestamp": "2008-10-09T11:33:25+01:00", "section": "Materials", "title": "GFP solution 2 mg/ml", "content": {"html": "Material: Solution
\nA 2mg/mL solution of GFP in Sortase Buffer prepared in Preparation of GFP solutions
This Post is Linked By: Preparation of GFP solutions;\n", "bbcode": "A 2mg/mL solution of GFP in Sortase Buffer prepared in [blog]79[/blog]"}, "datestamp": "2008-10-09T11:33:25+01:00", "internal-links": ["79"], "id": "82"}, {"author": null, "timestamp": "2008-10-09T12:03:10+01:00", "section": "Materials", "title": "GFP solution 1 mg/ml", "content": {"html": "Material: Solution
\nA 2mg/mL solution of GFP in Sortase Buffer prepared in Preparation of GFP solutions
This Post is Linked By: Preparation of GFP solutions;SAXS of GFP Samples;\n", "bbcode": "A 2mg/mL solution of GFP in Sortase Buffer prepared in [blog]79[/blog]"}, "datestamp": "2008-10-09T12:03:10+01:00", "internal-links": ["79"], "id": "83"}, {"author": null, "timestamp": "2008-10-09T12:04:55+01:00", "section": "Procedures", "title": "Preparation of GFP solutions", "content": {"html": "Carried out by Maria Gomis-Gomis.

9.7 mg of Freeze dried GFP was resuspended in 970 uL of Sortase Buffer to yield GFP solution 10 mg/mL.

This solution was then diluted with Sortase Buffer to yield:

GFP solution 5 mg/ml
GFP solution 2 mg/ml
GFP solution 1 mg/ml
This Post is Linked By: GFP solution 5 mg/ml;GFP solution 2 mg/ml;GFP solution 1 mg/ml;GFP solution 10 mg/mL;\n", "bbcode": "Carried out by Maria Gomis-Gomis. \n\n9.7 mg of [blog]77[/blog] was resuspended in 970 uL of [blog]76[/blog] to yield [blog]78[/blog].\n\nThis solution was then diluted with [blog]76[/blog] to yield:\n\n[blog]81[/blog]\n[blog]82[/blog]\n[blog]83[/blog]"}, "datestamp": "2008-10-09T11:31:01+01:00", "internal-links": ["77", "76", "78", "76", "81", "82", "83"], "id": "79"}, {"author": null, "timestamp": "2008-10-09T16:06:36+01:00", "section": "Materials", "title": "Centrifuged 10 mg/mL GFP", "content": {"html": "Material: Solution
\nThe centrifuged product of Centrifugation of 10 mg/mL GFP solution
This Post is Linked By: Centrifugation of 10 mg/mL GFP solution;SAXS of GFP Samples;\n", "bbcode": "The centrifuged product of [blog]85[/blog]"}, "datestamp": "2008-10-09T16:06:36+01:00", "internal-links": ["85"], "id": "86"}, {"author": null, "timestamp": "2008-10-09T16:08:11+01:00", "section": "Materials", "title": "Centrifuged 2 mg/mL GFP", "content": {"html": "Material: Solution
\n Spun solution of GFP at 2 mg/mL from Centrifugation of 10 mg/mL GFP solution
This Post is Linked By: Centrifugation of 10 mg/mL GFP solution;SAXS of GFP Samples;\n", "bbcode": " Spun solution of GFP at 2 mg/mL from [blog]85[/blog]"}, "datestamp": "2008-10-09T16:08:11+01:00", "internal-links": ["85"], "id": "87"}, {"author": null, "timestamp": "2008-10-09T16:09:03+01:00", "section": "Materials", "title": "Centrifuged 5 mg/mL GFP", "content": {"html": "Material: Solution
\nSpun solution of GFP at 5 mg/mL from Centrifugation of 10 mg/mL GFP solution
This Post is Linked By: Centrifugation of 10 mg/mL GFP solution;SAXS of GFP Samples;\n", "bbcode": "Spun solution of GFP at 5 mg/mL from [blog]85[/blog]"}, "datestamp": "2008-10-09T16:09:03+01:00", "internal-links": ["85"], "id": "88"}, {"author": null, "timestamp": "2008-10-09T18:21:56+01:00", "section": "Data", "title": "SAXS Run 02075", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: GFP SAXS data reduction;SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T18:16:04+01:00", "internal-links": [], "id": "110"}, {"author": null, "timestamp": "2008-10-09T18:22:15+01:00", "section": "Data", "title": "SAXS Run 02074", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: GFP SAXS data reduction;SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T18:14:04+01:00", "internal-links": [], "id": "108"}, {"author": null, "timestamp": "2008-10-09T18:22:29+01:00", "section": "Data", "title": "SAXS Run 02073", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T16:16:15+01:00", "internal-links": [], "id": "97"}, {"author": null, "timestamp": "2008-10-09T18:22:48+01:00", "section": "Data", "title": "SAXS Run 02072", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T16:16:04+01:00", "internal-links": [], "id": "96"}, {"author": null, "timestamp": "2008-10-09T18:23:03+01:00", "section": "Data", "title": "SAXS Run 02071", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: GFP SAXS data reduction;SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T16:15:47+01:00", "internal-links": [], "id": "95"}, {"author": null, "timestamp": "2008-10-09T18:23:18+01:00", "section": "Data", "title": "SAXS Run 02070", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: GFP SAXS data reduction;SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T16:15:35+01:00", "internal-links": [], "id": "94"}, {"author": null, "timestamp": "2008-10-09T18:23:32+01:00", "section": "Data", "title": "SAXS Run 02069", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The processing was aborted because the image plate was misplaced on the reader.
This Post is Linked By: SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The processing was aborted because the image plate was misplaced on the reader."}, "datestamp": "2008-10-09T16:15:23+01:00", "internal-links": [], "id": "93"}, {"author": null, "timestamp": "2008-10-09T18:23:47+01:00", "section": "Data", "title": "SAXS Run 02068", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T16:15:11+01:00", "internal-links": [], "id": "92"}, {"author": null, "timestamp": "2008-10-09T18:24:49+01:00", "section": "Data", "title": "SAXS Run 02067", "content": {"html": "Data Type: SAXS_Lab
\nThe raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1.
This Post is Linked By: GFP SAXS data reduction;SAXS of GFP Samples;\n", "bbcode": "The raw image (tiff) was collected from the image plate and processed using SAXS quant software (mask file). The X-scale was normalised by finding the beam centre (Q=0) and resetting the scale to nm-1."}, "datestamp": "2008-10-09T16:14:13+01:00", "internal-links": [], "id": "91"}, {"author": null, "timestamp": "2008-10-10T14:57:10+01:00", "section": "Procedures", "title": "GFP SAXS data reduction", "content": {"html": "The pdh files generated in SAXS of GFP Samples were all binned from Q = 0.08 - 20 nm-1 to generate the associated bin files. The background SAXS Run 02067 was subtracted from all 30 minute sample runs to generate the associated sub files.

The rebinned data from SAXS Run 02067 and SAXS Run 02075 were summed to give 02075.add. This was used as the background for the 60 minute runs (SAXS Run 02071 and SAXS Run 02074) as well as for the sum of two runs of GFP solution 5 mg/ml designated 02070.add

All data files are provided at:
\t
http://research.google.com/datasets/id/grd20081000149/files#snapshot=2008-10-10

The background subtracted data were re-binned to generate the files designated #####b.bin. Binning range was selected to run from 0.25 nm-1 to where the scattering was deemed to reach noise levels (can be seen from the data files). The binned files were de-smeared using the provided Lake software with default parameters. These generated the associated des files.

All re-binned and de-smeared data files are provided at:

http://research.google.com/datasets/id/grd20081000177/files#snapshot=2008-10-10

The data from the 1mg/mL solution SAXS Run 02070 was not desmeared as after background subtraction it had very little signal.
This Post is Linked By: Maria's analysis of the GFP SAXS data;\n", "bbcode": "The pdh files generated in [blog]109[/blog] were all binned from Q = 0.08 - 20 nm-1 to generate the associated bin files. The background [blog]91[/blog] was subtracted from all 30 minute sample runs to generate the associated sub files. \n\nThe rebinned data from [blog]91[/blog] and [blog]110[/blog] were summed to give 02075.add. This was used as the background for the 60 minute runs ([blog]95[/blog] and [blog]108[/blog]) as well as for the sum of two runs of [blog]81[/blog] designated 02070.add\n\nAll data files are provided at:\n \t\nhttp://research.google.com/datasets/id/grd20081000149/files#snapshot=2008-10-10\n\nThe background subtracted data were re-binned to generate the files designated #####b.bin. Binning range was selected to run from 0.25 nm-1 to where the scattering was deemed to reach noise levels (can be seen from the data files). The binned files were de-smeared using the provided Lake software with default parameters. These generated the associated des files. \n\nAll re-binned and de-smeared data files are provided at:\n\nhttp://research.google.com/datasets/id/grd20081000177/files#snapshot=2008-10-10\n\nThe data from the 1mg/mL solution [blog]94[/blog] was not desmeared as after background subtraction it had very little signal."}, "datestamp": "2008-10-09T19:11:32+01:00", "internal-links": ["109", "91", "91", "110", "95", "108", "81", "94"], "id": "123"}, {"author": null, "timestamp": "2008-10-13T13:38:51+01:00", "section": "Procedures", "title": "Centrifugation of 10 mg/mL GFP solution", "content": {"html": "Aggregation was evident in the 10 mg/mL GFP solution so it was spun (10 minutes, 11krpm in Eppendorf benchtop centrifuge) to give Centrifuged 10 mg/mL GFP

From this solution fresh solutions of Centrifuged 5 mg/mL GFP and Centrifuged 2 mg/mL GFP
This Post is Linked By: Centrifuged 10 mg/mL GFP;Centrifuged 2 mg/mL GFP;Centrifuged 5 mg/mL GFP;\n", "bbcode": "Aggregation was evident in the 10 mg/mL GFP solution so it was spun (10 minutes, 11krpm in Eppendorf benchtop centrifuge) to give [blog]86[/blog] \n\nFrom this solution fresh solutions of [blog]88[/blog] and [blog]87[/blog]"}, "datestamp": "2008-10-09T16:06:16+01:00", "internal-links": ["86", "88", "87"], "id": "85"}, {"author": null, "timestamp": "2008-10-16T12:15:41+01:00", "section": "Materials", "title": "GFP (10 mg/mL) in D2O buffer", "content": {"html": "Material: Solution
\nA 10 mg/mL solution of GFP in D2O buffer prepared in Preparation of GFP Samples for a quickie SANS experiment on LOQ
This Post is Linked By: Preparation of GFP Samples for a quickie SANS experiment on LOQ;UV-Vis spectroscopy of GFP and Lysozyme samples;SANS on GFP concentration series;Comparison of SANS2d and LOQ GFP data;\n", "bbcode": "A 10 mg/mL solution of GFP in D2O buffer prepared in [blog]130[/blog]"}, "datestamp": "2008-10-16T12:15:41+01:00", "internal-links": ["130"], "id": "131"}, {"author": null, "timestamp": "2008-10-16T12:51:18+01:00", "section": "Materials", "title": "GFP 5 mg/mL in D2O buffer", "content": {"html": "Material: Solution
\nA 5 mg/mL solution of GFP in D2O phophate buffer prepared in Preparation of GFP Samples for a quickie SANS experiment on LOQ
This Post is Linked By: Preparation of GFP Samples for a quickie SANS experiment on LOQ;UV-Vis spectroscopy of GFP and Lysozyme samples;SANS on GFP concentration series;\n", "bbcode": "A 5 mg/mL solution of GFP in D2O phophate buffer prepared in [blog]130[/blog]"}, "datestamp": "2008-10-16T12:51:18+01:00", "internal-links": ["130"], "id": "132"}, {"author": null, "timestamp": "2008-10-16T12:51:55+01:00", "section": "Materials", "title": "GFP 2 mg/mL in D2O buffer", "content": {"html": "Material: Solution
\nAn approx 2mg/mL solution of GFP in D2O phosphate buffer prepared in
This Post is Linked By: Preparation of GFP Samples for a quickie SANS experiment on LOQ;UV-Vis spectroscopy of GFP and Lysozyme samples;SANS on GFP concentration series;\n", "bbcode": "An approx 2mg/mL solution of GFP in D2O phosphate buffer prepared in "}, "datestamp": "2008-10-16T12:51:55+01:00", "internal-links": [], "id": "133"}, {"author": null, "timestamp": "2008-10-16T12:55:24+01:00", "section": "Procedures", "title": "Preparation of GFP Samples for a quickie SANS experiment on LOQ", "content": {"html": "Freeze dried GFP (10.5 mg) was disolved in 1.00 mL of 20 mM phosphate buffer in D2O. After addition the tube and contents weighed 1.1010g. The solution was then spun for 10' (20k x g) (to give GFP (10 mg/mL) in D2O buffer.

The solution was then diluted (300 uL + 300 uL buffer) to give GFP 5 mg/mL in D2O buffer and then this solution was diluted further (100 uL + 150 uL of buffer) to give GFP 2 mg/mL in D2O buffer.
This Post is Linked By: GFP (10 mg/mL) in D2O buffer;GFP 5 mg/mL in D2O buffer;\n", "bbcode": "[blog]77[/blog] (10.5 mg) was disolved in 1.00 mL of 20 mM phosphate buffer in D2O. After addition the tube and contents weighed 1.1010g. The solution was then spun for 10' (20k x g) (to give [blog]131[/blog].\n\nThe solution was then diluted (300 uL + 300 uL buffer) to give [blog]132[/blog] and then this solution was diluted further (100 uL + 150 uL of buffer) to give [blog]133[/blog]."}, "datestamp": "2008-10-16T12:15:05+01:00", "internal-links": ["77", "131", "132", "133"], "id": "130"}, {"author": null, "timestamp": "2008-10-16T15:13:20+01:00", "section": "Materials", "title": "Lysozyme", "content": {"html": "Material: Powder
\nFisher lysozyme powder
This Post is Linked By: Preparation of lysozyme solutions for quickie SANS experiment;\n", "bbcode": "Fisher lysozyme powder"}, "datestamp": "2008-10-16T15:13:20+01:00", "internal-links": [], "id": "135"}, {"author": null, "timestamp": "2008-10-16T15:15:44+01:00", "section": "Materials", "title": "Lysozyme 10 mg/mL in D2O buffer", "content": {"html": "Material: Solution
\n10 mg/mL solution of lysozyme in D2O buffer preapred inPreparation of lysozyme solutions for quickie SANS experiment
This Post is Linked By: Preparation of lysozyme solutions for quickie SANS experiment;UV-Vis spectroscopy of GFP and Lysozyme samples;SANS on GFP concentration series;\n", "bbcode": "10 mg/mL solution of lysozyme in D2O buffer preapred in[blog]136[/blog]"}, "datestamp": "2008-10-16T15:15:44+01:00", "internal-links": ["136"], "id": "137"}, {"author": null, "timestamp": "2008-10-16T15:16:25+01:00", "section": "Materials", "title": "Lysozyme 2mg/mL", "content": {"html": "Material: Solution
\n2 mg/mL solution of lysozyme prepared in Preparation of lysozyme solutions for quickie SANS experiment
This Post is Linked By: Preparation of lysozyme solutions for quickie SANS experiment;UV-Vis spectroscopy of GFP and Lysozyme samples;SANS on GFP concentration series;\n", "bbcode": "2 mg/mL solution of lysozyme prepared in [blog]136[/blog]"}, "datestamp": "2008-10-16T15:16:25+01:00", "internal-links": ["136"], "id": "138"}, {"author": null, "timestamp": "2008-10-16T15:17:23+01:00", "section": "Procedures", "title": "Preparation of lysozyme solutions for quickie SANS experiment", "content": {"html": "Lysozyme (17.6 mg) was dissolved in D2O phophate buffer (880 uL) to give a 20 mg/mL solution. The solution was diluted (400uL + 400 uL buffer) to give Lysozyme 10 mg/mL in D2O buffer. This solution was diluted (100 uL + 400 uL of buffer) to give Lysozyme 2mg/mL.
This Post is Linked By: Lysozyme 10 mg/mL in D2O buffer;Lysozyme 2mg/mL;\n", "bbcode": "[blog]135[/blog] (17.6 mg) was dissolved in D2O phophate buffer (880 uL) to give a 20 mg/mL solution. The solution was diluted (400uL + 400 uL buffer) to give [blog]137[/blog]. This solution was diluted (100 uL + 400 uL of buffer) to give [blog]138[/blog]."}, "datestamp": "2008-10-16T15:15:30+01:00", "internal-links": ["135", "137", "138"], "id": "136"}, {"author": null, "timestamp": "2008-10-16T15:52:45+01:00", "section": "Materials", "title": "20 mM Phosphate buffer in D2O", "content": {"html": "Material: Solution
\nMade by Luke
This Post is Linked By: SANS on GFP concentration series;\n", "bbcode": "Made by Luke"}, "datestamp": "2008-10-16T15:52:45+01:00", "internal-links": [], "id": "141"}, {"author": null, "timestamp": "2008-10-20T11:32:11+01:00", "section": "Procedures", "title": "UV-Vis spectroscopy of GFP and Lysozyme samples", "content": {"html": "Procedure: UV-Vis
\nSamples were run in 1mm banjo cells that were used for the SANS experiment. The samples were held in place by white-tac. The JASCO UV-Vis spectrophotometer was zeroed with no samples and then the baseline checked and re-zeroed with two buffer samples. Spectra were recorded with buffer in the reference position.


SampleData
GFP (10 mg/mL) in D2O bufferUV-Vis spectrum of 10mg/mL GFP
GFP 5 mg/mL in D2O bufferUV-Vis spectrum of 5mg/mL GFP
GFP 2 mg/mL in D2O bufferUV-Vis spectrum of 2mg/mL GFP
Lysozyme 10 mg/mL in D2O bufferUV-Vis spectrum of 10mg/mL Lysozyme
Lysozyme 2mg/mLUV-Vis spectrum of 2 mg/mL Lysozyme


\n", "bbcode": "Samples were run in 1mm banjo cells that were used for the SANS experiment. The samples were held in place by white-tac. The JASCO UV-Vis spectrophotometer was zeroed with no samples and then the baseline checked and re-zeroed with two buffer samples. Spectra were recorded with buffer in the reference position.\n\n[table]\n[row]Sample[col]Data[/row]\n[row][blog]131[/blog][col][blog]144[/blog][/row]\n[row][blog]132[/blog][col][blog]147[/blog][/row]\n[row][blog]133[/blog][col][blog]150[/blog][/row]\n[row][blog]137[/blog][col][blog]153[/blog][/row]\n[row][blog]138[/blog][col][blog]156[/blog][/row]\n[/table]\n"}, "datestamp": "2008-10-20T11:32:11+01:00", "internal-links": ["131", "144", "132", "147", "133", "150", "137", "153", "138", "156"], "id": "171"}, {"author": null, "timestamp": "2008-10-20T11:39:49+01:00", "section": "Templates", "title": "LOQ SANS data template", "content": {"html": "The raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included.

[[Section>Data]]
[[Data_type>SANS_LOQ]]
\n", "bbcode": "The raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included.\n\n[[Section>Data]]\n[[Data_type>SANS_LOQ]]"}, "datestamp": "2008-10-09T16:12:42+01:00", "internal-links": [], "id": "90"}, {"author": null, "timestamp": "2008-10-20T11:41:14+01:00", "section": "Data", "title": "44700 - 10mg/mL GFP on LOQ", "content": {"html": "Data Type: SANS_LOQ
\nThe raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included.
This Post is Linked By: Initial analysis of SANS data on GFP;SANS on GFP concentration series;\n", "bbcode": "The raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included."}, "datestamp": "2008-10-20T11:40:22+01:00", "internal-links": [], "id": "174"}, {"author": null, "timestamp": "2008-10-20T12:03:44+01:00", "section": "Data", "title": "44701 - 5mg/mL GFP on LOQ", "content": {"html": "Data Type: SANS_LOQ
\nThe raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included.
This Post is Linked By: Initial analysis of SANS data on GFP;SANS on GFP concentration series;\n", "bbcode": "The raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included."}, "datestamp": "2008-10-20T12:02:57+01:00", "internal-links": [], "id": "178"}, {"author": null, "timestamp": "2008-10-20T12:04:36+01:00", "section": "Data", "title": "44702 - 2mg/mL GFP on LOQ", "content": {"html": "Data Type: SANS_LOQ
\nThe raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included.
This Post is Linked By: Initial analysis of SANS data on GFP;SANS on GFP concentration series;\n", "bbcode": "The raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included."}, "datestamp": "2008-10-20T12:03:58+01:00", "internal-links": [], "id": "182"}, {"author": null, "timestamp": "2008-10-20T12:05:30+01:00", "section": "Data", "title": "44703 - 10mg/mL Lysozyme on LOQ", "content": {"html": "Data Type: SANS_LOQ
\nThe raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included.
This Post is Linked By: Initial analysis of SANS data on GFP;SANS on GFP concentration series;Comparison of SANS2d and LOQ Lysozyme data;\n", "bbcode": "The raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included."}, "datestamp": "2008-10-20T12:04:54+01:00", "internal-links": [], "id": "186"}, {"author": null, "timestamp": "2008-10-20T12:06:41+01:00", "section": "Data", "title": "44704 - 2mg/mL Lysozyme on LOQ", "content": {"html": "Data Type: SANS_LOQ
\nThe raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included.
This Post is Linked By: Initial analysis of SANS data on GFP;SANS on GFP concentration series;\n", "bbcode": "The raw image files were corrected and processed using Collete and using a buffer background. SASXML and LOQ Q files are included."}, "datestamp": "2008-10-20T12:05:54+01:00", "internal-links": [], "id": "190"}, {"author": null, "timestamp": "2008-10-20T14:07:15+01:00", "section": "Procedures", "title": "Initial analysis of SANS data on GFP", "content": {"html": "The data from the following files was loaded into Excel and graphed. Data from 44700 - 10mg/mL GFP on LOQ, 44701 - 5mg/mL GFP on LOQ, and 44703 - 10mg/mL Lysozyme on LOQ was fairly good over the range of Q=0.01 - 0.1. Data from 44702 - 2mg/mL GFP on LOQ was ok and 44704 - 2mg/mL Lysozyme on LOQ wasn't really useable.

Guiner plots gave an Rg of ~24 A for GFP and the experimental data was well fitted by that generated from the pdb file 1gfl (http://www.pdb.org/pdb/explore/explore.do?structureId=1GFL) which is of a dimer. The Rg is consistent with a dimer. Trying to fit the data to that predicted from the monomer (prepared by deleting one chain from 1gfl) gave a very poor fit.

The lysozyme data is not fit well by data predicted from 2vb1 (http://www.pdb.org/pdb/explore.do?structureId=2VB1)
\n", "bbcode": "The data from the following files was loaded into Excel and graphed. Data from [blog]174[/blog], [blog]178[/blog], and [blog]186[/blog] was fairly good over the range of Q=0.01 - 0.1. Data from [blog]182[/blog] was ok and [blog]190[/blog] wasn't really useable.\n\nGuiner plots gave an Rg of ~24 A for GFP and the experimental data was well fitted by that generated from the pdb file 1gfl ([url]http://www.pdb.org/pdb/explore/explore.do?structureId=1GFL[/url]) which is of a dimer. The Rg is consistent with a dimer. Trying to fit the data to that predicted from the monomer (prepared by deleting one chain from 1gfl) gave a very poor fit.\n\nThe lysozyme data is not fit well by data predicted from 2vb1 ([url]http://www.pdb.org/pdb/explore.do?structureId=2VB1[/url])"}, "datestamp": "2008-10-20T14:06:35+01:00", "internal-links": ["174", "178", "186", "182", "190"], "id": "195"}, {"author": null, "timestamp": "2008-10-20T16:03:03+01:00", "section": "Data", "title": "UV-Vis spectrum of 2 mg/mL Lysozyme", "content": {"html": "Data Type: UV-VIS
\njws, jcamp, txt
This Post is Linked By: UV-Vis spectroscopy of GFP and Lysozyme samples;\n", "bbcode": "jws, jcamp, txt"}, "datestamp": "2008-10-17T12:18:30+01:00", "internal-links": [], "id": "156"}, {"author": null, "timestamp": "2008-10-20T16:03:42+01:00", "section": "Data", "title": "UV-Vis spectrum of 10mg/mL Lysozyme", "content": {"html": "Data Type: UV-VIS
\njws, jcamp, txt
This Post is Linked By: UV-Vis spectroscopy of GFP and Lysozyme samples;\n", "bbcode": "jws, jcamp, txt"}, "datestamp": "2008-10-17T12:17:34+01:00", "internal-links": [], "id": "153"}, {"author": null, "timestamp": "2008-10-20T16:04:13+01:00", "section": "Data", "title": "UV-Vis spectrum of 2mg/mL GFP", "content": {"html": "Data Type: UV-VIS
\njws file, jcamp, txt
This Post is Linked By: UV-Vis spectroscopy of GFP and Lysozyme samples;\n", "bbcode": "jws file, jcamp, txt"}, "datestamp": "2008-10-17T12:16:37+01:00", "internal-links": [], "id": "150"}, {"author": null, "timestamp": "2008-10-20T16:04:46+01:00", "section": "Data", "title": "UV-Vis spectrum of 5mg/mL GFP", "content": {"html": "Data Type: UV-VIS
\njws file, jcamp,txt
This Post is Linked By: UV-Vis spectroscopy of GFP and Lysozyme samples;\n", "bbcode": "jws file, jcamp,txt"}, "datestamp": "2008-10-17T12:14:10+01:00", "internal-links": [], "id": "147"}, {"author": null, "timestamp": "2008-10-20T16:05:22+01:00", "section": "Data", "title": "UV-Vis spectrum of 10mg/mL GFP", "content": {"html": "Data Type: UV-VIS
\nJWS file, jcamp, txt
This Post is Linked By: UV-Vis spectroscopy of GFP and Lysozyme samples;\n", "bbcode": "JWS file, jcamp, txt"}, "datestamp": "2008-10-17T12:10:13+01:00", "internal-links": [], "id": "144"}, {"author": null, "timestamp": "2008-10-20T16:11:52+01:00", "section": "Procedures", "title": "SANS on GFP concentration series", "content": {"html": "Procedure: SANS
\nInstrument: LOQ
\nThe following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length banjo cells cell at a temperature of 20 C. The data were reduced using Collette and the buffer as a background subtraction.


SampleExposure time (min)Run #Trans Run#Data
20 mM Phosphate buffer in D2O604469944687
GFP (10 mg/mL) in D2O buffer60447004468844700 - 10mg/mL GFP on LOQ
GFP 5 mg/mL in D2O buffer60447014468944701 - 5mg/mL GFP on LOQ
GFP 2 mg/mL in D2O buffer60447024469044702 - 2mg/mL GFP on LOQ
Lysozyme 10 mg/mL in D2O buffer60447034469144703 - 10mg/mL Lysozyme on LOQ
Lysozyme 2mg/mL60447044469244704 - 2mg/mL Lysozyme on LOQ

\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length banjo cells cell at a temperature of 20 C. The data were reduced using Collette and the buffer as a background subtraction.\n\n[table]\n[row]Sample[col]Exposure time (min)[col]Run #[col]Trans Run#[col]Data[/row]\n[row][blog]141[/blog][col]60[col]44699[col]44687[col][/row]\n[row][blog]131[/blog][col]60[col]44700[col]44688[col][blog]174[/blog][/row]\n[row][blog]132[/blog][col]60[col]44701[col]44689[col][blog]178[/blog][/row]\n[row][blog]133[/blog][col]60[col]44702[col]44690[col][blog]182[/blog][/row]\n[row][blog]137[/blog][col]60[col]44703[col]44691[col][blog]186[/blog][/row]\n[row][blog]138[/blog][col]60[col]44704[col]44692[col][blog]190[/blog][/row]\n[/table]"}, "datestamp": "2008-10-16T15:52:49+01:00", "internal-links": ["141", "131", "174", "132", "178", "133", "182", "137", "186", "138", "190"], "id": "142"}, {"author": null, "timestamp": "2008-10-20T16:12:50+01:00", "section": "Procedures", "title": "SAXS of GFP Samples", "content": {"html": "Procedure: SAXS_Lab
\nInstrument: SAXSess_Bath
\nThe following samples were run as described on the SAXSess instrument in the Edler group at the University of Bath. The samples were run in the capillary cell at a temperature of 25 C. Data was collected on the image plate provided and read using ImageQuant software provided with the image plate reader. The image was converted to 1D scattering data (I vs Q) using the SAXS Quant software provided.


SampleExposure time (min)Run #Data
Sortase Buffer3002067SAXS Run 02067
GFP solution 5 mg/ml3002068SAXS Run 02068
GFP solution 5 mg/ml3002069SAXS Run 02069
GFP solution 5 mg/ml3002070SAXS Run 02070
GFP solution 1 mg/ml6002071SAXS Run 02071
Centrifuged 10 mg/mL GFP3002072SAXS Run 02072
Centrifuged 5 mg/mL GFP3002073SAXS Run 02073
Centrifuged 2 mg/mL GFP6002074SAXS Run 02074
Sortase Buffer3002075SAXS Run 02075


Run #02069 was aborted because the image plate was misaligned in the image plate carousel. There is therefore no data file recorded.
This Post is Linked By: GFP SAXS data reduction;\n", "bbcode": "The following samples were run as described on the SAXSess instrument in the Edler group at the University of Bath. The samples were run in the capillary cell at a temperature of 25 C. Data was collected on the image plate provided and read using ImageQuant software provided with the image plate reader. The image was converted to 1D scattering data (I vs Q) using the SAXS Quant software provided.\n\n[table]\n[row]Sample[col]Exposure time (min)[col]Run #[col]Data[/row]\n[row][blog]76[/blog][col]30[col]02067[col][blog]91[/blog][/row]\n[row][blog]81[/blog][col]30[col]02068[col][blog]92[/blog][/row]\n[row][blog]81[/blog][col]30[col]02069[col][blog]93[/blog][/row]\n[row][blog]81[/blog][col]30[col]02070[col][blog]94[/blog][/row]\n[row][blog]83[/blog][col]60[col]02071[col][blog]95[/blog][/row]\n[row][blog]86[/blog][col]30[col]02072[col][blog]96[/blog][/row]\n[row][blog]88[/blog][col]30[col]02073[col][blog]97[/blog][/row]\n[row][blog]87[/blog][col]60[col]02074[col][blog]108[/blog][/row]\n[row][blog]76[/blog][col]30[col]02075[col][blog]110[/blog][/row]\n[/table]\n\nRun #02069 was aborted because the image plate was misaligned in the image plate carousel. There is therefore no data file recorded."}, "datestamp": "2008-10-09T18:14:20+01:00", "internal-links": ["76", "91", "81", "92", "81", "93", "81", "94", "83", "95", "86", "96", "88", "97", "87", "108", "76", "110"], "id": "109"}, {"author": null, "timestamp": "2008-10-27T13:45:50+00:00", "section": "Templates", "title": "oligo template", "content": {"html": "
PropertyData
Name[[box]]
Number[[box]]
Location[[box]]
Sequence[[box]]
Length[[box]]
Melting temp[[box]]
Supplier[[box]]
Stock concentration[[box]]


[[Section>Materials]]
[[DNA>oligonucleotide]]
[[Material>solution]]
\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col][[box]][/row]\n[row]Number[col][[box]][/row]\n[row]Location[col][[box]][/row]\n[row]Sequence[col][[box]][/row]\n[row]Length[col][[box]][/row]\n[row]Melting temp[col][[box]][/row]\n[row]Supplier[col][[box]][/row]\n[row]Stock concentration[col][[box]][/row][/table]\n\n[[Section>Materials]]\n[[DNA>oligonucleotide]]\n[[Material>solution]]"}, "datestamp": "2008-10-27T13:09:49+00:00", "internal-links": [], "id": "210"}, {"author": null, "timestamp": "2008-10-28T12:12:57+00:00", "section": "Note", "title": "Planning preparation of DNA for Laser Tweezers experiment", "content": {"html": "The background to this experiment is given in my old lab book here:
http://chemtools.chem.soton.ac.uk/projects/blog/blogs.php/bit_id/18571

As described the presumed final volume for the ligations reactions is the 50uL given in the supplementary information for this paper: PMID: 12947199. There is sufficient DNA for each of the oligos to make 100 uM stocks which will make it easy to add relatively small volumes for each ligation step.

The overall plan is therefore to make 100 uM stocks of the oligos in straight Tris buffer. For each oligo I will then do a kinase reaction at ~100 uM oligo (i.e. by just adding the reagents). The Lambda DNA is 0.33 ug/uL which is very close to 1x10-8 M as required by the described method. Unfortunately it is in a Tris-EDTA buffer which will probably interfere with the kinase and ligation reactions. I will therefore take 100 uL and ethanol ppt it as Luke has recently made up buffers for this.

The ligation of the first (biotin end) then follows by mixing the lambda (10-8 M) with Oligo-lambda-biotin (10-7 M) and annealing followed by ligation. This mixture is then combined with the appropriate combination of end oligos (Oligo-TerRlam and Oligo-TerR or Oligo-TerFlam andOligo-TerF at 10-6 M) followed by annealing and ligation.

As the amount of biotinylated lamda we want is relatively small contamination with the biotin oligo shouldn't be a problem. If this seems to cause issues we can easily ethanol ppt during the experiment.

I think it will be advisable to get fresh PNK and ligase for this along with fresh ATP to rule out any problems with the enzymes. These are now ordered so we are right to go tomorrow or Thursday. Will attempt to sort out ethanol ppt of lambda this afternoon and make sure buffers are together.
\n", "bbcode": "The background to this experiment is given in my old lab book here:\nhttp://chemtools.chem.soton.ac.uk/projects/blog/blogs.php/bit_id/18571\n\nAs described the presumed final volume for the ligations reactions is the 50uL given in the supplementary information for this paper: [pubmed]12947199[/pubmed]. There is sufficient DNA for each of the oligos to make 100 uM stocks which will make it easy to add relatively small volumes for each ligation step.\n\nThe overall plan is therefore to make 100 uM stocks of the oligos in straight Tris buffer. For each oligo I will then do a kinase reaction at ~100 uM oligo (i.e. by just adding the reagents). The [blog]228[/blog] is 0.33 ug/uL which is very close to 1x10-8 M as required by the described method. Unfortunately it is in a Tris-EDTA buffer which will probably interfere with the kinase and ligation reactions. I will therefore take 100 uL and ethanol ppt it as Luke has recently made up buffers for this.\n\nThe ligation of the first (biotin end) then follows by mixing the lambda (10-8 M) with [blog]224[/blog] (10-7 M) and annealing followed by ligation. This mixture is then combined with the appropriate combination of end oligos ([blog]221[/blog] and [blog]218[/blog] or [blog]214[/blog] and[blog]211[/blog] at 10-6 M) followed by annealing and ligation.\n\nAs the amount of biotinylated lamda we want is relatively small contamination with the biotin oligo shouldn't be a problem. If this seems to cause issues we can easily ethanol ppt during the experiment.\n\nI think it will be advisable to get fresh PNK and ligase for this along with fresh ATP to rule out any problems with the enzymes. These are now ordered so we are right to go tomorrow or Thursday. Will attempt to sort out ethanol ppt of lambda this afternoon and make sure buffers are together."}, "datestamp": "2008-10-27T15:01:53+00:00", "internal-links": ["228", "224", "221", "218", "214", "211"], "id": "231"}, {"author": null, "timestamp": "2008-10-28T15:37:39+00:00", "section": "Materials", "title": "Ethanol precipitated lambda DNA", "content": {"html": "Material: Solution
\nLambda DNA resuspended in nuclease free water produced in Ethanol precipitation of lambda DNA
This Post is Linked By: Phosphorylation of DNA substrates for laser tweezers experiment;Ethanol precipitation of lambda DNA;\n", "bbcode": "Lambda DNA resuspended in nuclease free water produced in [blog]239[/blog]"}, "datestamp": "2008-10-28T15:35:18+00:00", "internal-links": ["239"], "id": "240"}, {"author": null, "timestamp": "2008-11-05T16:02:10+00:00", "section": "Materials", "title": "Phosphorylated TerR lam", "content": {"html": "Material: Solution
\nDna: oligonucleotide
\nPrepared in Phosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;First preparation of beads for laser tweezers experiment;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "Prepared in [blog]261[/blog]"}, "datestamp": "2008-11-05T16:02:10+00:00", "internal-links": ["261"], "id": "263"}, {"author": null, "timestamp": "2008-11-05T16:02:43+00:00", "section": "Materials", "title": "Phosporylated TerR", "content": {"html": "Material: Solution
\nDna: oligonucleotide
\nPrepared in Phosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "Prepared in [blog]261[/blog]"}, "datestamp": "2008-11-05T16:02:43+00:00", "internal-links": ["261"], "id": "264"}, {"author": null, "timestamp": "2008-11-05T16:04:45+00:00", "section": "Materials", "title": "Phosphorylated TerFlam", "content": {"html": "Material: Solution
\nDna: oligonucleotide
\nPrepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "Prepared in[blog]261[/blog]"}, "datestamp": "2008-11-05T16:03:13+00:00", "internal-links": ["261"], "id": "265"}, {"author": null, "timestamp": "2008-11-05T16:05:58+00:00", "section": "Materials", "title": "Phosphorylated oligo-lambda-biotin", "content": {"html": "Material: Solution
\nDna: oligonucleotide
\nprepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of oligo-biotin-lambda to lambda DNA;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "prepared in[blog]261[/blog]"}, "datestamp": "2008-11-05T16:05:58+00:00", "internal-links": ["261"], "id": "269"}, {"author": null, "timestamp": "2008-11-05T17:08:20+00:00", "section": "Materials", "title": "Product of ligation of lambda to lambda-oligo-biotin", "content": {"html": "Material: Solution
\nDna: double_stranded_linear
\nThe product of Ligation of oligo-biotin-lambda to lambda DNA
This Post is Linked By: Ligation of oligo-biotin-lambda to lambda DNA;Ligation of Tus adaptors to biotin-modified lambda;\n", "bbcode": "The product of [blog]273[/blog]"}, "datestamp": "2008-11-05T17:08:20+00:00", "internal-links": ["273"], "id": "275"}, {"author": null, "timestamp": "2008-11-05T17:08:39+00:00", "section": "Materials", "title": "Phosphorylated lambda DNA", "content": {"html": "Material: Solution
\nDna: double_stranded_linear
\nPhosphorylated lambda DNA prepared in Phosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of oligo-biotin-lambda to lambda DNA;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "Phosphorylated lambda DNA prepared in [blog]261[/blog]"}, "datestamp": "2008-11-05T16:01:05+00:00", "internal-links": ["261"], "id": "262"}, {"author": null, "timestamp": "2008-11-05T17:29:54+00:00", "section": "Procedures", "title": "Ligation of oligo-biotin-lambda to lambda DNA", "content": {"html": "Procedure: DNA_ligation
\nPhosphorylated lambda DNA (250 uL) and Phosphorylated oligo-lambda-biotin (0.5 uL) were combined and heated to 50 C followed by slow cooling over one hour. To this solution was added 5 x T4 DNA ligase buffer (1 uL) and the solution incubated overnight at 16 C to give Product of ligation of lambda to lambda-oligo-biotin.

This procedure follows that in PMID: 12947199 (supplementary information) except for a longer ligation period.
This Post is Linked By: Product of ligation of lambda to lambda-oligo-biotin;\n", "bbcode": "[blog]262[/blog] (250 uL) and [blog]269[/blog] (0.5 uL) were combined and heated to 50 C followed by slow cooling over one hour. To this solution was added [blog]272[/blog] (1 uL) and the solution incubated overnight at 16 C to give [blog]275[/blog]. \n\nThis procedure follows that in [pubmed]12947199[/pubmed] (supplementary information) except for a longer ligation period."}, "datestamp": "2008-11-05T17:06:34+00:00", "internal-links": ["262", "269", "272", "275"], "id": "273"}, {"author": null, "timestamp": "2008-11-05T17:30:52+00:00", "section": "Materials", "title": "Phosphorylated TerF", "content": {"html": "Material: Solution
\nDna: oligonucleotide
\nPrepared inPhosphorylation of DNA substrates for laser tweezers experiment
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "Prepared in[blog]261[/blog]"}, "datestamp": "2008-11-05T16:03:43+00:00", "internal-links": ["261"], "id": "266"}, {"author": null, "timestamp": "2008-11-05T17:31:13+00:00", "section": "Materials", "title": "Oligo-lambda-biotin", "content": {"html": "Dna: oligonucleotide
\nMaterial: Solution
\n
PropertyData
Namelambda-biotin
Number
LocationFreezer 1 - Cameron's box
Sequence5'-Agg TCg CCg CCC AAA AAA AAA AAA AAA AAA AA-biotin-3'
Length32
Melting temp
SupplierInvitrogen
Stock concentration

This Post is Linked By: Planning preparation of DNA for Laser Tweezers experiment;Preparing fresh polymer-DNA beads for lasers experiment;Examining silica beads for stickiness to surface;Polymer beads with low loading of lambda-biotin-DNA;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col]lambda-biotin[/row]\n[row]Number[col][/row]\n[row]Location[col]Freezer 1 - Cameron's box[/row]\n[row]Sequence[col]5'-Agg TCg CCg CCC AAA AAA AAA AAA AAA AAA AA-biotin-3'[/row]\n[row]Length[col]32[/row]\n[row]Melting temp[col][/row]\n[row]Supplier[col]Invitrogen[/row]\n[row]Stock concentration[col][/row][/table]"}, "datestamp": "2008-10-27T14:14:48+00:00", "internal-links": [], "id": "224"}, {"author": null, "timestamp": "2008-11-05T17:31:31+00:00", "section": "Materials", "title": "Oligo-TerRlam", "content": {"html": "Dna: oligonucleotide
\nMaterial: Solution
\n
PropertyData
NameTerRlam
Number
LocationFreezer 1 - Cameron's box
Sequenceggg Cgg CgA CCTATAAGTATGTTGTAACTAAAG
Length33
Melting temp
SupplierInvitrogen
Stock concentration

This Post is Linked By: Planning preparation of DNA for Laser Tweezers experiment;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col]TerRlam[/row]\n[row]Number[col][/row]\n[row]Location[col]Freezer 1 - Cameron's box[/row]\n[row]Sequence[col]ggg Cgg CgA CCTATAAGTATGTTGTAACTAAAG[/row]\n[row]Length[col]33[/row]\n[row]Melting temp[col][/row]\n[row]Supplier[col]Invitrogen[/row]\n[row]Stock concentration[col][/row][/table]"}, "datestamp": "2008-10-27T13:48:01+00:00", "internal-links": [], "id": "221"}, {"author": null, "timestamp": "2008-11-05T17:31:52+00:00", "section": "Materials", "title": "Oligo-TerR", "content": {"html": "Dna: oligonucleotide
\nMaterial: Solution
\n
PropertyData
NameTerR
Number
LocationFreezer 1 - Cameron's box
SequenceCTTTAGTTACAACATACTTAT
Length21
Melting temp
SupplierInvitrogen
Stock concentration

This Post is Linked By: Planning preparation of DNA for Laser Tweezers experiment;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col]TerR[/row]\n[row]Number[col][/row]\n[row]Location[col]Freezer 1 - Cameron's box[/row]\n[row]Sequence[col]CTTTAGTTACAACATACTTAT[/row]\n[row]Length[col]21[/row]\n[row]Melting temp[col][/row]\n[row]Supplier[col]Invitrogen[/row]\n[row]Stock concentration[col][/row][/table]"}, "datestamp": "2008-10-27T13:46:50+00:00", "internal-links": [], "id": "218"}, {"author": null, "timestamp": "2008-11-05T17:32:16+00:00", "section": "Materials", "title": "Oligo-TerFlam", "content": {"html": "Dna: oligonucleotide
\nMaterial: Solution
\n
PropertyData
NameTerFlam
Number
LocationFreezer 1 - Cameron's box
Sequenceggg Cgg CgA CCT CTTTAGTTACAACATACTTAT
Length33
Melting temp
SupplierInvitrogen
Stock concentration

This Post is Linked By: Planning preparation of DNA for Laser Tweezers experiment;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col]TerFlam[/row]\n[row]Number[col][/row]\n[row]Location[col]Freezer 1 - Cameron's box[/row]\n[row]Sequence[col]ggg Cgg CgA CCT CTTTAGTTACAACATACTTAT[/row]\n[row]Length[col]33[/row]\n[row]Melting temp[col][/row]\n[row]Supplier[col]Invitrogen[/row]\n[row]Stock concentration[col][/row][/table]"}, "datestamp": "2008-10-27T13:44:58+00:00", "internal-links": [], "id": "214"}, {"author": null, "timestamp": "2008-11-05T17:32:48+00:00", "section": "Materials", "title": "Oligo-TerF", "content": {"html": "Dna: oligonucleotide
\nMaterial: Solution
\n
PropertyData
NameTerF
Number
LocationFreezer 1 - Cameron's box
SequenceATAAGTATGTTGTAACTAAAG
Length21
Melting temp
SupplierInvitrogen
Stock concentration

This Post is Linked By: Planning preparation of DNA for Laser Tweezers experiment;Phosphorylation of DNA substrates for laser tweezers experiment;\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col]TerF[/row]\n[row]Number[col][/row]\n[row]Location[col]Freezer 1 - Cameron's box[/row]\n[row]Sequence[col]ATAAGTATGTTGTAACTAAAG[/row]\n[row]Length[col]21[/row]\n[row]Melting temp[col][/row]\n[row]Supplier[col]Invitrogen[/row]\n[row]Stock concentration[col][/row][/table]"}, "datestamp": "2008-10-27T13:41:00+00:00", "internal-links": [], "id": "211"}, {"author": null, "timestamp": "2008-11-05T17:33:08+00:00", "section": "Materials", "title": "Sortase Buffer", "content": {"html": "Material: Solution
\nPrepared by Maria Gomis-Gomis at the University of Southampton.


PropertyData
NameSortase buffer
Expiry
pH7.5
Tris-HCl50 mM
NaCl100 mM
CaCl25 mM

This Post is Linked By: GFP solution 5 mg/ml;Preparation of GFP solutions;SAXS of GFP Samples;\n", "bbcode": "Prepared by Maria Gomis-Gomis at the University of Southampton. \n\n[table]\n[mrow]Property[mcol]Data[/mrow]\n[row]Name[col]Sortase buffer[/row]\n[row]Expiry[col][/row]\n[row]pH[col]7.5[/row]\n[row]Tris-HCl[col]50 mM[/row]\n[row]NaCl[col]100 mM[/row]\n[row]CaCl2[col]5 mM[/row]\n[/table]"}, "datestamp": "2008-10-09T11:24:25+01:00", "internal-links": [], "id": "76"}, {"author": null, "timestamp": "2008-11-05T17:34:43+00:00", "section": "Materials", "title": "GFP solution 10 mg/mL", "content": {"html": "Material: Solution
\nThe solution of GFP prepared in Preparation of GFP solutions
This Post is Linked By: Preparation of GFP solutions;\n", "bbcode": "The solution of GFP prepared in [blog]79[/blog]"}, "datestamp": "2008-10-09T11:30:01+01:00", "internal-links": ["79"], "id": "78"}, {"author": null, "timestamp": "2008-11-05T17:35:00+00:00", "section": "Materials", "title": "Freeze dried GFP", "content": {"html": "Material: Solution
\nGFP prepared by Luke Clifton and Mark Telling. This has been purified by Ni-NTA chromatography but not further purified. A fluffy yellow powder. This specific sample given to Maria Gomis-Gomis at Southampton University for SAXS and MS experiments
This Post is Linked By: Preparation of GFP solutions;Preparation of GFP Samples for a quickie SANS experiment on LOQ;\n", "bbcode": "GFP prepared by Luke Clifton and Mark Telling. This has been purified by Ni-NTA chromatography but not further purified. A fluffy yellow powder. This specific sample given to Maria Gomis-Gomis at Southampton University for SAXS and MS experiments"}, "datestamp": "2008-10-09T11:26:29+01:00", "internal-links": [], "id": "77"}, {"author": null, "timestamp": "2008-11-06T10:22:35+00:00", "section": "Materials", "title": "1:100 gly-OH modified silica beads", "content": {"html": "Material: Powder
\nSilica beads
This Post is Linked By: Ammonia treatment of gly modified beads;\n", "bbcode": "Silica beads"}, "datestamp": "2008-11-06T10:22:35+00:00", "internal-links": [], "id": "287"}, {"author": null, "timestamp": "2008-11-06T10:23:26+00:00", "section": "Materials", "title": "1:1000 gly-OH modified silica beads", "content": {"html": "Material: Powder
\nbeads
This Post is Linked By: Ammonia treatment of gly modified beads;\n", "bbcode": "beads"}, "datestamp": "2008-11-06T10:23:26+00:00", "internal-links": [], "id": "288"}, {"author": null, "timestamp": "2008-11-06T10:23:50+00:00", "section": "Materials", "title": "1:10000 gly-OH modified silica beads", "content": {"html": "Material: Powder
\nbeads
This Post is Linked By: Ammonia treatment of gly modified beads;\n", "bbcode": "beads"}, "datestamp": "2008-11-06T10:23:50+00:00", "internal-links": [], "id": "289"}, {"author": null, "timestamp": "2008-11-06T10:24:40+00:00", "section": "Materials", "title": "1:100000 gly-OH modified silica beads", "content": {"html": "Material: Powder
\nbeads
This Post is Linked By: Ammonia treatment of gly modified beads;\n", "bbcode": "beads"}, "datestamp": "2008-11-06T10:24:40+00:00", "internal-links": [], "id": "290"}, {"author": null, "timestamp": "2008-11-06T11:28:42+00:00", "section": "Materials", "title": "TerF-lambda-biotin construct", "content": {"html": "Material: Solution
\nDna: double_stranded_linear
\nProduct #1 of Ligation of Tus adaptors to biotin-modified lambda
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;\n", "bbcode": "Product #1 of [blog]294[/blog]"}, "datestamp": "2008-11-06T11:28:21+00:00", "internal-links": ["294"], "id": "295"}, {"author": null, "timestamp": "2008-11-06T11:48:48+00:00", "section": "Procedures", "title": "Ligation of Tus adaptors to biotin-modified lambda", "content": {"html": "Procedure: DNA_ligation
\nTo Product of ligation of lambda to lambda-oligo-biotin was added the adaptors as given below. The solutions were heated to 65 C and then cooled over approximately one hour. Fresh ATP (0.5 uL of 10 mM) and T4 DNA ligase (1 uL of 1U/uL) were then added and the solutions incubated at 16 C for two hours.


#Product of ligation of lambda to lambda-oligo-biotin (uL)Adaptor 1uLAdaptor 2uLProduct
150Phosphorylated TerR0.5Phosphorylated TerRlam0.5TerF-lambda-biotin construct
250Phosporylated TerR0.5Phosphorylated TerR lam0.5TerR-lambda-biotin construct


Note that Rxn #1 is actually Ter forward. It shows as TerR because of a mistake with the original title of the material posts.
This Post is Linked By: TerF-lambda-biotin construct;TerR-lambda-biotin construct;\n", "bbcode": "To [blog]275[/blog] was added the adaptors as given below. The solutions were heated to 65 C and then cooled over approximately one hour. Fresh ATP (0.5 uL of 10 mM) and [blog]271[/blog] (1 uL of 1U/uL) were then added and the solutions incubated at 16 C for two hours.\n\n[table]\n[row]#[col][blog]275[/blog] (uL)[col]Adaptor 1[col]uL[col]Adaptor 2[col]uL[col]Product[/row]\n[row]1[col]50[col][blog]266[/blog][col]0.5[col][blog]265[/blog][col]0.5[col][blog]295[/blog][/row]\n[row]2[col]50[col][blog]264[/blog][col]0.5[col][blog]263[/blog][col]0.5[col][blog]298[/blog][/row]\n[/table]\n\nNote that Rxn #1 is actually Ter forward. It shows as TerR because of a mistake with the original title of the material posts."}, "datestamp": "2008-11-06T11:14:54+00:00", "internal-links": ["275", "271", "275", "266", "265", "295", "264", "263", "298"], "id": "294"}, {"author": null, "timestamp": "2008-11-06T11:53:11+00:00", "section": "Materials", "title": "1:100 gly-oh beads after ammonia treatment", "content": {"html": "Material: Powder
\nProduct #1 from Ammonia treatment of gly modified beads
This Post is Linked By: Fresh beads for Laser Tweezers experiments;First preparation of beads for laser tweezers experiment;\n", "bbcode": "Product #1 from [blog]291[/blog]"}, "datestamp": "2008-11-06T11:53:11+00:00", "internal-links": ["291"], "id": "300"}, {"author": null, "timestamp": "2008-11-06T11:53:45+00:00", "section": "Materials", "title": "1:1000 gly-OH beads after ammonia treatment", "content": {"html": "Material: Powder
\nProduct #2 of Ammonia treatment of gly modified beads
This Post is Linked By: Fresh beads for Laser Tweezers experiments;\n", "bbcode": "Product #2 of [blog]291[/blog]"}, "datestamp": "2008-11-06T11:53:45+00:00", "internal-links": ["291"], "id": "301"}, {"author": null, "timestamp": "2008-11-06T11:54:16+00:00", "section": "Materials", "title": "1:10000 gly-OH beads after ammonia treatment", "content": {"html": "Material: Powder
\nProduct #3 ofAmmonia treatment of gly modified beads
This Post is Linked By: Fresh beads for Laser Tweezers experiments;\n", "bbcode": "Product #3 of[blog]291[/blog]"}, "datestamp": "2008-11-06T11:54:16+00:00", "internal-links": ["291"], "id": "302"}, {"author": null, "timestamp": "2008-11-06T11:54:46+00:00", "section": "Materials", "title": "1:100,000 gly-OH beads after ammonia treatment", "content": {"html": "Material: Powder
\nproduct #4 of Ammonia treatment of gly modified beads
This Post is Linked By: Fresh beads for Laser Tweezers experiments;\n", "bbcode": "product #4 of [blog]291[/blog]"}, "datestamp": "2008-11-06T11:54:46+00:00", "internal-links": ["291"], "id": "303"}, {"author": null, "timestamp": "2008-11-06T12:16:50+00:00", "section": "Procedures", "title": "Ammonia treatment of gly modified beads", "content": {"html": "Procedure: Chemistry
\nA sample of the silica beads previously prepared were treated with aqueous ammonia (200 uL) for 30' at 65 C as given.


BeadsWeight (mg)Product
1:100 gly-OH modified silica beads20.96
1:1000 gly-OH modified silica beads31.26
1:10000 gly-OH modified silica beads26.57
1:100000 gly-OH modified silica beads20.92


After addition of the ammonia the beads rapidly dispersed. A quick spin seemed to show there was still some beads there so hopefully not dissolved.

Beads were washed five times with ~1 mL of water and then dried in the freeze drier. Beads seem to be ok after washing.
This Post is Linked By: 1:100 gly-oh beads after ammonia treatment;1:1000 gly-OH beads after ammonia treatment;1:10000 gly-OH beads after ammonia treatment;1:100,000 gly-OH beads after ammonia treatment;\n", "bbcode": "A sample of the silica beads previously prepared were treated with aqueous ammonia (200 uL) for 30' at 65 C as given.\n\n[table]\n[row]Beads[col]Weight (mg)[col]Product[/row]\n[row][blog]287[/blog][col]20.96[col][/row]\n[row][blog]288[/blog][col]31.26[col][/row]\n[row][blog]289[/blog][col]26.57[col][/row]\n[row][blog]290[/blog][col]20.92[col][/row]\n[/table]\n\nAfter addition of the ammonia the beads rapidly dispersed. A quick spin seemed to show there was still some beads there so hopefully not dissolved.\n\nBeads were washed five times with ~1 mL of water and then dried in the freeze drier. Beads seem to be ok after washing."}, "datestamp": "2008-11-06T10:27:35+00:00", "internal-links": ["287", "288", "289", "290"], "id": "291"}, {"author": null, "timestamp": "2008-11-07T11:24:56+00:00", "section": "Procedures", "title": "Maria's analysis of the GFP SAXS data", "content": {"html": "Procedure: Data_analysis
\nMaria Gomis-Gomis has done some analysis of Rg and I(0) values from the SAXS data that is described in GFP SAXS data reduction.

The Rgs are broadly consistent with the SANS data for the 5mg/mL and 2 mg/mL samples. The I(0) values do not appear consistent suggesting issues with background subtraction that will need to be looked at.
\n", "bbcode": "Maria Gomis-Gomis has done some analysis of Rg and I(0) values from the SAXS data that is described in [blog]123[/blog].\n\nThe Rgs are broadly consistent with the SANS data for the 5mg/mL and 2 mg/mL samples. The I(0) values do not appear consistent suggesting issues with background subtraction that will need to be looked at."}, "datestamp": "2008-11-07T11:23:34+00:00", "internal-links": ["123"], "id": "305"}, {"author": null, "timestamp": "2008-11-11T15:48:39+00:00", "section": "Materials", "title": "TerR-lambda-biotin construct", "content": {"html": "Material: Solution
\nDna: double_stranded_linear
\nProduct #2 of Ligation of Tus adaptors to biotin-modified lambda
This Post is Linked By: Ligation of Tus adaptors to biotin-modified lambda;Preparing fresh polymer-DNA beads for lasers experiment;Examining silica beads for stickiness to surface;Polymer beads with low loading of lambda-biotin-DNA;\n", "bbcode": "Product #2 of [blog]294[/blog]"}, "datestamp": "2008-11-06T11:47:08+00:00", "internal-links": ["294"], "id": "298"}, {"author": null, "timestamp": "2008-11-12T14:10:53+00:00", "section": "Materials", "title": "Bangs Labs streptavidin coated beads", "content": {"html": "Material: Suspension
\nto be filled in
This Post is Linked By: Preparing fresh polymer-DNA beads for lasers experiment;First preparation of beads for laser tweezers experiment;\n", "bbcode": "to be filled in"}, "datestamp": "2008-11-12T14:10:53+00:00", "internal-links": [], "id": "352"}, {"author": null, "timestamp": "2008-11-14T12:14:36+00:00", "section": "Procedures", "title": "Preparing fresh polymer-DNA beads for lasers experiment", "content": {"html": "Project: Laser_tweezers_tus
\nBangs Labs streptavidin coated beads (20 uL) were mixed with TerR-lambda-biotin construct (1 uL) and incubated for 30 minutes. The beads were washed twice with 1 mL of 5 mM Tris-HCl pH 7.5, 1 M NaCl.

Bangs Labs streptavidin coated beads (20 uL) were mixed with TerR-lambda-biotin construct (1 uL) and Oligo-lambda-biotin (1 uL) and incubated for 30 minutes. The beads were washed twice with 1 mL of 5 mM Tris-HCl pH 7.5, 1 M NaCl and then 3 x 100 mM NaCl.
\n", "bbcode": "[blog]352[/blog] (20 uL) were mixed with [blog]298[/blog] (1 uL) and incubated for 30 minutes. The beads were washed twice with 1 mL of 5 mM Tris-HCl pH 7.5, 1 M NaCl.\n\n[blog]352[/blog] (20 uL) were mixed with [blog]298[/blog] (1 uL) and [blog]224[/blog] (1 uL) and incubated for 30 minutes. The beads were washed twice with 1 mL of 5 mM Tris-HCl pH 7.5, 1 M NaCl and then 3 x 100 mM NaCl."}, "datestamp": "2008-11-14T10:21:15+00:00", "internal-links": ["352", "298", "352", "298", "224"], "id": "375"}, {"author": null, "timestamp": "2008-11-14T17:12:14+00:00", "section": "Note", "title": "Examining silica beads for stickiness to surface", "content": {"html": "Project: Laser_tweezers_tus
\nA quick check on labelled 100:1 beads and 100,000:1 beads indicate that both are very sticky when suspended in water or buffer. it seems possible to disperse them from the top and catch a few which may be viable for experiments but a bit of a pain.

More comprehensive analysis:

In 100 mM all appear to be sticky and also sticking to themselves. Beads are forming aggregates much worse than they were before.

All beads sets are extremely sticky in 100 mM, 50 mM, 0mM NaCl buffer. Beads themselves are more sticky, probably due to being shaken overnight in water but aggregates seem loose so sonication should clear things up. Not much good for easy interaction studies though.

Polymer beads when settled seem to be possible to pull back off the surface with the tweezers. After 10-15 minutes it is still possible to pull polymer beads (with DNA) off the surface with the traps. After 30 minutes it is getting harder to find easily trappable beads but there are still plenty about.

But there seems to be significant differences between different cells. Sticking in some but not others. Beads treated with TerR-lambda-biotin construct plus Oligo-lambda-biotin seem to be less prone to sticking than those just treated with TerR-lambda-biotin construct.
\n", "bbcode": "A quick check on labelled 100:1 beads and 100,000:1 beads indicate that both are very sticky when suspended in water or buffer. it seems possible to disperse them from the top and catch a few which may be viable for experiments but a bit of a pain.\n\nMore comprehensive analysis:\n\nIn 100 mM all appear to be sticky and also sticking to themselves. Beads are forming aggregates much worse than they were before.\n\nAll beads sets are extremely sticky in 100 mM, 50 mM, 0mM NaCl buffer. Beads themselves are more sticky, probably due to being shaken overnight in water but aggregates seem loose so sonication should clear things up. Not much good for easy interaction studies though.\n\nPolymer beads when settled seem to be possible to pull back off the surface with the tweezers. After 10-15 minutes it is still possible to pull polymer beads (with DNA) off the surface with the traps. After 30 minutes it is getting harder to find easily trappable beads but there are still plenty about.\n\nBut there seems to be significant differences between different cells. Sticking in some but not others. Beads treated with [blog]298[/blog] plus [blog]224[/blog] seem to be less prone to sticking than those just treated with [blog]298[/blog]."}, "datestamp": "2008-11-14T12:14:20+00:00", "internal-links": ["298", "224", "298"], "id": "379"}, {"author": null, "timestamp": "2008-11-16T11:21:52+00:00", "section": "Materials", "title": "Octameric rck domain from MthK in D2O buffer", "content": {"html": "Material: Solution
\nProject: mthk
\nOctameric rck domain in 20 mM Tris-pD 8.0, 250 mM NaCl, in D2O. Prepared by Luke by performing gel filtration at pH 8.0
This Post is Linked By: SANS runs on octameric RCK;Additional runs on octameric Rck;Addition of Ca++ to octameric mthk sample;Dialysis of Octameric RCK samples;\n", "bbcode": "Octameric rck domain in 20 mM Tris-pD 8.0, 250 mM NaCl, in D2O. Prepared by Luke by performing gel filtration at pH 8.0"}, "datestamp": "2008-11-16T11:21:24+00:00", "internal-links": [], "id": "387"}, {"author": null, "timestamp": "2008-11-16T12:42:38+00:00", "section": "Templates", "title": "SANS on LOQ template", "content": {"html": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]



[[Section>Procedures]]
[[Procedure>SANS]]
[[Instrument>LOQ]]
\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[/table]\n\n\n[[Section>Procedures]]\n[[Procedure>SANS]]\n[[Instrument>LOQ]]"}, "datestamp": "2008-10-16T15:51:26+01:00", "internal-links": [], "id": "140"}, {"author": null, "timestamp": "2008-11-16T12:45:55+00:00", "section": "Procedures", "title": "SANS on LOQ template", "content": {"html": "Procedure: SANS
\nInstrument: LOQ
\nThe following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.


SampleSANS/TRANSExposure (uamp.hr)Run #Data
LOQ T49 Standard 14 mmT1046281
LOQ standard Can 14 mmT1046282
Direct beamT1046283
LOQ T49 Standard 14 mmS1546284
LOQ standard Can 14 mmS1546285

\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure (uamp.hr)[col]Run #[col]Data[/row]\n[row]LOQ T49 Standard 14 mm[col]T[col]10[col]46281[col][blog][/blog][/row]\n[row]LOQ standard Can 14 mm[col]T[col]10[col]46282[col][blog][/blog][/row]\n[row]Direct beam[col]T[col]10[col]46283[col][blog][/blog][/row]\n[row]LOQ T49 Standard 14 mm[col]S[col]15[col]46284[col][blog][/blog][/row]\n[row]LOQ standard Can 14 mm[col]S[col]15[col]46285[col][blog][/blog][/row]\n[/table]"}, "datestamp": "2008-11-16T12:38:41+00:00", "internal-links": [], "id": "394"}, {"author": null, "timestamp": "2008-11-16T13:30:12+00:00", "section": "Procedures", "title": "SANS runs on octameric RCK", "content": {"html": "Procedure: SANS
\nInstrument: LOQ
\nThe following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
Octameric rck domain from MthK in D2O bufferT1046286
Buffer background for octameric rck domainT1046287
Octameric rck domain from MthK in D2O bufferS8546288
Buffer background for octameric rck domainS8546289

\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]387[/blog][col]T[col]10[col]46286[col][blog][/blog][/row]\n[row][blog]390[/blog][col]T[col]10[col]46287[col][blog][/blog][/row]\n[row][blog]387[/blog][col]S[col]85[col]46288[col][blog][/blog][/row]\n[row][blog]390[/blog][col]S[col]85[col]46289[col][blog][/blog][/row]\n[/table]"}, "datestamp": "2008-11-16T13:29:40+00:00", "internal-links": ["387", "390", "387", "390"], "id": "402"}, {"author": null, "timestamp": "2008-11-16T15:57:49+00:00", "section": "Procedures", "title": "Additional runs on octameric Rck", "content": {"html": "Procedure: SANS
\nInstrument: LOQ
\nThe following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
Octameric rck domain from MthK in D2O bufferS8546290
Buffer background for octameric rck domainS8546291

\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]387[/blog][col]S[col]85[col]46290[col][blog][/blog][/row]\n[row][blog]390[/blog][col]S[col]85[col]46291[col][blog][/blog][/row]\n[/table]"}, "datestamp": "2008-11-16T15:57:06+00:00", "internal-links": ["387", "390"], "id": "405"}, {"author": null, "timestamp": "2008-11-16T17:38:22+00:00", "section": "Materials", "title": "Octameric RCK plus Ca", "content": {"html": "Material: Solution
\nProject: mthk
\nThe product of adding Ca to octameric RCK domain in Addition of Ca++ to octameric mthk sample




This Post is Linked By: Addition of Ca++ to octameric mthk sample;SANS of octameric RCK plus Ca++;Dialysis of Octameric RCK samples;\n", "bbcode": "The product of adding Ca to octameric RCK domain in [blog]408[/blog]\n\n\n\n"}, "datestamp": "2008-11-16T17:38:22+00:00", "internal-links": ["408"], "id": "409"}, {"author": null, "timestamp": "2008-11-16T17:40:07+00:00", "section": "Materials", "title": "Buffer background for octameric RCK plus Ca", "content": {"html": "Material: Solution
\nProject: mthk
\nThe product of adding Ca to buffer background in Addition of Ca++ to octameric mthk sample




This Post is Linked By: Addition of Ca++ to octameric mthk sample;SANS of octameric RCK plus Ca++;\n", "bbcode": "The product of adding Ca to buffer background in [blog]408[/blog]\n\n\n\n"}, "datestamp": "2008-11-16T17:40:07+00:00", "internal-links": ["408"], "id": "410"}, {"author": null, "timestamp": "2008-11-16T18:09:23+00:00", "section": "Procedures", "title": "Addition of Ca++ to octameric mthk sample", "content": {"html": "Project: mthk
\nTo each of Octameric rck domain from MthK in D2O buffer and Buffer background for octameric rck domain (500 uL) in 1 mm SANS Tank cells was added CaCl2 (15 uL of a 1 M solution) to give Octameric RCK plus Ca and Buffer background for octameric RCK plus Ca respectively.

Some precipitation was observed in the protein sample so it was spun down and returned to the sample cell.
This Post is Linked By: Octameric RCK plus Ca;Buffer background for octameric RCK plus Ca;\n", "bbcode": "To each of [blog]387[/blog] and [blog]390[/blog] (500 uL) in 1 mm SANS Tank cells was added CaCl2 (15 uL of a 1 M solution) to give [blog]409[/blog] and [blog]410[/blog] respectively.\n\nSome precipitation was observed in the protein sample so it was spun down and returned to the sample cell."}, "datestamp": "2008-11-16T17:38:03+00:00", "internal-links": ["387", "390", "409", "410"], "id": "408"}, {"author": null, "timestamp": "2008-11-16T22:29:21+00:00", "section": "Materials", "title": "Dimeric RCK from gel filtration in pD 6.5 D2O buffer", "content": {"html": "Material: Solution
\nProject: mthk
\nDimeric RCK off gel filtration column in 20 mM MES 250 mM KCl, pD 6.5 in D2O




This Post is Linked By: SANS of dimeric RCK;\n", "bbcode": "Dimeric RCK off gel filtration column in 20 mM MES 250 mM KCl, pD 6.5 in D2O\n\n\n\n"}, "datestamp": "2008-11-16T22:29:21+00:00", "internal-links": [], "id": "417"}, {"author": null, "timestamp": "2008-11-16T22:30:01+00:00", "section": "Materials", "title": "Buffer background for dimeric RCK", "content": {"html": "Material: Solution
\nProject: mthk
\n20 mM MES, 250 mM KCl, pD 6.5 in D2O




This Post is Linked By: SANS of dimeric RCK;\n", "bbcode": "20 mM MES, 250 mM KCl, pD 6.5 in D2O\n\n\n\n"}, "datestamp": "2008-11-16T22:30:01+00:00", "internal-links": [], "id": "418"}, {"author": null, "timestamp": "2008-11-16T22:33:43+00:00", "section": "Procedures", "title": "SANS of dimeric RCK", "content": {"html": "Procedure: SANS
\nInstrument: LOQ
\nThe following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
Dimeric RCK from gel filtration in pD 6.5 D2O bufferT1046298
Buffer background for dimeric RCKT1046299
Dimeric RCK from gel filtration in pD 6.5 D2O bufferS8546300
Buffer background for dimeric RCKS8546301

\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]417[/blog][col]T[col]10[col]46298[col][blog][/blog][/row]\n[row][blog]418[/blog][col]T[col]10[col]46299[col][blog][/blog][/row]\n[row][blog]417[/blog][col]S[col]85[col]46300[col][blog][/blog][/row]\n[row][blog]418[/blog][col]S[col]85[col]46301[col][blog][/blog][/row]\n[/table]"}, "datestamp": "2008-11-16T22:31:38+00:00", "internal-links": ["417", "418", "417", "418"], "id": "419"}, {"author": null, "timestamp": "2008-11-16T22:35:41+00:00", "section": "Procedures", "title": "SANS of octameric RCK plus Ca++", "content": {"html": "Procedure: SANS
\nInstrument: LOQ
\nThe following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
Octameric RCK plus CaT1046292
Buffer background for octameric RCK plus CaT1046293
Octameric RCK plus CaS8546294
Buffer background for octameric RCK plus CaS8546295
Octameric RCK plus CaS8546296
Buffer background for octameric RCK plus CaS8546297


The order was changed after uploading the control script. The second control script is the correct one.
\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]409[/blog][col]T[col]10[col]46292[col][blog][/blog][/row]\n[row][blog]410[/blog][col]T[col]10[col]46293[col][blog][/blog][/row]\n[row][blog]409[/blog][col]S[col]85[col]46294[col][blog][/blog][/row]\n[row][blog]410[/blog][col]S[col]85[col]46295[col][blog][/blog][/row]\n[row][blog]409[/blog][col]S[col]85[col]46296[col][blog][/blog][/row]\n[row][blog]410[/blog][col]S[col]85[col]46297[col][blog][/blog][/row]\n[/table]\n\nThe order was changed after uploading the control script. The second control script is the correct one."}, "datestamp": "2008-11-16T17:58:16+00:00", "internal-links": ["409", "410", "409", "410", "409", "410"], "id": "412"}, {"author": null, "timestamp": "2008-11-17T01:00:49+00:00", "section": "Materials", "title": "Octameric RCK plus Ca dialysed into pD6.5", "content": {"html": "Material: Solution
\nProject: mthk
\nSample of octameric RCK with calcium added that was dialysed into pD 6.5 buffer in Dialysis of Octameric RCK samples




This Post is Linked By: Dialysis of Octameric RCK samples;SANS on LOQ template;\n", "bbcode": "Sample of octameric RCK with calcium added that was dialysed into pD 6.5 buffer in [blog]425[/blog]\n\n\n\n"}, "datestamp": "2008-11-17T01:00:49+00:00", "internal-links": ["425"], "id": "426"}, {"author": null, "timestamp": "2008-11-17T01:04:25+00:00", "section": "Materials", "title": "Octameric RCK plus (no Ca) dialysed into pD 6.5 buffer", "content": {"html": "Material: Solution
\nProject: mthk
\nThe sample of octameric RCK dialysed into 20 mM MES, 250 mM KCl pD 6.5
This Post is Linked By: Dialysis of Octameric RCK samples;SANS on LOQ template;\n", "bbcode": "The sample of octameric RCK dialysed into 20 mM MES, 250 mM KCl pD 6.5"}, "datestamp": "2008-11-17T01:01:31+00:00", "internal-links": [], "id": "427"}, {"author": null, "timestamp": "2008-11-17T01:04:46+00:00", "section": "Procedures", "title": "Dialysis of Octameric RCK samples", "content": {"html": "Project: mthk
\nThe samples Octameric rck domain from MthK in D2O buffer and Octameric RCK plus Ca were dialysed into pD 6.5 buffer (MES, 250 mM KCl, one change) and the same buffer with 25 mM Ca2+ to give the samples Octameric RCK plus (no Ca) dialysed into pD 6.5 buffer and Octameric RCK plus Ca dialysed into pD6.5 respectively.
This Post is Linked By: Octameric RCK plus Ca dialysed into pD6.5;\n", "bbcode": "The samples [blog]387[/blog] and [blog]409[/blog] were dialysed into pD 6.5 buffer (MES, 250 mM KCl, one change) and the same buffer with 25 mM Ca2+ to give the samples [blog]427[/blog] and [blog]426[/blog] respectively."}, "datestamp": "2008-11-17T01:00:35+00:00", "internal-links": ["387", "409", "427", "426"], "id": "425"}, {"author": null, "timestamp": "2008-11-17T01:05:19+00:00", "section": "Materials", "title": "20 mM MES pD6.5 250 mM KCl in D2O", "content": {"html": "Material: Solution
\nProject: mthk
\nBuffer pD 6.5 with no Ca2+




This Post is Linked By: SANS on LOQ template;\n", "bbcode": "Buffer pD 6.5 with no Ca2+\n\n\n\n"}, "datestamp": "2008-11-17T01:05:19+00:00", "internal-links": [], "id": "432"}, {"author": null, "timestamp": "2008-11-17T01:05:45+00:00", "section": "Materials", "title": "20 mM MES pD6.5 250 mM KCl, 25 mM Ca2+ in D2O", "content": {"html": "Material: Solution
\nProject: mthk
\nBuffer pD 6.5 with Ca2+




This Post is Linked By: SANS on LOQ template;\n", "bbcode": "Buffer pD 6.5 with Ca2+\n\n\n\n"}, "datestamp": "2008-11-17T01:05:45+00:00", "internal-links": [], "id": "433"}, {"author": null, "timestamp": "2008-11-17T01:14:29+00:00", "section": "Procedures", "title": "SANS of dialysed octameric RCK samples", "content": {"html": "Procedure: SANS
\nInstrument: LOQ
\nThe following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
Octameric RCK plus (no Ca) dialysed into pD 6.5 bufferT1046302
20 mM MES pD6.5 250 mM KCl in D2OT1046303
Octameric RCK plus Ca dialysed into pD6.5T1046304
20 mM MES pD6.5 250 mM KCl, 25 mM Ca2+ in D2OT1046305
Octameric RCK plus (no Ca) dialysed into pD 6.5 bufferS8546306
20 mM MES pD6.5 250 mM KCl in D2OS8546307
Octameric RCK plus Ca dialysed into pD6.5S8546308
20 mM MES pD6.5 250 mM KCl, 25 mM Ca2+ in D2OS8546309
Octameric RCK plus (no Ca) dialysed into pD 6.5 bufferS8546310
20 mM MES pD6.5 250 mM KCl in D2OS8546311
Octameric RCK plus Ca dialysed into pD6.5S8546312
20 mM MES pD6.5 250 mM KCl, 25 mM Ca2+ in D2OS8546313

\n", "bbcode": "The following samples were run as described on LOQ at ISIS. The samples were run in 1 mm path length tank cells (500 uL samples)l at a temperature of 16 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]427[/blog][col]T[col]10[col]46302[col][blog][/blog][/row]\n[row][blog]432[/blog][col]T[col]10[col]46303[col][blog][/blog][/row]\n[row][blog]426[/blog][col]T[col]10[col]46304[col][blog][/blog][/row]\n[row][blog]433[/blog][col]T[col]10[col]46305[col][blog][/blog][/row]\n[row][blog]427[/blog][col]S[col]85[col]46306[col][blog][/blog][/row]\n[row][blog]432[/blog][col]S[col]85[col]46307[col][blog][/blog][/row]\n[row][blog]426[/blog][col]S[col]85[col]46308[col][blog][/blog][/row]\n[row][blog]433[/blog][col]S[col]85[col]46309[col][blog][/blog][/row]\n[row][blog]427[/blog][col]S[col]85[col]46310[col][blog][/blog][/row]\n[row][blog]432[/blog][col]S[col]85[col]46311[col][blog][/blog][/row]\n[row][blog]426[/blog][col]S[col]85[col]46312[col][blog][/blog][/row]\n[row][blog]433[/blog][col]S[col]85[col]46313[col][blog][/blog][/row]\n[/table]"}, "datestamp": "2008-11-17T01:07:34+00:00", "internal-links": ["427", "432", "426", "433", "427", "432", "426", "433", "427", "432", "426", "433"], "id": "434"}, {"author": null, "timestamp": "2008-11-27T13:24:08+00:00", "section": "Procedures", "title": "Fresh beads for Laser Tweezers experiments", "content": {"html": "Project: Laser_tweezers_tus
\nWe have done a bunch of fairly random preliminary experiments that suggest that the beads made have very different stickiness. The 1:100 gly-oh beads after ammonia treatment seem to be pretty non-sticky but after protein loading they become much more sticky. We are going to prepare protein loaded beads on good quantities of beads to split into different buffers and wash extensively.

Sortase reaction mixture made from:
50 uL Sortase (8.4 uM)
50 uL CaCl2 (100 mM)
368 uL Tus (62 uM)
32 uL water



BeadsWt of tubeWt of tube + beadsuL Sortase reactionProduct
1:100 gly-oh beads after ammonia treatment1.54821.5877100
1:1000 gly-OH beads after ammonia treatment1.64341.64861001;1000 Tus loaded silica beads
1:10000 gly-OH beads after ammonia treatment1.64311.6473100New 1:10,000 Tus labelled Silica beads
1:100,000 gly-OH beads after ammonia treatment1.59061.5942100


The beads were incubated overnight with shaking at room temperature. In the morning they were washed twice with 5 mM Tris-HCl pH 7.5, 1 M NaCL (1 mL), then 1 x 1 mL of the same buffer with 400 mM NaCl, then 1 x 1 mL of buffer with 300 mM NaCl. Then 1 x 1 mL of 100 mM NaCl buffer.

After resuspension in 100 mM NaCl buffer the samples were then split into 4 x 250 uL. The 250 uL samples were spun and resuspended in 1 mL of 100 mM NaCl buffer, 50 mM NaCl buffer, 0 mM NaCl buffer and water and washed a further two times with this buffer.
This Post is Linked By: New 1:10,000 Tus labelled Silica beads;1;1000 Tus loaded silica beads;\n", "bbcode": "We have done a bunch of fairly random preliminary experiments that suggest that the beads made have very different stickiness. The [blog]300[/blog] seem to be pretty non-sticky but after protein loading they become much more sticky. We are going to prepare protein loaded beads on good quantities of beads to split into different buffers and wash extensively.\n\nSortase reaction mixture made from:\n50 uL Sortase (8.4 uM)\n50 uL CaCl2 (100 mM)\n368 uL Tus (62 uM)\n32 uL water\n\n\n[Table]\n[row]Beads[col]Wt of tube[col]Wt of tube + beads[col]uL Sortase reaction[col]Product[/row]\n[row][blog]300[/blog][col]1.5482[col]1.5877[col]100[col][/row]\n[row][blog]301[/blog][col]1.6434[col]1.6486[col]100[col][blog]445[/blog][/row]\n[row][blog]302[/blog][col]1.6431[col]1.6473[col]100[col][blog]444[/blog][/row]\n[row][blog]303[/blog][col]1.5906[col]1.5942[col]100[col][/row]\n[/table]\n\nThe beads were incubated overnight with shaking at room temperature. In the morning they were washed twice with 5 mM Tris-HCl pH 7.5, 1 M NaCL (1 mL), then 1 x 1 mL of the same buffer with 400 mM NaCl, then 1 x 1 mL of buffer with 300 mM NaCl. Then 1 x 1 mL of 100 mM NaCl buffer.\n\nAfter resuspension in 100 mM NaCl buffer the samples were then split into 4 x 250 uL. The 250 uL samples were spun and resuspended in 1 mL of 100 mM NaCl buffer, 50 mM NaCl buffer, 0 mM NaCl buffer and water and washed a further two times with this buffer."}, "datestamp": "2008-11-13T17:52:44+00:00", "internal-links": ["300", "300", "301", "445", "302", "444", "303"], "id": "374"}, {"author": null, "timestamp": "2008-11-28T11:02:19+00:00", "section": "Data", "title": "DNA sequence data from Southampton on pLLC064", "content": {"html": "Data Type: Sequence_DNA
\nSequence data forwarded by guillame boucher from sequencing of the plasmid pLLC064 - supposedly Sortase in pETMCSI

TTTTGTTTACTTTAAGAAGGAGATATACATATGAAACCACATATCGATAATTATCTTCAC
GATAAAGATAAAGATGAAAAGATTGAACAATATGATAAAAATGTAAAAGAACAGGCGAGT
AAAGATAAAAAGCAGCAAGCTAAACCTCAAATTCCGAAAGATAAATCGAAAGTGGCAGGC
TATATTGAAATTCCAGATGCTGATATTAAAGAACCAGTATATCCAGGACCAGCAACACCT
GAACAATTAAATAGAGGTGTAAGCTTTGCAGAAGAAAATGAATCACTAGATGATCAAAAT
ATTTCAATTGCAGGACACACTTTCATTGACCGTCCGAACTATCAATTTACAAATCTTAAA
GCAGCCAAAAAAGGTAGTATGGTGTACTTTAAAGTTGGTAATGAAACACGTAAGTATAAA
ATGACAAGTATAAGAGATGTTAAGCCTACAGATGTAGGAGTTCTAGATGAACAAAAAGGT
AAAGATAAACAATTAACATTAATTACTTGTGATGATTACAATGAAAAGACAGGCGTTTGG
GAAAAACGTAAAATCTTTGTAGCTACAGAAGTCAAATAATCGAATTCGAGCTCCCGGGTA
CCATGGCATGCATCGATAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCT
GCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGG
GGTTTTTTGCTGAAAGGAGGAACTATATCCGGATATCCACAGGACGGGTGTGGTCGCCAT
GATCGCGTAGTCGATAGTGGCTCCAAGTAGCGAAGCGAGCAGGACTGGGCGGCGGCCAAA
GCGGTCGGACAGTGCTCCGAGAACGGGTGCGCATAGAAATTGCATCAACGCATATAGCGC
TAGCAGCACGCCATAGTGACTGGCCGATGCTGTCGGAATGGACGATATCCCGCAAGAGGC
CCGGCAGTACCGGCATAACCAAGCCTATGCCT
\n", "bbcode": "Sequence data forwarded by guillame boucher from sequencing of the plasmid pLLC064 - supposedly Sortase in pETMCSI\n\nTTTTGTTTACTTTAAGAAGGAGATATACATATGAAACCACATATCGATAATTATCTTCAC\nGATAAAGATAAAGATGAAAAGATTGAACAATATGATAAAAATGTAAAAGAACAGGCGAGT\nAAAGATAAAAAGCAGCAAGCTAAACCTCAAATTCCGAAAGATAAATCGAAAGTGGCAGGC\nTATATTGAAATTCCAGATGCTGATATTAAAGAACCAGTATATCCAGGACCAGCAACACCT\nGAACAATTAAATAGAGGTGTAAGCTTTGCAGAAGAAAATGAATCACTAGATGATCAAAAT\nATTTCAATTGCAGGACACACTTTCATTGACCGTCCGAACTATCAATTTACAAATCTTAAA\nGCAGCCAAAAAAGGTAGTATGGTGTACTTTAAAGTTGGTAATGAAACACGTAAGTATAAA\nATGACAAGTATAAGAGATGTTAAGCCTACAGATGTAGGAGTTCTAGATGAACAAAAAGGT\nAAAGATAAACAATTAACATTAATTACTTGTGATGATTACAATGAAAAGACAGGCGTTTGG\nGAAAAACGTAAAATCTTTGTAGCTACAGAAGTCAAATAATCGAATTCGAGCTCCCGGGTA\nCCATGGCATGCATCGATAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCT\nGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGG\nGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATATCCACAGGACGGGTGTGGTCGCCAT\nGATCGCGTAGTCGATAGTGGCTCCAAGTAGCGAAGCGAGCAGGACTGGGCGGCGGCCAAA\nGCGGTCGGACAGTGCTCCGAGAACGGGTGCGCATAGAAATTGCATCAACGCATATAGCGC\nTAGCAGCACGCCATAGTGACTGGCCGATGCTGTCGGAATGGACGATATCCCGCAAGAGGC\nCCGGCAGTACCGGCATAACCAAGCCTATGCCT"}, "datestamp": "2008-11-28T11:02:19+00:00", "internal-links": [], "id": "454"}, {"author": null, "timestamp": "2008-12-01T11:19:11+00:00", "section": "Procedures", "title": "Analysis of pLLC064 sequencing data", "content": {"html": "Procedure: Data_analysis
\nLooking at the sequence provided by Guillame and comparing it to the sequences of pETMCSI and pETMCSIII it is evident that this plasmid is the original sequence that Krystle cloned into pETMCSI in 2004 rather than the version is pETMCSIII. This explains why in previous work the protein didn't bind to the nickel column but was apparently well expressed. My guess is that Lilyan mis-labelled the plasmids when they were placed in the storage box. It also means that the plasmid I have sent out to various people isn't what I said it was.

The good news is that Ali Tavasolli's group at Soton are going to re-clone \"our\" Sortase gene and we can then re-make the properly designated pLLC064.
\n", "bbcode": "Looking at the sequence provided by Guillame and comparing it to the sequences of pETMCSI and pETMCSIII it is evident that this plasmid is the original sequence that Krystle cloned into pETMCSI in 2004 rather than the version is pETMCSIII. This explains why in previous work the protein didn't bind to the nickel column but was apparently well expressed. My guess is that Lilyan mis-labelled the plasmids when they were placed in the storage box. It also means that the plasmid I have sent out to various people isn't what I said it was.\n\nThe good news is that Ali Tavasolli's group at Soton are going to re-clone \"our\" Sortase gene and we can then re-make the properly designated pLLC064."}, "datestamp": "2008-12-01T11:16:32+00:00", "internal-links": [], "id": "474"}, {"author": null, "timestamp": "2008-12-09T10:36:01+00:00", "section": "Templates", "title": "PCR template", "content": {"html": "PCR reactions were run using the following sample conditions. The PCR cycling programme was [[blog]].



Reaction		TemplateuLPrimer 1ulPrimer 2uLBufferuLEnzymeuLdNTPulMguLWater (uL)Product

1		[[Dna:%]][[box=3]][[Dna:oligonucleotide]][[box=3]][[Dna:oligonucleotide]][[box=3]]
[[box]][[box=3]][[box]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]]
[[Dna:pcr_product]]

2		[[Dna:%]][[box=3]][[Dna:oligonucleotide]][[box=3]][[Dna:oligonucleotide]][[box=3]]
[[box]][[box=3]][[box]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]]
[[Dna:pcr_product]]

3		[[Dna:%]][[box=3]][[Dna:oligonucleotide]][[box=3]][[Dna:oligonucleotide]][[box=3]]
[[box]][[box=3]][[box]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]]
[[Dna:pcr_product]]

4		[[Dna:%]][[box=3]][[Dna:oligonucleotide]][[box=3]][[Dna:oligonucleotide]][[box=3]]
[[box]][[box=3]][[box]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]]
[[Dna:pcr_product]]

5		[[Dna:%]][[box=3]][[Dna:oligonucleotide]][[box=3]][[Dna:oligonucleotide]][[box=3]]
[[box]][[box=3]][[box]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]][[box=3]]
[[Dna:pcr_product]]


[[Section>Procedure]]
[[Procedure>PCR]]
\n", "bbcode": "PCR reactions were run using the following sample conditions. The PCR cycling programme was [[blog]].\n\n[table]\n[row]\nReaction[col]Template[col]uL[col]Primer 1[col]ul[col]Primer 2[col]uL[col]Buffer[col]uL[col]Enzyme[col]uL[col]dNTP[col]ul[col]Mg[col]uL[col]Water (uL)[col]Product\n[/row]\n\n[row]\n1[col][[Dna:%]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]]\n[col][[box]][col][[box=3]][col][[box]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]]\n[col][[Dna:pcr_product]][/row]\n\n[row]\n2[col][[Dna:%]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]]\n[col][[box]][col][[box=3]][col][[box]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]]\n[col][[Dna:pcr_product]][/row]\n\n[row]\n3[col][[Dna:%]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]]\n[col][[box]][col][[box=3]][col][[box]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]]\n[col][[Dna:pcr_product]][/row]\n\n[row]\n4[col][[Dna:%]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]]\n[col][[box]][col][[box=3]][col][[box]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]]\n[col][[Dna:pcr_product]][/row]\n\n[row]\n5[col][[Dna:%]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]][col][[Dna:oligonucleotide]][col][[box=3]]\n[col][[box]][col][[box=3]][col][[box]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]][col][[box=3]]\n[col][[Dna:pcr_product]][/row]\n[/table]\n\n[[Section>Procedure]]\n[[Procedure>PCR]]"}, "datestamp": "2008-12-09T10:36:01+00:00", "internal-links": [], "id": "766"}, {"author": null, "timestamp": "2008-12-10T13:51:32+00:00", "section": "Materials", "title": "Buffer background for octameric rck domain", "content": {"html": "Material: Solution
\nProject: mthk
\n20 mM Tris-HCl pD 8.0, 250 mM KCl
This Post is Linked By: SANS runs on octameric RCK;Additional runs on octameric Rck;Addition of Ca++ to octameric mthk sample;\n", "bbcode": "20 mM Tris-HCl pD 8.0, 250 mM KCl"}, "datestamp": "2008-11-16T11:23:39+00:00", "internal-links": [], "id": "390"}, {"author": null, "timestamp": "2008-12-10T13:54:42+00:00", "section": "Materials", "title": "KcsA plasmid from Southampton", "content": {"html": "Dna: plasmid
\nMaterial: Solution
\nA pET based plasmid containing the KcsA gene, a few micrograms resuspended in 20 uL of nuclease free water.
This Post is Linked By: Test PCR to insert Sortase sequence within KcsA;\n", "bbcode": "A pET based plasmid containing the KcsA gene, a few micrograms resuspended in 20 uL of nuclease free water."}, "datestamp": "2008-12-09T10:34:18+00:00", "internal-links": [], "id": "765"}, {"author": null, "timestamp": "2008-12-10T13:55:44+00:00", "section": "Materials", "title": "kcsa-sort-bwd", "content": {"html": "Dna: oligonucleotide
\nMaterial: Solution
\n
PropertyData
Namekcsa-sort-bwd
Number
Location
SequenceCTGCCGGGTACCGGTGGTGCGCAGCTGATCACGTATCCGC
Length40
Melting temp71 (64) C
SupplierInvitrogen
Stock concentration100 uM

This Post is Linked By: Test PCR to insert Sortase sequence within KcsA;\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col]kcsa-sort-bwd[/row]\n[row]Number[col][/row]\n[row]Location[col][/row]\n[row]Sequence[col]CTGCCGGGTACCGGTGGTGCGCAGCTGATCACGTATCCGC[/row]\n[row]Length[col]40[/row]\n[row]Melting temp[col]71 (64) C[/row]\n[row]Supplier[col]Invitrogen[/row]\n[row]Stock concentration[col]100 uM[/row][/table]"}, "datestamp": "2008-12-09T10:24:45+00:00", "internal-links": [], "id": "757"}, {"author": null, "timestamp": "2008-12-10T13:55:59+00:00", "section": "Materials", "title": "kcsa-sort-fwd", "content": {"html": "Dna: oligonucleotide
\nMaterial: Solution
\n
PropertyData
Namekcsa-sort-fwd
Number
Location
SequenceCGCACCACCGGTACCGGCAGACCTGCGCCGCCTCAGCCAG
Length40
Melting temp74 (64) C
SupplierInvitrogen
Stock concentration100 uM

This Post is Linked By: Test PCR to insert Sortase sequence within KcsA;\n", "bbcode": "[table][mrow]Property[mcol]Data[/mrow]\n[row]Name[col]kcsa-sort-fwd[/row]\n[row]Number[col][/row]\n[row]Location[col][/row]\n[row]Sequence[col]CGCACCACCGGTACCGGCAGACCTGCGCCGCCTCAGCCAG[/row]\n[row]Length[col]40[/row]\n[row]Melting temp[col]74 (64) C[/row]\n[row]Supplier[col]Invitrogen[/row]\n[row]Stock concentration[col]100 uM[/row][/table]"}, "datestamp": "2008-12-09T10:23:18+00:00", "internal-links": [], "id": "756"}, {"author": null, "timestamp": "2008-12-10T14:16:59+00:00", "section": "Procedures", "title": "Test PCR to insert Sortase sequence within KcsA", "content": {"html": "Procedure: PCR
\nProject: kcsa
\nTwo large PCR reactions masters were set up as described in the table.



Reaction		TemplateuLPrimer 1ulPrimer 2uLBufferuLEnzymeuLdNTPulMguLWater (uL)Product

1		KcsA plasmid from Southampton5kcsa-sort-fwd1kcsa-sort-bwd1
Thermopol buffer10Vent12 mM10100 mM072

2		KcsA plasmid from Southampton5kcsa-sort-fwd1kcsa-sort-bwd1
Thermopol buffer10Vent12 mM10100 mM171


Each of the two was then divided into ten PCR tubes and spread across the plate of the thermal cycler to have a gradient on the annealing phase of the PCR reaction from 40-60 C.

Samples of each rxn (5 uL) were run on an agarose gel and stained. Not a thing on it! Which is odd given the amount of MgSO4 in the second set of reactions. Will have to try again...
\n", "bbcode": "Two large PCR reactions masters were set up as described in the table.\n\n[table]\n[row]\nReaction[col]Template[col]uL[col]Primer 1[col]ul[col]Primer 2[col]uL[col]Buffer[col]uL[col]Enzyme[col]uL[col]dNTP[col]ul[col]Mg[col]uL[col]Water (uL)[col]Product\n[/row]\n\n[row]\n1[col][blog]765[/blog][col]5[col][blog]756[/blog][col]1[col][blog]757[/blog][col]1\n[col]Thermopol buffer[col]10[col]Vent[col]1[col]2 mM[col]10[col]100 mM[col]0[col]72\n[/row]\n\n[row]\n2[col][blog]765[/blog][col]5[col][blog]756[/blog][col]1[col][blog]757[/blog][col]1\n[col]Thermopol buffer[col]10[col]Vent[col]1[col]2 mM[col]10[col]100 mM[col]1[col]71[/row]\n\n[/table]\n\nEach of the two was then divided into ten PCR tubes and spread across the plate of the thermal cycler to have a gradient on the annealing phase of the PCR reaction from 40-60 C.\n\nSamples of each rxn (5 uL) were run on an agarose gel and stained. Not a thing on it! Which is odd given the amount of MgSO4 in the second set of reactions. Will have to try again..."}, "datestamp": "2008-12-09T10:47:35+00:00", "internal-links": ["765", "756", "757", "765", "756", "757"], "id": "769"}, {"author": null, "timestamp": "2009-01-23T15:03:27+00:00", "section": "Procedures", "title": "First preparation of beads for laser tweezers experiment", "content": {"html": "Project: Laser_tweezers_tus
\nApproximately 1 mg of 1:100 gly-oh beads after ammonia treatment was taken for resuspension in Sortase labelling reaction. Phosphorylated TerR lam (1uL) was added to Bangs Labs streptavidin coated beads (10uL) and allowed to incubate for ~15 minutes after which 1 mL of water was added and the beads spun, supernatant discarded and the beads resuspended in 1mL of water.
\n", "bbcode": "Approximately 1 mg of [blog]300[/blog] was taken for resuspension in Sortase labelling reaction. [blog]263[/blog] (1uL) was added to [blog]352[/blog] (10uL) and allowed to incubate for ~15 minutes after which 1 mL of water was added and the beads spun, supernatant discarded and the beads resuspended in 1mL of water."}, "datestamp": "2008-11-12T14:12:44+00:00", "internal-links": ["300", "263", "352"], "id": "353"}, {"author": null, "timestamp": "2009-01-23T15:03:53+00:00", "section": "Procedures", "title": "Phosphorylation of DNA substrates for laser tweezers experiment", "content": {"html": "Procedure: DNA_phosphorylation
\nProject: Laser_tweezers_tus
\n
DNA substratevolumeT4 Polynucleotide Kinase5 x Kinase Forward reaction bufferATP (10 mM)WaterProduct
Ethanol precipitated lambda DNA200150250Phosphorylated lambda DNA
Oligo-lambda-biotin10152.57.5Phosphorylated oligo-lambda-biotin
Oligo-TerRlam10152.57.5Phosphorylated TerR lam
Oligo-TerR10152.57.5Phosporylated TerR
Oligo-TerFlam10152.57.5Phosphorylated TerRlam
Oligo-TerF10152.57.5Phosphorylated TerR


Samples were prepared as given and incubated at 37 C for 10' followed by 10' at 65 C to inactivate the enzyme.
This Post is Linked By: Phosphorylated TerR lam;Phosporylated TerR;Phosphorylated TerRlam;Phosphorylated oligo-lambda-biotin;Phosphorylated lambda DNA;Phosphorylated TerR;\n", "bbcode": "[table]\n[row]DNA substrate[col]volume[col][blog]259[/blog][col][blog]260[/blog][col]ATP (10 mM)[col]Water[col]Product[/row]\n[row][blog]240[/blog][col]200[col]1[col]50[col]25[col]0[col][blog]262[/blog][/row]\n[row][blog]224[/blog][col]10[col]1[col]5[col]2.5[col]7.5[col][blog]269[/blog][/row]\n[row][blog]221[/blog][col]10[col]1[col]5[col]2.5[col]7.5[col][blog]263[/blog][/row]\n[row][blog]218[/blog][col]10[col]1[col]5[col]2.5[col]7.5[col][blog]264[/blog][/row]\n[row][blog]214[/blog][col]10[col]1[col]5[col]2.5[col]7.5[col][blog]265[/blog][/row]\n[row][blog]211[/blog][col]10[col]1[col]5[col]2.5[col]7.5[col][blog]266[/blog][/row]\n[/table]\n\nSamples were prepared as given and incubated at 37 C for 10' followed by 10' at 65 C to inactivate the enzyme."}, "datestamp": "2008-11-05T15:59:58+00:00", "internal-links": ["259", "260", "240", "262", "224", "269", "221", "263", "218", "264", "214", "265", "211", "266"], "id": "261"}, {"author": null, "timestamp": "2009-01-23T15:04:27+00:00", "section": "Procedures", "title": "Ethanol precipitation of lambda DNA", "content": {"html": "Project: Laser_tweezers_tus
\nBecause the Lambda DNA is in a tris-edta buffer I will ethanol ppt it and resuspend in water.

200 uL of Lambda DNA was added to 20 uL of 3 M ammonium acetate pH 4.8 followed by 400 uL of ethanol. The solution was mixed and incubated on ice for ~60 minutes. The solution was then centrifuged at 20k x g for 20 minutes.

The DNA was then further dried overnight and resuspended in nuclease free water to give Ethanol precipitated lambda DNA
This Post is Linked By: Ethanol precipitated lambda DNA;\n", "bbcode": "Because the [blog]228[/blog] is in a tris-edta buffer I will ethanol ppt it and resuspend in water. \n\n200 uL of [blog]228[/blog] was added to 20 uL of 3 M ammonium acetate pH 4.8 followed by 400 uL of ethanol. The solution was mixed and incubated on ice for ~60 minutes. The solution was then centrifuged at 20k x g for 20 minutes.\n\nThe DNA was then further dried overnight and resuspended in nuclease free water to give [blog]240[/blog]"}, "datestamp": "2008-10-28T15:35:06+00:00", "internal-links": ["228", "228", "240"], "id": "239"}, {"author": null, "timestamp": "2009-02-10T11:36:21+00:00", "section": "Procedures", "title": "Further lysozyme runs", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nThe following samples were run in 1mm SAXS cells on I22. Detector was at 5m and q range standardised against silver behenate. 0.5 mm of Al was used to attenuate the beam from this point on.


SampleFramesExposure time I22 Raw Run #Data
Lysozyme (~10 mg/mL)3030A10000.202Lysozyme 10 mg/mL with attenutor
Lysozyme (~20 mg/mL)3030A11000.202Lysozyme 20 mg/mL w/o attenutor
GFP (~2 mg/mL)3030A12000.2020GFP 2mg/mL
GFP (~2 mg/mL)1030A13000.202second 10 frames of 2 mg/mL GFP
GFP (~5 mg/mL)3030A14000.202GFP 5 mg/mL
GFP (~10mg/mL)3030A15000.202GFP 10mg/mL
GFP (~20 mg/mL)3030A16000.202GFP 20mg/mL

\n", "bbcode": "The following samples were run in 1mm SAXS cells on I22. Detector was at 5m and q range standardised against silver behenate. 0.5 mm of Al was used to attenuate the beam from this point on.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2790[/blog][col]30[col]30[col]A10000.202[col][blog]2838[/blog][/row]\n[row][blog]2778[/blog][col]30[col]30[col]A11000.202[col][blog]2837[/blog][/row]\n[row][blog]2788[/blog][col]30[col]30[col]A12000.2020[col][blog]2858[/blog][/row]\n[row][blog]2788[/blog][col]10[col]30[col]A13000.202[col][blog]2859[/blog][/row]\n[row][blog]2787[/blog][col]30[col]30[col]A14000.202[col][blog]2860[/blog][/row]\n[row][blog]2786[/blog][col]30[col]30[col]A15000.202[col][blog]2863[/blog][/row]\n[row][blog]2782[/blog][col]30[col]30[col]A16000.202[col][blog]2864[/blog][/row]\n[/table]"}, "datestamp": "2009-02-02T19:25:10+00:00", "internal-links": ["2790", "2838", "2778", "2837", "2788", "2858", "2788", "2859", "2787", "2860", "2786", "2863", "2782", "2864"], "id": "2868"}, {"author": null, "timestamp": "2009-02-09T15:33:54+00:00", "section": "Data", "title": "UV-Vis of 5mg/mL Lysozyme", "content": {"html": "Data Type: UV-Vis
\nFromUV-Vis of Lysozyme and GFP samples from I22 SAXS

This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From[blog]3219[/blog][data]382[/data]"}, "datestamp": "2009-02-09T15:33:38+00:00", "internal-links": ["3219"], "id": "3226"}, {"author": null, "timestamp": "2009-02-09T15:34:28+00:00", "section": "Data", "title": "UV-Vis of 2mg/mL Lysozyme", "content": {"html": "Data Type: UV-Vis
\nFrom UV-Vis of Lysozyme and GFP samples from I22 SAXS
This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From [blog]3219[/blog]"}, "datestamp": "2009-02-09T15:34:28+00:00", "internal-links": ["3219"], "id": "3229"}, {"author": null, "timestamp": "2009-02-09T15:35:11+00:00", "section": "Data", "title": "UV-Vis of 20mg/mL GFP", "content": {"html": "Data Type: UV-Vis
\nFrom UV-Vis of Lysozyme and GFP samples from I22 SAXS

This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From [blog]3219[/blog][data]384[/data]"}, "datestamp": "2009-02-09T15:34:55+00:00", "internal-links": ["3219"], "id": "3230"}, {"author": null, "timestamp": "2009-02-09T15:36:03+00:00", "section": "Data", "title": "UV-Vis of 10mg/mL GFP", "content": {"html": "Data Type: UV-Vis
\nFrom UV-Vis of Lysozyme and GFP samples from I22 SAXS

This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From [blog]3219[/blog][data]386[/data]"}, "datestamp": "2009-02-09T15:35:35+00:00", "internal-links": ["3219"], "id": "3233"}, {"author": null, "timestamp": "2009-02-09T15:36:45+00:00", "section": "Data", "title": "UV-Vis of 5mg/mL GFP", "content": {"html": "Data Type: UV-Vis
\nFrom UV-Vis of Lysozyme and GFP samples from I22 SAXS

This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From [blog]3219[/blog][data]388[/data]"}, "datestamp": "2009-02-09T15:36:27+00:00", "internal-links": ["3219"], "id": "3236"}, {"author": null, "timestamp": "2009-02-09T15:37:24+00:00", "section": "Data", "title": "UV-Vis of 2mg/mL GFP", "content": {"html": "Data Type: UV-Vis
\nFrom UV-Vis of Lysozyme and GFP samples from I22 SAXS

This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From [blog]3219[/blog][data]390[/data]"}, "datestamp": "2009-02-09T15:37:09+00:00", "internal-links": ["3219"], "id": "3239"}, {"author": null, "timestamp": "2009-02-09T15:38:25+00:00", "section": "Procedures", "title": "UV-Vis of Lysozyme and GFP samples from I22 SAXS", "content": {"html": "Procedure: UV-Vis
\nSamples (10 uL) were run in a 5mm path length microcell on the GeneQuant 1300. The instrument was zeroed with a water background.


SampleDilutionData
Lysozyme (~20 mg/mL)20-foldUV-Vis of 20mg/mL Lysozyme
Lysozyme (~10 mg/mL)20-foldUV-Vis of 10mg/mL Lysozyme
Lysozyme (~5 mg/mL)10-foldUV-Vis of 5mg/mL Lysozyme
Lysozyme (~2 mg/mL)5-foldUV-Vis of 2mg/mL Lysozyme
GFP (~20 mg/mL)10-foldUV-Vis of 20mg/mL GFP
GFP (~10mg/mL)2-foldUV-Vis of 10mg/mL GFP
GFP (~5 mg/mL)2-foldUV-Vis of 5mg/mL GFP
GFP (~2 mg/mL)N/aUV-Vis of 2mg/mL GFP

This Post is Linked By: UV-Vis of 5mg/mL Lysozyme;UV-Vis of 2mg/mL Lysozyme;UV-Vis of 20mg/mL GFP;UV-Vis of 10mg/mL GFP;UV-Vis of 5mg/mL GFP;UV-Vis of 2mg/mL GFP;UV-Vis of 20mg/mL Lysozyme;UV-Vis of 10mg/mL Lysozyme;\n", "bbcode": "Samples (10 uL) were run in a 5mm path length microcell on the GeneQuant 1300. The instrument was zeroed with a water background.\n\n[table]\n[row]Sample[col]Dilution[col]Data[/row]\n[row][blog]2778[/blog][col]20-fold[col][blog]3220[/blog][/row]\n[row][blog]2790[/blog][col]20-fold[col][blog]3223[/blog][/row]\n[row][blog]2791[/blog][col]10-fold[col][blog]3226[/blog][/row]\n[row][blog]2792[/blog][col]5-fold[col][blog]3229[/blog][/row]\n[row][blog]2782[/blog][col]10-fold[col][blog]3230[/blog][/row]\n[row][blog]2786[/blog][col]2-fold[col][blog]3233[/blog][/row]\n[row][blog]2787[/blog][col]2-fold[col][blog]3236[/blog][/row]\n[row][blog]2788[/blog][col]N/a[col][blog]3239[/blog][/row]\n[/table]"}, "datestamp": "2009-02-09T14:45:03+00:00", "internal-links": ["2778", "3220", "2790", "3223", "2791", "3226", "2792", "3229", "2782", "3230", "2786", "3233", "2787", "3236", "2788", "3239"], "id": "3219"}, {"author": null, "timestamp": "2009-02-09T15:32:26+00:00", "section": "Data", "title": "UV-Vis of 20mg/mL Lysozyme", "content": {"html": "Data Type: UV-Vis
\nFrom UV-Vis of Lysozyme and GFP samples from I22 SAXS

This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From [blog]3219[/blog][data]378[/data]"}, "datestamp": "2009-02-09T15:32:00+00:00", "internal-links": ["3219"], "id": "3220"}, {"author": null, "timestamp": "2009-02-09T15:33:09+00:00", "section": "Data", "title": "UV-Vis of 10mg/mL Lysozyme", "content": {"html": "Data Type: UV-Vis
\nFrom UV-Vis of Lysozyme and GFP samples from I22 SAXS

This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;\n", "bbcode": "From [blog]3219[/blog][data]380[/data]"}, "datestamp": "2009-02-09T15:32:51+00:00", "internal-links": ["3219"], "id": "3223"}, {"author": null, "timestamp": "2009-02-01T12:48:21+00:00", "section": "Procedures", "title": "Preparation of DMPC vesicles", "content": {"html": "Project: Reaction_centre
\nDMPC (20.6 mg) was dissolved in 10 mL of chloroform and transferred to a conical flask. The chloroform was evaporated under a stream of dry nitrogen.
\n", "bbcode": "DMPC (20.6 mg) was dissolved in 10 mL of chloroform and transferred to a conical flask. The chloroform was evaporated under a stream of dry nitrogen. "}, "datestamp": "2009-02-01T12:48:21+00:00", "internal-links": [], "id": "2765"}, {"author": null, "timestamp": "2009-02-01T16:00:51+00:00", "section": "Procedures", "title": "Exchange of prBC into bOG", "content": {"html": "Project: Reaction_centre
\nFollowing the procedure from http://chemtools.chem.soton.ac.uk/projects/blog/blogs.php/bit_id/5591 for detergent exchange.

Stock solution of 20 mM Tris-HCl pH 8 is available in the lab. Will use this as the base for buffers.

beta octyl glucoside (0.4104 g) was dissolved in 70 mL of Tris buffer.

Approx 1.5 mL of prBC sample was loaded onto a DEAE-FF column equilibrated in Tris buffer. The column was loaded and then washed with ~50 mL of buffer. The column was then exchanged into Tris buffer with 20 mM beta octyl glucoside and the protein attempted to be eluted with Tris buffer with beta octyl glucoside plus 200 mM NaCl.

Took four fractions and did UV absorbance but no significant peak at ~800 expected for prBC. Also no visible purple throughout run which suggests protein did not bind to column.
\n", "bbcode": "Following the procedure from http://chemtools.chem.soton.ac.uk/projects/blog/blogs.php/bit_id/5591 for detergent exchange.\n\nStock solution of 20 mM Tris-HCl pH 8 is available in the lab. Will use this as the base for buffers.\n\n[blog]2767[/blog] (0.4104 g) was dissolved in 70 mL of Tris buffer.\n\nApprox 1.5 mL of prBC sample was loaded onto a DEAE-FF column equilibrated in Tris buffer. The column was loaded and then washed with ~50 mL of buffer. The column was then exchanged into Tris buffer with 20 mM [blog]2767[/blog] and the protein attempted to be eluted with Tris buffer with [blog]2767[/blog] plus 200 mM NaCl.\n\nTook four fractions and did UV absorbance but no significant peak at ~800 expected for prBC. Also no visible purple throughout run which suggests protein did not bind to column."}, "datestamp": "2009-02-01T15:00:06+00:00", "internal-links": ["2767", "2767", "2767"], "id": "2774"}, {"author": null, "timestamp": "2009-02-01T16:31:00+00:00", "section": "Materials", "title": "Lysozyme (~20 mg/mL)", "content": {"html": "Material: Solution
\nProject: SAS_standard
\nSolution of lysozyme at approx 20 mg/mL from Preparation of lysozyme solutions
This Post is Linked By: Further lysozyme runs;UV-Vis of Lysozyme and GFP samples from I22 SAXS;SAXS on I22 template;Preparation of lysozyme solutions;\n", "bbcode": "Solution of lysozyme at approx 20 mg/mL from [blog]2779[/blog]"}, "datestamp": "2009-02-01T16:30:33+00:00", "internal-links": ["2779"], "id": "2778"}, {"author": null, "timestamp": "2009-02-01T16:57:28+00:00", "section": "Materials", "title": "GFP (~20 mg/mL)", "content": {"html": "Project: SAS_standard
\nApprox 20 mg/mL GFP prepared in Preparation of GFP solutions for I22 SAXS
This Post is Linked By: Further lysozyme runs;UV-Vis of Lysozyme and GFP samples from I22 SAXS;Preparation of GFP solutions for I22 SAXS;\n", "bbcode": "Approx 20 mg/mL GFP prepared in [blog]2783[/blog]"}, "datestamp": "2009-02-01T16:32:27+00:00", "internal-links": ["2783"], "id": "2782"}, {"author": null, "timestamp": "2009-02-01T16:57:42+00:00", "section": "Materials", "title": "GFP (~10mg/mL)", "content": {"html": "Material: Solution
\nProject: SAS_standard
\nApprox 10 mg/mL GFP prepared in Preparation of GFP solutions for I22 SAXS




This Post is Linked By: Further lysozyme runs;UV-Vis of Lysozyme and GFP samples from I22 SAXS;Preparation of GFP solutions for I22 SAXS;\n", "bbcode": "Approx 10 mg/mL GFP prepared in [blog]2783[/blog]\n\n\n\n"}, "datestamp": "2009-02-01T16:57:42+00:00", "internal-links": ["2783"], "id": "2786"}, {"author": null, "timestamp": "2009-02-01T16:58:14+00:00", "section": "Materials", "title": "GFP (~5 mg/mL)", "content": {"html": "Material: Solution
\nProject: SAS_standard
\nApprox 5 mg/mL GFP prepared in Preparation of GFP solutions for I22 SAXS




This Post is Linked By: Further lysozyme runs;UV-Vis of Lysozyme and GFP samples from I22 SAXS;Preparation of GFP solutions for I22 SAXS;\n", "bbcode": "Approx 5 mg/mL GFP prepared in [blog]2783[/blog]\n\n\n\n"}, "datestamp": "2009-02-01T16:58:14+00:00", "internal-links": ["2783"], "id": "2787"}, {"author": null, "timestamp": "2009-02-01T16:58:42+00:00", "section": "Materials", "title": "GFP (~2 mg/mL)", "content": {"html": "Material: Solution
\nProject: SAS_standard
\nApprox 2 mg/mL GFP prepared in Preparation of GFP solutions for I22 SAXS




This Post is Linked By: Further lysozyme runs;UV-Vis of Lysozyme and GFP samples from I22 SAXS;Preparation of GFP solutions for I22 SAXS;\n", "bbcode": "Approx 2 mg/mL GFP prepared in [blog]2783[/blog]\n\n\n\n"}, "datestamp": "2009-02-01T16:58:42+00:00", "internal-links": ["2783"], "id": "2788"}, {"author": null, "timestamp": "2009-02-01T17:01:00+00:00", "section": "Materials", "title": "Lysozyme (~10 mg/mL)", "content": {"html": "Material: Solution
\nProject: SAS_standard
\nApprox 10 mg/mL lysozyme prepared in Preparation of lysozyme solutions




This Post is Linked By: Further lysozyme runs;UV-Vis of Lysozyme and GFP samples from I22 SAXS;Preparation of lysozyme solutions;\n", "bbcode": "Approx 10 mg/mL lysozyme prepared in [blog]2779[/blog]\n\n\n\n"}, "datestamp": "2009-02-01T17:01:00+00:00", "internal-links": ["2779"], "id": "2790"}, {"author": null, "timestamp": "2009-02-01T17:01:26+00:00", "section": "Materials", "title": "Lysozyme (~5 mg/mL)", "content": {"html": "Material: Solution
\nProject: SAS_standard
\nApprox 5 mg/mL lysozyme prepared in Preparation of lysozyme solutions




This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;SAXS on I22 template;Preparation of lysozyme solutions;\n", "bbcode": "Approx 5 mg/mL lysozyme prepared in [blog]2779[/blog]\n\n\n\n"}, "datestamp": "2009-02-01T17:01:26+00:00", "internal-links": ["2779"], "id": "2791"}, {"author": null, "timestamp": "2009-02-01T17:01:52+00:00", "section": "Materials", "title": "Lysozyme (~2 mg/mL)", "content": {"html": "Material: Solution
\nProject: SAS_standard
\nApprox 2 mg/mL lysozyme prepared in Preparation of lysozyme solutions




This Post is Linked By: UV-Vis of Lysozyme and GFP samples from I22 SAXS;SAXS on I22 template;Preparation of lysozyme solutions;\n", "bbcode": "Approx 2 mg/mL lysozyme prepared in [blog]2779[/blog]\n\n\n\n"}, "datestamp": "2009-02-01T17:01:52+00:00", "internal-links": ["2779"], "id": "2792"}, {"author": null, "timestamp": "2009-02-02T14:20:16+00:00", "section": "Materials", "title": "Tris-HCl pH 8.0 buffer", "content": {"html": "Project: SAS_standard
\nMaterial: Solution
\ntris-hcl pH 8.0 buffer
This Post is Linked By: SAXS on I22 template;\n", "bbcode": "tris-hcl pH 8.0 buffer"}, "datestamp": "2009-02-02T14:16:52+00:00", "internal-links": [], "id": "2816"}, {"author": null, "timestamp": "2009-02-02T14:30:45+00:00", "section": "Data", "title": "SAXS on Tris-HCl pH 8.0 buffer", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A02001.202A02000.DAT





This Post is Linked By: SAXS on I22 template;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A02001.202[col]A02000.DAT[/row]\n[/table]\n\n\n\n"}, "datestamp": "2009-02-02T14:30:45+00:00", "internal-links": [], "id": "2822"}, {"author": null, "timestamp": "2009-02-02T17:26:28+00:00", "section": "Data", "title": "Lysozyme 10 mg/mL with attenutor", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A10000.202A10000.DAT



This Post is Linked By: Further lysozyme runs;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A10000.202[col]A10000.DAT[/row]\n[/table]\n\n[data]314[/data]"}, "datestamp": "2009-02-02T17:22:34+00:00", "internal-links": [], "id": "2838"}, {"author": null, "timestamp": "2009-02-02T17:27:18+00:00", "section": "Data", "title": "Lysozyme 5mg/mL with attenuator", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A09000.202A09000.DAT



This Post is Linked By: SAXS on I22 template;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A09000.202[col]A09000.DAT[/row]\n[/table]\n\n[data]318[/data]"}, "datestamp": "2009-02-02T16:50:50+00:00", "internal-links": [], "id": "2834"}, {"author": null, "timestamp": "2009-02-02T17:27:32+00:00", "section": "Data", "title": "Lysozyme 2mg/mL with attenuator", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A08000.202A08000.DAT

This Post is Linked By: SAXS on I22 template;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A08000.202[col]A08000.DAT[/row]\n\n[/table][data]316[/data]"}, "datestamp": "2009-02-02T16:51:59+00:00", "internal-links": [], "id": "2835"}, {"author": null, "timestamp": "2009-02-02T17:28:05+00:00", "section": "Data", "title": "Buffer with attentuator", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A07000.202A07000.DAT



This Post is Linked By: SAXS on I22 template;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A07000.202[col]A07000.DAT[/row]\n[/table]\n\n[data]320[/data]"}, "datestamp": "2009-02-02T16:50:11+00:00", "internal-links": [], "id": "2833"}, {"author": null, "timestamp": "2009-02-02T17:32:45+00:00", "section": "Data", "title": "Lysozyme 20 mg/mL w/o attenutor", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A05000.202A05000.DAT



\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A05000.202[col]A05000.DAT[/row]\n[/table]\n\n[data]322[/data]"}, "datestamp": "2009-02-02T16:49:20+00:00", "internal-links": [], "id": "2832"}, {"author": null, "timestamp": "2009-02-02T17:33:14+00:00", "section": "Data", "title": "Lysozyme 5mg/mL w/o attenuator", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A04000.202A04000.DAT



\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A04000.202[col]A04000.DAT[/row]\n[/table]\n\n[data]324[/data]"}, "datestamp": "2009-02-02T16:47:48+00:00", "internal-links": [], "id": "2831"}, {"author": null, "timestamp": "2009-02-02T17:33:40+00:00", "section": "Data", "title": "First run on 2 mg/ml Lyzozyme", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A03000.202A03000.DAT



This Post is Linked By: SAXS on I22 template;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A03000.202[col]A03000.DAT[/row]\n[/table]\n\n[data]326[/data]"}, "datestamp": "2009-02-02T15:56:56+00:00", "internal-links": [], "id": "2824"}, {"author": null, "timestamp": "2009-02-02T17:41:04+00:00", "section": "Data", "title": "Lysozyme 20 mg/mL with attenutor", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A11000.202A11000.DAT



This Post is Linked By: Further lysozyme runs;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A11000.202[col]A11000.DAT[/row]\n[/table]\n\n[data]328[/data]"}, "datestamp": "2009-02-02T17:22:01+00:00", "internal-links": [], "id": "2837"}, {"author": null, "timestamp": "2009-02-02T17:44:08+00:00", "section": "Data", "title": "GFP 2mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A12000.202A12001.DAT






This Post is Linked By: Further lysozyme runs;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A12000.202[col]A12001.DAT[/row]\n[/table]\n\n\n\n\n"}, "datestamp": "2009-02-02T17:44:08+00:00", "internal-links": [], "id": "2858"}, {"author": null, "timestamp": "2009-02-02T18:31:31+00:00", "section": "Data", "title": "second 10 frames of 2 mg/mL GFP", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A13000.202A13001.DAT



This Post is Linked By: Further lysozyme runs;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A13000.202[col]A13001.DAT[/row]\n[/table]\n\n[data]330[/data]"}, "datestamp": "2009-02-02T18:30:15+00:00", "internal-links": [], "id": "2859"}, {"author": null, "timestamp": "2009-02-02T18:54:11+00:00", "section": "Data", "title": "GFP 5 mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A14000.202A14001.202



This Post is Linked By: Further lysozyme runs;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A14000.202[col]A14001.202[/row]\n[/table]\n\n[data]332[/data]"}, "datestamp": "2009-02-02T18:30:48+00:00", "internal-links": [], "id": "2860"}, {"author": null, "timestamp": "2009-02-02T19:28:54+00:00", "section": "Materials", "title": "0.25 mg/mL GluR0 with glutamate", "content": {"html": "Material: Solution
\nProject: SAS_standard
\n0.25 mg/mL GluR0 with glutamate prepared by Michael
This Post is Linked By: SAXS runs of GluR0;\n", "bbcode": "0.25 mg/mL GluR0 with glutamate prepared by Michael"}, "datestamp": "2009-02-02T19:28:39+00:00", "internal-links": [], "id": "2872"}, {"author": null, "timestamp": "2009-02-02T19:29:40+00:00", "section": "Materials", "title": "0.5 mg/mL GluR0 with glutamate", "content": {"html": "Material: Solution
\nProject: SAS_standard
\n0.5 mg/mL GluR0 with glutamate prepared by Michael
This Post is Linked By: SAXS runs of GluR0;\n", "bbcode": "0.5 mg/mL GluR0 with glutamate prepared by Michael"}, "datestamp": "2009-02-02T19:29:27+00:00", "internal-links": [], "id": "2874"}, {"author": null, "timestamp": "2009-02-02T19:36:27+00:00", "section": "Data", "title": "GFP 10mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A15000.202A15001.DAT

This Post is Linked By: Further lysozyme runs;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A15000.202[col]A15001.DAT[/row]\n[/table][data]334[/data]"}, "datestamp": "2009-02-02T18:37:12+00:00", "internal-links": [], "id": "2863"}, {"author": null, "timestamp": "2009-02-02T19:36:54+00:00", "section": "Data", "title": "GFP 20mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: SAS_standard
\n
Raw data fileData file
A16000.202A16001.DAT

This Post is Linked By: Further lysozyme runs;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A16000.202[col]A16001.DAT[/row]\n[/table][data]336[/data]"}, "datestamp": "2009-02-02T18:37:38+00:00", "internal-links": [], "id": "2864"}, {"author": null, "timestamp": "2009-02-02T22:46:49+00:00", "section": "Procedures", "title": "SAXS on I22 template", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nThe following samples were run in 1mm SAXS cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
Tris-HCl pH 8.0 buffer110A2001.202SAXS on Tris-HCl pH 8.0 buffer
Lysozyme (~2 mg/mL)1010A03000.202First run on 20 mg/ml Lyzozyme
Lysozyme (~5 mg/mL)1010A04000.202
Lysozyme (~20 mg/mL)1010A05000.202
Tris-HCl pH 8.0 buffer1010A06000.202
Tris-HCl pH 8.0 buffer3030A07000.202Buffer with attentuator
Lysozyme (~2 mg/mL)3030A08000.202Lysozyme 2mg/mL with attenuator
Lysozyme (~5 mg/mL)3030A09000.202Lysozyme 5mg/mL with attenuator


After first four runs put in attentuator (10x, 0.5 mm of Al)
\n", "bbcode": "The following samples were run in 1mm SAXS cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2816[/blog][col]1[col]10[col]A2001.202[col][blog]2822[/blog][/row]\n[row][blog]2792[/blog][col]10[col]10[col]A03000.202[col][blog]2824[/blog][/row]\n[row][blog]2791[/blog][col]10[col]10[col]A04000.202[col][blog][/blog][/row]\n[row][blog]2778[/blog][col]10[col]10[col]A05000.202[col][blog][/blog][/row]\n[row][blog]2816[/blog][col]10[col]10[col]A06000.202[col][blog][/blog][/row]\n[row][blog]2816[/blog][col]30[col]30[col]A07000.202[col][blog]2833[/blog][/row]\n[row][blog]2792[/blog][col]30[col]30[col]A08000.202[col][blog]2835[/blog][/row]\n[row][blog]2791[/blog][col]30[col]30[col]A09000.202[col][blog]2834[/blog][/row]\n[/table]\n\nAfter first four runs put in attentuator (10x, 0.5 mm of Al)"}, "datestamp": "2009-02-02T16:22:56+00:00", "internal-links": ["2816", "2822", "2792", "2824", "2791", "2778", "2816", "2816", "2833", "2792", "2835", "2791", "2834"], "id": "2825"}, {"author": null, "timestamp": "2009-02-02T23:00:53+00:00", "section": "Materials", "title": "GluR0 buffer", "content": {"html": "Material: Solution
\nProject: GluR0
\nGluR0 buffer prepared by Michael
This Post is Linked By: SAXS on GluR) in capillaries;\n", "bbcode": "GluR0 buffer prepared by Michael"}, "datestamp": "2009-02-02T23:00:41+00:00", "internal-links": [], "id": "2896"}, {"author": null, "timestamp": "2009-02-02T23:02:27+00:00", "section": "Procedures", "title": "SAXS runs of GluR0", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nProject: GluR0
\nThe following samples were run in 1mm SAXS cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
0.25 mg/mL GluR0 with glutamate3030A17000.202GluR0 SAXS 0.25 mg/mL + glu first run
0.5 mg/mL GluR0 with glutamate3030A1800.202SAXS of 0.5 mg/mL GluR0 with glutamate


SAXS from 0.5 mg/mL seems poor compared to 0.25 mg/mL. Are these the wrong way around?
\n", "bbcode": "The following samples were run in 1mm SAXS cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2872[/blog][col]30[col]30[col]A17000.202[col][blog]2876[/blog][/row]\n[row][blog]2874[/blog][col]30[col]30[col]A1800.202[col][blog]2881[/blog][/row]\n[/table]\n\nSAXS from 0.5 mg/mL seems poor compared to 0.25 mg/mL. Are these the wrong way around?"}, "datestamp": "2009-02-02T22:45:48+00:00", "internal-links": ["2872", "2876", "2874", "2881"], "id": "2886"}, {"author": null, "timestamp": "2009-02-02T23:12:00+00:00", "section": "Materials", "title": "GluR0 1mg/mL no glutamate", "content": {"html": "Material: Solution
\nProject: GluR0
\nGluR0 1mg/mL no glutamate prepared by Michael
This Post is Linked By: SAXS on GluR) in capillaries;\n", "bbcode": "GluR0 1mg/mL no glutamate prepared by Michael"}, "datestamp": "2009-02-02T23:11:51+00:00", "internal-links": [], "id": "2900"}, {"author": null, "timestamp": "2009-02-02T23:12:36+00:00", "section": "Materials", "title": "0.5 mg/mL GluR0 no glutamate", "content": {"html": "Material: Solution
\nProject: GluR0
\n0.5 mg/mL GluR0 no glutamate prepared by Michael




This Post is Linked By: SAXS on GluR) in capillaries;\n", "bbcode": "0.5 mg/mL GluR0 no glutamate prepared by Michael\n\n\n\n"}, "datestamp": "2009-02-02T23:12:36+00:00", "internal-links": [], "id": "2903"}, {"author": null, "timestamp": "2009-02-02T23:12:54+00:00", "section": "Materials", "title": "0.25 mg/mL GluR0 no glutamate", "content": {"html": "Material: Solution
\nProject: GluR0
\n0.25 mg/mL GluR0 no glutamate prepared by Michael




This Post is Linked By: SAXS on GluR) in capillaries;\n", "bbcode": "0.25 mg/mL GluR0 no glutamate prepared by Michael\n\n\n\n"}, "datestamp": "2009-02-02T23:12:54+00:00", "internal-links": [], "id": "2904"}, {"author": null, "timestamp": "2009-02-02T23:14:13+00:00", "section": "Data", "title": "SAXS of 0.5 mg/mL GluR0 with glutamate", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A18000.202A18001.DAT

This Post is Linked By: SAXS runs of GluR0;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A18000.202[col]A18001.DAT[/row]\n[/table][data]338[/data]"}, "datestamp": "2009-02-02T19:51:10+00:00", "internal-links": [], "id": "2881"}, {"author": null, "timestamp": "2009-02-02T23:14:47+00:00", "section": "Data", "title": "GluR0 SAXS 0.25 mg/mL + glu first run", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A17000.202A17001.DAT

This Post is Linked By: SAXS runs of GluR0;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A17000.202[col]A17001.DAT[/row]\n[/table][data]340[/data]"}, "datestamp": "2009-02-02T19:34:56+00:00", "internal-links": [], "id": "2876"}, {"author": null, "timestamp": "2009-02-02T23:30:16+00:00", "section": "Data", "title": "SAXS of GLuR0 buffer", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A19000.202A19001.DAT
A19001.DAT

This Post is Linked By: SAXS on GluR) in capillaries;Reprocessing SAXS data from Feb 09;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A19000.202[col]A19001.DAT[/row]\n[/table][data]342[/data]"}, "datestamp": "2009-02-02T23:29:56+00:00", "internal-links": [], "id": "2909"}, {"author": null, "timestamp": "2009-02-02T23:39:03+00:00", "section": "Data", "title": "SAXS of 1 mg/mL GluR0 no glutamate", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A20000.202A20001.DAT
A20001.DAT

This Post is Linked By: SAXS on GluR) in capillaries;Reprocessing SAXS data from Feb 09;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A20000.202[col]A20001.DAT[/row]\n[/table][data]344[/data]"}, "datestamp": "2009-02-02T23:31:15+00:00", "internal-links": [], "id": "2912"}, {"author": null, "timestamp": "2009-02-02T23:58:30+00:00", "section": "Data", "title": "SAXS of GluR0 0.5 mg/mL no glutamate", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A21000.202A21001.DAT

This Post is Linked By: SAXS on GluR) in capillaries;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A21000.202[col]A21001.DAT[/row]\n[/table][data]346[/data]"}, "datestamp": "2009-02-02T23:48:42+00:00", "internal-links": [], "id": "2915"}, {"author": null, "timestamp": "2009-02-03T00:13:10+00:00", "section": "Procedures", "title": "SAXS on GluR) in capillaries", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nThe following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
GluR0 buffer3030A19000.202SAXS of GLuR0 buffer
GluR0 1mg/mL no glutamate3030A20000.202SAXS of 1 mg/mL GluR0 no glutamate
0.5 mg/mL GluR0 no glutamate3030A21000.202SAXS of GluR0 0.5 mg/mL no glutamate
0.25 mg/mL GluR0 no glutamate303022000.202SAXS of GluR0 0.25 mg/mL no glutamate

\n", "bbcode": "The following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2896[/blog][col]30[col]30[col]A19000.202[col][blog]2909[/blog][/row]\n[row][blog]2900[/blog][col]30[col]30[col]A20000.202[col][blog]2912[/blog][/row]\n[row][blog]2903[/blog][col]30[col]30[col]A21000.202[col][blog]2915[/blog][/row]\n[row][blog]2904[/blog][col]30[col]30[col]22000.202[col][blog]2920[/blog][/row]\n[/table]"}, "datestamp": "2009-02-03T00:12:57+00:00", "internal-links": ["2896", "2909", "2900", "2912", "2903", "2915", "2904", "2920"], "id": "2921"}, {"author": null, "timestamp": "2009-02-03T00:20:36+00:00", "section": "Data", "title": "SAXS of GluR0 0.25 mg/mL no glutamate", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A22000.202A22001.DAT

This Post is Linked By: SAXS on GluR) in capillaries;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A22000.202[col]A22001.DAT[/row]\n[/table][data]348[/data]"}, "datestamp": "2009-02-03T00:04:04+00:00", "internal-links": [], "id": "2920"}, {"author": null, "timestamp": "2009-02-03T00:24:09+00:00", "section": "Materials", "title": "Tus buffer", "content": {"html": "Material: Solution
\nProject: Tus_labelling
\nTus buffer prepared by Shubbie




This Post is Linked By: SAXS of Tus samples;\n", "bbcode": "Tus buffer prepared by Shubbie\n\n\n\n"}, "datestamp": "2009-02-03T00:24:09+00:00", "internal-links": [], "id": "2926"}, {"author": null, "timestamp": "2009-02-03T00:24:27+00:00", "section": "Materials", "title": "Tus unlabelled", "content": {"html": "Material: Solution
\nProject: Tus_labelling
\nUnlabelled Tus prepared by Shubbie




This Post is Linked By: SAXS of Tus samples;\n", "bbcode": "Unlabelled Tus prepared by Shubbie\n\n\n\n"}, "datestamp": "2009-02-03T00:24:27+00:00", "internal-links": [], "id": "2927"}, {"author": null, "timestamp": "2009-02-03T00:25:04+00:00", "section": "Materials", "title": "Fluorescein labelled Tus", "content": {"html": "Material: Solution
\nProject: Tus_labelling
\nFluorescein labelled Tus prepared by Shubbie




\n", "bbcode": "Fluorescein labelled Tus prepared by Shubbie\n\n\n\n"}, "datestamp": "2009-02-03T00:25:04+00:00", "internal-links": [], "id": "2928"}, {"author": null, "timestamp": "2009-02-03T00:28:04+00:00", "section": "Data", "title": "SAXS of unlabelled Tus", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Tus_labelling
\n
Raw data fileData file
A24000.202A24001.DAT






This Post is Linked By: SAXS of Tus samples;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A24000.202[col]A24001.DAT[/row]\n[/table]\n\n\n\n\n"}, "datestamp": "2009-02-03T00:28:04+00:00", "internal-links": [], "id": "2931"}, {"author": null, "timestamp": "2009-02-03T00:28:28+00:00", "section": "Data", "title": "SAXS of labelled Tus", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Tus_labelling
\n
Raw data fileData file
A25000.202A25001.DAT






This Post is Linked By: SAXS of Tus samples;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A25000.202[col]A25001.DAT[/row]\n[/table]\n\n\n\n\n"}, "datestamp": "2009-02-03T00:28:28+00:00", "internal-links": [], "id": "2932"}, {"author": null, "timestamp": "2009-02-03T00:36:28+00:00", "section": "Data", "title": "SAXS of Tus buffer", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Tus_labelling
\n
Raw data fileData file
A23000.202A23000.DAT



This Post is Linked By: SAXS of Tus samples;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A23000.202[col]A23000.DAT[/row]\n[/table]\n\n[data]352[/data]"}, "datestamp": "2009-02-03T00:27:36+00:00", "internal-links": [], "id": "2930"}, {"author": null, "timestamp": "2009-02-03T01:12:57+00:00", "section": "Procedures", "title": "SAXS of Tus samples", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nThe following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
Tus buffer3030A23000.202SAXS of Tus buffer
Tus buffer3030A24000.202SAXS of unlabelled Tus
Tus unlabelled1090A25000.202SAXS of labelled Tus


No apparent scattering from Tus samples?!? even though supposed to be 2 mg/mL
\n", "bbcode": "The following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2926[/blog][col]30[col]30[col]A23000.202[col][blog]2930[/blog][/row]\n[row][blog]2926[/blog][col]30[col]30[col]A24000.202[col][blog]2931[/blog][/row]\n[row][blog]2927[/blog][col]10[col]90[col]A25000.202[col][blog]2932[/blog][/row]\n[/table]\n\nNo apparent scattering from Tus samples?!? even though supposed to be 2 mg/mL"}, "datestamp": "2009-02-03T01:12:24+00:00", "internal-links": ["2926", "2930", "2926", "2931", "2927", "2932"], "id": "2937"}, {"author": null, "timestamp": "2009-02-03T01:14:00+00:00", "section": "Materials", "title": "JHL sample", "content": {"html": "Material: Solution
\nProject: JHL
\nJHL Sample (23 mg/mL)




This Post is Linked By: SAXS for JHL;\n", "bbcode": "JHL Sample (23 mg/mL)\n\n\n\n"}, "datestamp": "2009-02-03T01:14:00+00:00", "internal-links": [], "id": "2940"}, {"author": null, "timestamp": "2009-02-03T01:14:28+00:00", "section": "Materials", "title": "JHL buffer", "content": {"html": "Material: Solution
\nProject: JHL
\nJHL buffer




This Post is Linked By: SAXS for JHL;\n", "bbcode": "JHL buffer\n\n\n\n"}, "datestamp": "2009-02-03T01:14:28+00:00", "internal-links": [], "id": "2941"}, {"author": null, "timestamp": "2009-02-03T01:50:29+00:00", "section": "Materials", "title": "JHL 10mg/mL", "content": {"html": "Material: Solution
\nProject: JHL
\nJHL 10 mg/mL




This Post is Linked By: SAXS for JHL;\n", "bbcode": "JHL 10 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T01:50:29+00:00", "internal-links": [], "id": "2942"}, {"author": null, "timestamp": "2009-02-03T02:09:23+00:00", "section": "Materials", "title": "JHL RP 5 mg/mL", "content": {"html": "Material: Solution
\nProject: JHL
\nJHL RP 5 mg/mL




This Post is Linked By: SAXS for JHL;\n", "bbcode": "JHL RP 5 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T02:09:23+00:00", "internal-links": [], "id": "2944"}, {"author": null, "timestamp": "2009-02-03T02:15:30+00:00", "section": "Materials", "title": "JHL N 10 mg/mL", "content": {"html": "Material: Solution
\nProject: JHL
\nJHL N 10 mg/mL




This Post is Linked By: SAXS for JHL;\n", "bbcode": "JHL N 10 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T02:15:30+00:00", "internal-links": [], "id": "2945"}, {"author": null, "timestamp": "2009-02-03T02:24:55+00:00", "section": "Materials", "title": "JHL N 5 mg/mL", "content": {"html": "Material: Solution
\nProject: JHL
\nJHL N 5 mg/mL




This Post is Linked By: SAXS for JHL;\n", "bbcode": "JHL N 5 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T02:24:55+00:00", "internal-links": [], "id": "2946"}, {"author": null, "timestamp": "2009-02-03T02:25:31+00:00", "section": "Procedures", "title": "SAXS for JHL", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nThe following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
JHL sample1090A26000.202
JHL buffer1090A27000.202
JHL 10mg/mL1090A28000.202
JHL RP 5 mg/mL2-390A29000.203
JHL N 10 mg/mL1090A30000.203
JHL N 5 mg/mL1090A31000.203

\n", "bbcode": "The following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2940[/blog][col]10[col]90[col]A26000.202[col][blog][/blog][/row]\n[row][blog]2941[/blog][col]10[col]90[col]A27000.202[col][blog][/blog][/row]\n[row][blog]2942[/blog][col]10[col]90[col]A28000.202[col][blog][/blog][/row]\n[row][blog]2944[/blog][col]2-3[col]90[col]A29000.203[col][blog][/blog][/row]\n[row][blog]2945[/blog][col]10[col]90[col]A30000.203[col][blog][/blog][/row]\n[row][blog]2946[/blog][col]10[col]90[col]A31000.203[col][blog][/blog][/row]\n[/table]"}, "datestamp": "2009-02-03T01:50:36+00:00", "internal-links": ["2940", "2941", "2942", "2944", "2945", "2946"], "id": "2943"}, {"author": null, "timestamp": "2009-02-03T02:43:21+00:00", "section": "Materials", "title": "ATIC - Buffer", "content": {"html": "Material: Solution
\nProject: Soton
\nATIC buffer from Southampton




This Post is Linked By: SAXS on ATIC;Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "ATIC buffer from Southampton\n\n\n\n"}, "datestamp": "2009-02-03T02:43:21+00:00", "internal-links": [], "id": "2948"}, {"author": null, "timestamp": "2009-02-03T02:43:46+00:00", "section": "Materials", "title": "ATIC 20 mg/mL", "content": {"html": "Material: Solution
\nProject: Soton
\nATIC 20 mg/mL




This Post is Linked By: SAXS on ATIC;Addition of inhibitor to ATIC solutions;Further preparation of samples with inhibitor;Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "ATIC 20 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T02:43:46+00:00", "internal-links": [], "id": "2949"}, {"author": null, "timestamp": "2009-02-03T02:44:10+00:00", "section": "Materials", "title": "ATIC 10 mg/mL", "content": {"html": "Material: Solution
\nProject: Soton
\nATIC 10 mg/mL




This Post is Linked By: SAXS on ATIC;Addition of inhibitor to ATIC solutions;Further preparation of samples with inhibitor;\n", "bbcode": "ATIC 10 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T02:44:10+00:00", "internal-links": [], "id": "2950"}, {"author": null, "timestamp": "2009-02-03T02:44:36+00:00", "section": "Materials", "title": "ATIC 5 mg/mL", "content": {"html": "Material: Solution
\nProject: Soton
\nATIC 5 mg/mL




This Post is Linked By: SAXS on ATIC;\n", "bbcode": "ATIC 5 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T02:44:36+00:00", "internal-links": [], "id": "2951"}, {"author": null, "timestamp": "2009-02-03T02:45:01+00:00", "section": "Materials", "title": "ATIC 2 mg/mL", "content": {"html": "Material: Solution
\nProject: Soton
\nATIC 2 mg/mL




This Post is Linked By: SAXS on ATIC;\n", "bbcode": "ATIC 2 mg/mL\n\n\n\n"}, "datestamp": "2009-02-03T02:45:01+00:00", "internal-links": [], "id": "2952"}, {"author": null, "timestamp": "2009-02-03T03:13:16+00:00", "section": "Data", "title": "SAX of ATIC buffer", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A32000.203A32001.DAT






This Post is Linked By: SAXS on ATIC;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A32000.203[col]A32001.DAT[/row]\n[/table]\n\n\n\n\n"}, "datestamp": "2009-02-03T03:13:16+00:00", "internal-links": [], "id": "2954"}, {"author": null, "timestamp": "2009-02-03T03:31:05+00:00", "section": "Data", "title": "SAXS on ATIC 20 mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A33000.203A33001.DAT

This Post is Linked By: SAXS on ATIC;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A33000.203[col]A33001.DAT[/row]\n[/table][data]354[/data]"}, "datestamp": "2009-02-03T03:15:16+00:00", "internal-links": [], "id": "2955"}, {"author": null, "timestamp": "2009-02-03T03:47:34+00:00", "section": "Data", "title": "SAXS on ATIC 2 mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A34000.203A34001.DAT

This Post is Linked By: SAXS on ATIC;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A34000.203[col]A34001.DAT[/row]\n[/table][data]356[/data]"}, "datestamp": "2009-02-03T03:32:23+00:00", "internal-links": [], "id": "2958"}, {"author": null, "timestamp": "2009-02-03T04:05:54+00:00", "section": "Data", "title": "SAXS on ATIC 10 mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A35000.203A35001.DAT

This Post is Linked By: SAXS on ATIC;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A35000.203[col]A35001.DAT[/row]\n[/table][data]358[/data]"}, "datestamp": "2009-02-03T04:05:40+00:00", "internal-links": [], "id": "2961"}, {"author": null, "timestamp": "2009-02-03T04:21:23+00:00", "section": "Data", "title": "SAXS on ATIC 5 mg/mL", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A36000.203A36001.DAT

This Post is Linked By: SAXS on ATIC;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A36000.203[col]A36001.DAT[/row]\n[/table][data]360[/data]"}, "datestamp": "2009-02-03T04:21:10+00:00", "internal-links": [], "id": "2964"}, {"author": null, "timestamp": "2009-02-03T04:22:06+00:00", "section": "Procedures", "title": "SAXS on ATIC", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nProject: Soton
\nThe following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
ATIC - Buffer1090A32000.203SAX of ATIC buffer
ATIC 20 mg/mL1090A33000.203SAXS on ATIC 20 mg/mL
ATIC 2 mg/mL1090A34000.203SAXS on ATIC 2 mg/mL
ATIC 10 mg/mL1090A35000.203SAXS on ATIC 10 mg/mL
ATIC 5 mg/mL1090A36000.203SAXS on ATIC 5 mg/mL

\n", "bbcode": "The following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2948[/blog][col]10[col]90[col]A32000.203[col][blog]2954[/blog][/row]\n[row][blog]2949[/blog][col]10[col]90[col]A33000.203[col][blog]2955[/blog][/row]\n[row][blog]2952[/blog][col]10[col]90[col]A34000.203[col][blog]2958[/blog][/row]\n[row][blog]2950[/blog][col]10[col]90[col]A35000.203[col][blog]2961[/blog][/row]\n[row][blog]2951[/blog][col]10[col]90[col]A36000.203[col][blog]2964[/blog][/row]\n[/table]"}, "datestamp": "2009-02-03T04:21:49+00:00", "internal-links": ["2948", "2954", "2949", "2955", "2952", "2958", "2950", "2961", "2951", "2964"], "id": "2967"}, {"author": null, "timestamp": "2009-02-03T04:58:30+00:00", "section": "Materials", "title": "20 mg/mL ATIC with inhibitor", "content": {"html": "Material: Solution
\nProject: Soton
\nProduct 1 of Addition of inhibitor to ATIC solutions




This Post is Linked By: Addition of inhibitor to ATIC solutions;SAXS of ATIC with inhibitors;\n", "bbcode": "Product 1 of [blog]2970[/blog]\n\n\n\n"}, "datestamp": "2009-02-03T04:58:30+00:00", "internal-links": ["2970"], "id": "2971"}, {"author": null, "timestamp": "2009-02-03T04:59:29+00:00", "section": "Materials", "title": "10 mg/mL ATIC with inhibitor", "content": {"html": "Material: Solution
\nProject: Soton
\nProduct 2 of Addition of inhibitor to ATIC solutions




This Post is Linked By: Addition of inhibitor to ATIC solutions;SAXS of ATIC with inhibitors;\n", "bbcode": "Product 2 of [blog]2970[/blog]\n\n\n\n"}, "datestamp": "2009-02-03T04:59:29+00:00", "internal-links": ["2970"], "id": "2972"}, {"author": null, "timestamp": "2009-02-03T04:59:39+00:00", "section": "Procedures", "title": "Addition of inhibitor to ATIC solutions", "content": {"html": "Project: Soton
\nTo ATIC 20 mg/mL (100 uL) was added 2 uL of peptide inhibitor to make 20 mg/mL ATIC with inhibitor.

To ATIC 10 mg/mL (100 uL) was added 2 uL of peptide inhibitor to make 10 mg/mL ATIC with inhibitor
This Post is Linked By: 20 mg/mL ATIC with inhibitor;10 mg/mL ATIC with inhibitor;\n", "bbcode": "To [blog]2949[/blog] (100 uL) was added 2 uL of peptide inhibitor to make [blog]2971[/blog].\n\nTo [blog]2950[/blog] (100 uL) was added 2 uL of peptide inhibitor to make [blog]2972[/blog]"}, "datestamp": "2009-02-03T04:58:11+00:00", "internal-links": ["2949", "2971", "2950", "2972"], "id": "2970"}, {"author": null, "timestamp": "2009-02-03T05:43:52+00:00", "section": "Data", "title": "SAXS on 20 mg/mL ATIC plus inhibitor (2%)", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A39000.203A39001.DAT

This Post is Linked By: SAXS of ATIC with inhibitors;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A39000.203[col]A39001.DAT[/row]\n[/table][data]362[/data]"}, "datestamp": "2009-02-03T05:21:05+00:00", "internal-links": [], "id": "2974"}, {"author": null, "timestamp": "2009-02-03T05:51:09+00:00", "section": "Data", "title": "SAXS on 10 mg/mL ATIC plus inhibitor (2%)", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A40000.203A40001.DAT

This Post is Linked By: SAXS of ATIC with inhibitors;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A40000.203[col]A40001.DAT[/row]\n[/table][data]364[/data]"}, "datestamp": "2009-02-03T05:22:04+00:00", "internal-links": [], "id": "2975"}, {"author": null, "timestamp": "2009-02-03T06:28:30+00:00", "section": "Data", "title": "Second SAXS run on 10 mg/mL with inhibitor", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A41000.203A41001.DAT

This Post is Linked By: SAXS of ATIC with inhibitors;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A41000.203[col]A41001.DAT[/row]\n[/table][data]366[/data]"}, "datestamp": "2009-02-03T06:28:16+00:00", "internal-links": [], "id": "2982"}, {"author": null, "timestamp": "2009-02-03T06:59:31+00:00", "section": "Materials", "title": "5 mg/mL ATIC + 10% inhibitor", "content": {"html": "Material: Solution
\nProject: Soton
\n5 mg/mL ATIC + 10% inhibitor prepared in Further preparation of samples with inhibitor




This Post is Linked By: Further preparation of samples with inhibitor;Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "5 mg/mL ATIC + 10% inhibitor prepared in [blog]2985[/blog]\n\n\n\n"}, "datestamp": "2009-02-03T06:59:31+00:00", "internal-links": ["2985"], "id": "2986"}, {"author": null, "timestamp": "2009-02-03T07:00:07+00:00", "section": "Materials", "title": "10 mg/mL ATIC with 10% inhibitor", "content": {"html": "Material: Solution
\nProject: Soton
\n10 mg/mL ATIC with 10% inhibitor prepared in Further preparation of samples with inhibitor




This Post is Linked By: Further preparation of samples with inhibitor;Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "10 mg/mL ATIC with 10% inhibitor prepared in [blog]2985[/blog]\n\n\n\n"}, "datestamp": "2009-02-03T07:00:07+00:00", "internal-links": ["2985"], "id": "2987"}, {"author": null, "timestamp": "2009-02-03T07:08:12+00:00", "section": "Procedures", "title": "Further preparation of samples with inhibitor", "content": {"html": "Project: Soton
\nTo ATIC 20 mg/mL (100 uL) was added 10 uL of inhibitor in DMSO to give 5 mg/mL ATIC + 10% inhibitor

To ATIC 10 mg/mL (100 uL) was added 10 uL of inhibitor in DMSO to give 10 mg/mL ATIC with 10% inhibitor
This Post is Linked By: 5 mg/mL ATIC + 10% inhibitor;10 mg/mL ATIC with 10% inhibitor;\n", "bbcode": "To [blog]2949[/blog] (100 uL) was added 10 uL of inhibitor in DMSO to give [blog]2986[/blog]\n\nTo [blog]2950[/blog] (100 uL) was added 10 uL of inhibitor in DMSO to give [blog]2987[/blog]"}, "datestamp": "2009-02-03T06:59:14+00:00", "internal-links": ["2949", "2986", "2950", "2987"], "id": "2985"}, {"author": null, "timestamp": "2009-02-03T07:55:50+00:00", "section": "Data", "title": "SAXS on 5 mg/mL ATIC with 10% inhibitor", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A45000.203A45001.DAT

This Post is Linked By: Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A45000.203[col]A45001.DAT[/row]\n[/table][data]368[/data]"}, "datestamp": "2009-02-03T07:23:20+00:00", "internal-links": [], "id": "2991"}, {"author": null, "timestamp": "2009-02-03T07:56:14+00:00", "section": "Data", "title": "SAXS of 10 mg/mL ATIC with 10% inhibitor", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A43000.203A43001.DAT


Somehow the data for this run seemed to get lost due to a computer glitch.
This Post is Linked By: Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A43000.203[col]A43001.DAT[/row]\n[/table]\n\nSomehow the data for this run seemed to get lost due to a computer glitch."}, "datestamp": "2009-02-03T07:22:17+00:00", "internal-links": [], "id": "2990"}, {"author": null, "timestamp": "2009-02-03T08:21:47+00:00", "section": "Procedures", "title": "SAXS of ATIC with inhibitors", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nProject: Soton
\nThe following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
20 mg/mL ATIC with inhibitor1090A39000.203SAXS on 20 mg/mL ATIC plus inhibitor (2%)
10 mg/mL ATIC with inhibitor590A40000.203SAXS on 10 mg/mL ATIC plus inhibitor (2%)
10 mg/mL ATIC with inhibitor1090A41000.203Second SAXS run on 10 mg/mL with inhibitor

\n", "bbcode": "The following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2971[/blog][col]10[col]90[col]A39000.203[col][blog]2974[/blog][/row]\n[row][blog]2972[/blog][col]5[col]90[col]A40000.203[col][blog]2975[/blog][/row]\n[row][blog]2972[/blog][col]10[col]90[col]A41000.203[col][blog]2982[/blog][/row]\n[/table]"}, "datestamp": "2009-02-03T08:21:21+00:00", "internal-links": ["2971", "2974", "2972", "2975", "2972", "2982"], "id": "3000"}, {"author": null, "timestamp": "2009-02-03T08:53:34+00:00", "section": "Data", "title": "Repeat SAXS of 10 mg/mL ATIC with 10% inhibitor", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A48000.203A48001.DAT

This Post is Linked By: Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A48000.203[col]A48001.DAT[/row]\n[/table][data]370[/data]"}, "datestamp": "2009-02-03T08:39:46+00:00", "internal-links": [], "id": "3002"}, {"author": null, "timestamp": "2009-02-03T09:12:14+00:00", "section": "Data", "title": "Repeat SAXS of 20 mg/mL ATIC", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A49000.203A49001.DAT

This Post is Linked By: Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A49000.203[col]A49001.DAT[/row]\n[/table][data]372[/data]"}, "datestamp": "2009-02-03T08:54:53+00:00", "internal-links": [], "id": "3005"}, {"author": null, "timestamp": "2009-02-03T09:34:33+00:00", "section": "Data", "title": "Repeat SAXS of ATIC buffer", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Soton
\n
Raw data fileData file
A52000.203A52001.DAT






This Post is Linked By: Continuing SAXS on ATIC with (and without) inhibitor;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A52000.203[col]A52001.DAT[/row]\n[/table]\n\n\n\n\n"}, "datestamp": "2009-02-03T09:34:33+00:00", "internal-links": [], "id": "3008"}, {"author": null, "timestamp": "2009-02-03T10:56:21+00:00", "section": "Procedures", "title": "Continuing SAXS on ATIC with (and without) inhibitor", "content": {"html": "Procedure: SAXS
\nInstrument: I22
\nThe following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
10 mg/mL ATIC with 10% inhibitor1090A44000.203SAXS of 10 mg/mL ATIC with 10% inhibitor
5 mg/mL ATIC + 10% inhibitor1090A44000.203SAXS on 5 mg/mL ATIC with 10% inhibitor
10 mg/mL ATIC with 10% inhibitor1090A48000.203Repeat SAXS of 10 mg/mL ATIC with 10% inhibitor
ATIC 20 mg/mL1090A49000Repeat SAXS of 20 mg/mL ATIC
ATIC - Buffer990A51000.203Repeat SAXS of ATIC buffer






\n", "bbcode": "The following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][blog]2987[/blog][col]10[col]90[col]A44000.203[col][blog]2990[/blog][/row]\n[row][blog]2986[/blog][col]10[col]90[col]A44000.203[col][blog]2991[/blog][/row]\n[row][blog]2987[/blog][col]10[col]90[col]A48000.203[col][blog]3002[/blog][/row]\n[row][blog]2949[/blog][col]10[col]90[col]A49000[col][blog]3005[/blog][/row]\n[row][blog]2948[/blog][col]9[col]90[col]A51000.203[col][blog]3008[/blog][/row]\n[row][blog][/blog][col][col][col][col][blog][/blog][/row]\n[/table]\n\n\n\n\n"}, "datestamp": "2009-02-03T10:56:21+00:00", "internal-links": ["2987", "2990", "2986", "2991", "2987", "3002", "2949", "3005", "2948", "3008"], "id": "3010"}, {"author": null, "timestamp": "2009-03-10T14:20:00+00:00", "section": "Note", "title": "test", "content": {"html": "test
\n", "bbcode": "test"}, "datestamp": "2009-03-10T14:20:00+00:00", "internal-links": [], "id": "7501"}, {"author": null, "timestamp": "2009-05-29T13:08:32+01:00", "section": "Procedures", "title": "Preparation of lysozyme solutions", "content": {"html": "Project: SAS_standard
\nLysozyme (26.3 mg) was dissolved in 1 mL of 20 mM Tris-HCl pH 8.0 (lab stock). The solution was spun at 15 krpm for 10 minutes and then transferred to a fresh tube to give Lysozyme (~20 mg/mL)

From Lysozyme (~20 mg/mL) 200 uL was diluted with 200 uL of buffer to give Lysozyme (~10 mg/mL).

From Lysozyme (~20 mg/mL) 100 uL was diluted with 300 uL of buffer to give Lysozyme (~5 mg/mL)

From Lysozyme (~20 mg/mL) 50 uL was diluted with 450 uL of buffer to give Lysozyme (~2 mg/mL).

Solutions were kept in the cold room overnight.
This Post is Linked By: Lysozyme (~20 mg/mL);Lysozyme (~10 mg/mL);Lysozyme (~5 mg/mL);Lysozyme (~2 mg/mL);\n", "bbcode": "[blog]2777[/blog] (26.3 mg) was dissolved in 1 mL of 20 mM Tris-HCl pH 8.0 (lab stock). The solution was spun at 15 krpm for 10 minutes and then transferred to a fresh tube to give [blog]2778[/blog]\n\nFrom [blog]2778[/blog] 200 uL was diluted with 200 uL of buffer to give [blog]2790[/blog].\n\nFrom [blog]2778[/blog] 100 uL was diluted with 300 uL of buffer to give [blog]2791[/blog]\n\nFrom [blog]2778[/blog] 50 uL was diluted with 450 uL of buffer to give [blog]2792[/blog].\n\nSolutions were kept in the cold room overnight."}, "datestamp": "2009-02-01T16:30:55+00:00", "internal-links": ["2777", "2778", "2778", "2790", "2778", "2791", "2778", "2792"], "id": "2779"}, {"author": null, "timestamp": "2009-05-29T13:08:10+01:00", "section": "Procedures", "title": "Preparation of GFP solutions for I22 SAXS", "content": {"html": "Project: SAS_standard
\nPreviously purified and freeze dried GFP (17.8 mg) was dissolved in 1 mL of 20 mM Tris-HCl pH 8.0 (lab stock). The solution was spun at 14 krpm for ten minutes and then transferred to a fresh tube to give GFP (~20 mg/mL). Significant ppt is obvious after centrifugation so probably lost several miligrams.

From GFP (~10mg/mL) 200 uL was diluted with 200 uL of buffer to give GFP (~10mg/mL).

From GFP (~20 mg/mL) 100 uL was diluted with 300 uL of buffer to give GFP (~5 mg/mL).

From GFP (~20 mg/mL) 50 uL was diluted with 450 uL of buffer to give GFP (~2 mg/mL).
This Post is Linked By: GFP (~20 mg/mL);GFP (~10mg/mL);GFP (~5 mg/mL);GFP (~2 mg/mL);\n", "bbcode": "Previously purified and freeze dried GFP (17.8 mg) was dissolved in 1 mL of 20 mM Tris-HCl pH 8.0 (lab stock). The solution was spun at 14 krpm for ten minutes and then transferred to a fresh tube to give [blog]2782[/blog]. Significant ppt is obvious after centrifugation so probably lost several miligrams.\n\nFrom [blog]2786[/blog] 200 uL was diluted with 200 uL of buffer to give [blog]2786[/blog]. \n\nFrom [blog]2782[/blog] 100 uL was diluted with 300 uL of buffer to give [blog]2787[/blog].\n\nFrom [blog]2782[/blog] 50 uL was diluted with 450 uL of buffer to give [blog]2788[/blog]."}, "datestamp": "2009-02-01T16:32:55+00:00", "internal-links": ["2782", "2786", "2786", "2782", "2787", "2782", "2788"], "id": "2783"}, {"author": null, "timestamp": "2009-06-18T15:03:41+01:00", "section": "Materials", "title": "50 mM Hepes pH 7 Buffer in D2O", "content": {"html": "Material: Solution
\n50 mM Hepes-NaOH pH 7, 100 mM NaCl, 10% glycerol, in D2O


MaterialConcnAmount requiredAmount meas
HEPES 50 mM5.9575g5.9589 g
Sodium Chloride100 mM2.922 g2.9243
Glycerol10%5 g5.0 g


The buffer was made up and pH'd to a reading of 6.608 with NaOD in D2O. pH reading was rising but appeared to settle. May have been slow exchange of glycerol protons.
This Post is Linked By: Dialysis of MurM into new buffer;\n", "bbcode": "50 mM Hepes-NaOH pH 7, 100 mM NaCl, 10% glycerol, in D2O\n\n[table]\n[row]Material[col]Concn[col]Amount required[col]Amount meas[/row]\n[row][blog]650[/blog][col]50 mM[col]5.9575g[col]5.9589 g[/row]\n[row][blog]683[/blog][col]100 mM[col]2.922 g[col]2.9243[/row]\n[row][blog]11330[/blog][col]10%[col]5 g[col]5.0 g[/row]\n[/table]\n\nThe buffer was made up and pH'd to a reading of 6.608 with NaOD in D2O. pH reading was rising but appeared to settle. May have been slow exchange of glycerol protons."}, "datestamp": "2009-06-18T14:09:40+01:00", "internal-links": ["650", "683", "11330"], "id": "11331"}, {"author": null, "timestamp": "2009-06-18T15:04:22+01:00", "section": "Materials", "title": "MurM sample", "content": {"html": "Material: Solution
\nApprox 12 mg/mL MurM in buffer with 50% glycerol 0.5 M NaCl made by Jennifer Shepherd
This Post is Linked By: Dialysis of MurM into new buffer;\n", "bbcode": "Approx 12 mg/mL MurM in buffer with 50% glycerol 0.5 M NaCl made by Jennifer Shepherd"}, "datestamp": "2009-06-18T15:04:22+01:00", "internal-links": [], "id": "11335"}, {"author": null, "timestamp": "2009-06-18T15:18:44+01:00", "section": "Materials", "title": "Dialysed MurM sample in D2O buffer", "content": {"html": "Material: Solution
\nProject: MurM
\nThe sample of MurM after dialysis as described in Dialysis of MurM into new buffer
This Post is Linked By: Dialysis of MurM into new buffer;\n", "bbcode": "The sample of MurM after dialysis as described in [blog]11336[/blog]"}, "datestamp": "2009-06-18T15:18:44+01:00", "internal-links": ["11336"], "id": "11337"}, {"author": null, "timestamp": "2009-06-20T21:24:18+01:00", "section": "Procedures", "title": "Dialysis of MurM into new buffer", "content": {"html": "Procedure: Sample_preparation
\nProject: MurM
\nMurM sample (1 mL) was spun at 6 C at the maximum speed in a bench centrifuge three times ten minutes. No visible aggregate was seen. The sample was then dialysed overnight against ~120 mL of 50 mM Hepes pH 7 Buffer in D2O.

Buffer was changed the following morning and afternoon (Friday). Significant precipitate was observed. On Saturday the remaining buffer was filtered and the sample spun and transferred to new dialysis tubing in filtered buffer and dialysed overnight. A sample was taken for a UV-Vis reading (attached).
Spun sample before final dialysis UV



The final dialysed sample is Dialysed MurM sample in D2O buffer. A sample of the dialysate was taken as a blank for SAXS/SANS:Buffer blank dialysate for MurM
This Post is Linked By: Dialysed MurM sample in D2O buffer;Buffer blank dialysate for MurM;\n", "bbcode": "[blog]11335[/blog] (1 mL) was spun at 6 C at the maximum speed in a bench centrifuge three times ten minutes. No visible aggregate was seen. The sample was then dialysed overnight against ~120 mL of [blog]11331[/blog].\n\nBuffer was changed the following morning and afternoon (Friday). Significant precipitate was observed. On Saturday the remaining buffer was filtered and the sample spun and transferred to new dialysis tubing in filtered buffer and dialysed overnight. A sample was taken for a UV-Vis reading (attached).[data]1171[/data]\n\n\nThe final dialysed sample is [blog]11337[/blog]. A sample of the dialysate was taken as a blank for SAXS/SANS:[blog]11338[/blog]"}, "datestamp": "2009-06-18T15:15:51+01:00", "internal-links": ["11335", "11331", "11337", "11338"], "id": "11336"}, {"author": null, "timestamp": "2009-07-29T03:00:47+01:00", "section": "Materials", "title": "Test solution sample", "content": {"html": "Material: Solution
\nProject: test
\nTest




\n", "bbcode": "Test\n\n\n\n"}, "datestamp": "2009-07-29T03:00:47+01:00", "internal-links": [], "id": "11530"}, {"author": null, "timestamp": "2009-07-24T14:05:39+01:00", "section": "Note", "title": "Approaching the design of a dataset consisting of modelled data based on pdb structures", "content": {"html": "Project: Data_analysis
\nAim: For the set of unique sequences of data obtained from crystallography from the PDB, generate predicted data from a set of techniques. Hold that data in a useful and coordinated form to enable the comparison of (ultimately) experimental data from the same techniques to those systems.

Methods:

The techniques (and tools for generating predicted data) are Small Angle X-ray Scattering (Crysol - ATSAS suite), Small Angle Neutron Scattering (Cryson) and AUC (Hydropro). These programs take PDB files and generate a set of flat text files and (at least for Crysol and Cryson) are controlled from the command line. The file sizes aren't huge and could probably be held as text in a straightforward relational database but a document oriented DB might be better. Conversely could just use a single directory for each PDB and just hold reference data in a DB.

There is a list of sets of sequence-unique PDB IDs at http://swift.cmbi.kun.nl/whatif/select/ These can relatively easily be pulled down by name from the PDB (ftp://ftp.wwpdb.org/pub/pdb/README) as either PDB or XML. As the programs take PDB files but the XML might be more useful further down the track it may be worthwhile to get both. This shouldn't require too much hacking to do via Python.

Doing the actual analysis is a question of scripting the command line operations to run the program so not too hard hopefully. The files will be generated so they may as well sit in the same directory as the PDB file as this will be the default anyway. May need to move them later. Step two would be to pull that information into some sort of useful datastructure but maybe that is better left until the actual files have been generated anyway.

The analysis will involve taking a test set of data and finding the closest match in the full dataset. This may involve truncating and scaling the data to fit the modelled data set. The mechanics of how best to do the comparison are part of the point of the exercise as will be adding noise to see where problems arise.

As always the question is also how best to record and track everything that is going on. A massive GitHub repository is tempting but probably overkill and may run into issues of cost not to mention transfer times. Would be great to write out triples directly to e.g. Talis but in first instance at least writing out a logfile of exactly what happened would be a good start. Need to think about how best to mark that up.
\n", "bbcode": "Aim: For the set of unique sequences of data obtained from crystallography from the PDB, generate predicted data from a set of techniques. Hold that data in a useful and coordinated form to enable the comparison of (ultimately) experimental data from the same techniques to those systems.\n\nMethods:\n\nThe techniques (and tools for generating predicted data) are Small Angle X-ray Scattering (Crysol - ATSAS suite), Small Angle Neutron Scattering (Cryson) and AUC (Hydropro). These programs take PDB files and generate a set of flat text files and (at least for Crysol and Cryson) are controlled from the command line. The file sizes aren't huge and could probably be held as text in a straightforward relational database but a document oriented DB might be better. Conversely could just use a single directory for each PDB and just hold reference data in a DB.\n\nThere is a list of sets of sequence-unique PDB IDs at http://swift.cmbi.kun.nl/whatif/select/ These can relatively easily be pulled down by name from the PDB (ftp://ftp.wwpdb.org/pub/pdb/README) as either PDB or XML. As the programs take PDB files but the XML might be more useful further down the track it may be worthwhile to get both. This shouldn't require too much hacking to do via Python.\n\nDoing the actual analysis is a question of scripting the command line operations to run the program so not too hard hopefully. The files will be generated so they may as well sit in the same directory as the PDB file as this will be the default anyway. May need to move them later. Step two would be to pull that information into some sort of useful datastructure but maybe that is better left until the actual files have been generated anyway.\n\nThe analysis will involve taking a test set of data and finding the closest match in the full dataset. This may involve truncating and scaling the data to fit the modelled data set. The mechanics of how best to do the comparison are part of the point of the exercise as will be adding noise to see where problems arise. \n\nAs always the question is also how best to record and track everything that is going on. A massive GitHub repository is tempting but probably overkill and may run into issues of cost not to mention transfer times. Would be great to write out triples directly to e.g. Talis but in first instance at least writing out a logfile of exactly what happened would be a good start. Need to think about how best to mark that up. "}, "datestamp": "2009-07-24T14:05:39+01:00", "internal-links": [], "id": "11510"}, {"author": null, "timestamp": "2009-07-29T03:00:08+01:00", "section": "Materials", "title": "Buffer blank dialysate for MurM", "content": {"html": "Material: Solution
\nA sample of dialysate obtained for use as a buffer blank after Dialysis of MurM into new buffer
This Post is Linked By: Dialysis of MurM into new buffer;\n", "bbcode": "A sample of dialysate obtained for use as a buffer blank after [blog]11336[/blog]"}, "datestamp": "2009-06-18T15:19:26+01:00", "internal-links": ["11336"], "id": "11338"}, {"author": null, "timestamp": "2009-07-29T12:57:02+01:00", "section": "Templates", "title": "SAXS on I22 template", "content": {"html": "following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.


SampleFramesExposure time I22 Raw Run #Data
[[Material:Solution]][[box=3]][[Box=3]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]


[[Section>Procedures]]
[[Procedure>SAXS]]
[[Instrument>I22]]
\n", "bbcode": "following samples were run in 1 mm capillary cells on I22. Detector was at 5m and q range standardised against silver behenate.\n\n[table]\n[row]Sample[col]Frames[col]Exposure time [col]I22 Raw Run #[col]Data[/row]\n[row][[Material:Solution]][col][[box=3]][col][[Box=3]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[/table]\n\n[[Section>Procedures]]\n[[Procedure>SAXS]]\n[[Instrument>I22]]"}, "datestamp": "2009-02-02T14:19:36+00:00", "internal-links": [], "id": "2818"}, {"author": null, "timestamp": "2009-08-26T12:50:00+01:00", "section": "Data", "title": "Reprocessed Glur0 buffer background", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A19000.202Left/A19001.DAT

This Post is Linked By: Reprocessing SAXS data from Feb 09;Initial analysis of reprocessed Glur0 Data;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A19000.202[col]Left/A19001.DAT[/row]\n[/table]"}, "datestamp": "2009-08-26T12:48:52+01:00", "internal-links": [], "id": "11573"}, {"author": null, "timestamp": "2009-08-26T12:51:16+01:00", "section": "Data", "title": "Reprocessed Glur0 buffer background (Right)", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: GluR0
\n
Raw data fileData file
A19000.202Right/A19001.DAT

This Post is Linked By: Reprocessing SAXS data from Feb 09;Initial analysis of reprocessed Glur0 Data;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A19000.202[col]Right/A19001.DAT[/row]\n[/table]"}, "datestamp": "2009-08-26T12:50:44+01:00", "internal-links": [], "id": "11576"}, {"author": null, "timestamp": "2009-08-26T12:51:36+01:00", "section": "Templates", "title": "I22 Data template", "content": {"html": "
Raw data fileData file
[[box]][[box]]


[[Section>Data]]
[[Data Type>SAXS_Diamond]]
[[Instrument>I22]]
[[Project>Glur0]]
\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row][[box]][col][[box]][/row]\n[/table]\n\n[[Section>Data]]\n[[Data Type>SAXS_Diamond]]\n[[Instrument>I22]]\n[[Project>Glur0]]"}, "datestamp": "2009-02-02T14:28:28+00:00", "internal-links": [], "id": "2820"}, {"author": null, "timestamp": "2009-08-26T12:53:07+01:00", "section": "Data", "title": "Reprocessed Glur0 data 1mg/mL (Left)", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Glur0
\n
Raw data fileData file
A20000.202A20001.DAT

This Post is Linked By: Reprocessing SAXS data from Feb 09;Initial analysis of reprocessed Glur0 Data;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A20000.202[col]A20001.DAT[/row]\n[/table]"}, "datestamp": "2009-08-26T12:52:22+01:00", "internal-links": [], "id": "11580"}, {"author": null, "timestamp": "2009-08-26T12:54:19+01:00", "section": "Data", "title": "Reprocessed Glur0 data 1mg/mL (Right)", "content": {"html": "Data Type: SAXS_Diamond
\nInstrument: I22
\nProject: Glur0
\n
Raw data fileData file
A20000.202Right/A20001.DAT

This Post is Linked By: Reprocessing SAXS data from Feb 09;Initial analysis of reprocessed Glur0 Data;\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]A20000.202[col]Right/A20001.DAT[/row]\n[/table]"}, "datestamp": "2009-08-26T12:53:50+01:00", "internal-links": [], "id": "11583"}, {"author": null, "timestamp": "2009-08-26T12:56:23+01:00", "section": "Procedures", "title": "Reprocessing SAXS data from Feb 09", "content": {"html": "Procedure: SAXS
\nThe SAXS data taken in capillaries from the Feb 09 experiment was reprocessed in two halves to reduce the effect of flare from the capillary curvature that was seen in the image. Two 1d reduced datasets were created from each pattern on the left and right of the flare from the image.


SampleRaw dataLeft reduced dataRight reduced data
Glur0 bufferSAXS of GLuR0 bufferReprocessed Glur0 buffer backgroundReprocessed Glur0 buffer background (Right)
Glur0 1mg/mLSAXS of 1 mg/mL GluR0 no glutamateReprocessed Glur0 data 1mg/mL (Left)Reprocessed Glur0 data 1mg/mL (Right)

\n", "bbcode": "The SAXS data taken in capillaries from the Feb 09 experiment was reprocessed in two halves to reduce the effect of flare from the capillary curvature that was seen in the image. Two 1d reduced datasets were created from each pattern on the left and right of the flare from the image.\n\n[Table]\n[row]Sample[col]Raw data[col]Left reduced data[col]Right reduced data[/row]\n[row]Glur0 buffer[col][blog]2909[/blog][col][blog]11573[/blog][col][blog]11576[/blog][/row]\n[row]Glur0 1mg/mL[col][blog]2912[/blog][col][blog]11580[/blog][col][blog]11583[/blog][/row]\n\n[/table]"}, "datestamp": "2009-08-26T12:56:23+01:00", "internal-links": ["2909", "11573", "11576", "2912", "11580", "11583"], "id": "11586"}, {"author": null, "timestamp": "2009-08-26T13:04:50+01:00", "section": "Data", "title": "Glur0 1mg/mL I vs Q (background subtracted and small linear displacement)", "content": {"html": "Data Type: SAXS_Diamond
\nProject: Glur0
\nData generated as described in Initial analysis of reprocessed Glur0 Data

Glur0 1mg/mL I vs Q

This Post is Linked By: Initial analysis of reprocessed Glur0 Data;\n", "bbcode": "Data generated as described in [blog]11589[/blog]\n\n[data]1334[/data]"}, "datestamp": "2009-08-26T13:03:07+01:00", "internal-links": ["11589"], "id": "11587"}, {"author": null, "timestamp": "2009-08-26T13:36:54+01:00", "section": "Procedures", "title": "Initial analysis of reprocessed Glur0 Data", "content": {"html": "Procedure: Data_Analysis
\nProject: Glur0
\nThe data from Reprocessed Glur0 buffer background, Reprocessed Glur0 buffer background (Right), Reprocessed Glur0 data 1mg/mL (Left) andReprocessed Glur0 data 1mg/mL (Right) was loaded into Igor Pro. Only the first six shots (columns) of each dataset were taken based on the apparent degradation of the protein after six shots.

Left and right datasets from the first six shots were added together for both sample and background and the background subtracted from the sample. Because the background was slightly higher in counts at higher Q than the sample 20 counts was added at all Q points to the sample data for visualisation and analysis. The data were plotted and seem to give a good curve for a Q range from 0.005 to around 0.2 inverse angstroms.

Glur0 1mg/mL I vs Q


A quick Guinier analysis gave slopes varying from around 605 to 660 corresponding to an Rg between 43 and 50 angstroms.

Glur0 1mg/mL Guinier


The Igor log file is attached along with images of the graphs. The output data is in Glur0 1mg/mL I vs Q (background subtracted and small linear displacement). This is broadly consistent with the DLS data recorded by Luke in DLS data of GluR0 samples from LoQ Beamtime which gave an Rh of ~72 A which compares well with a spherical R (sqrt(5/3)*Rg) of ~58 from the SAXS data
This Post is Linked By: Glur0 1mg/mL I vs Q (background subtracted and small linear displacement);\n", "bbcode": "The data from [blog]11573[/blog], [blog]11576[/blog], [blog]11580[/blog] and[blog]11583[/blog] was loaded into Igor Pro. Only the first six shots (columns) of each dataset were taken based on the apparent degradation of the protein after six shots.\n\nLeft and right datasets from the first six shots were added together for both sample and background and the background subtracted from the sample. Because the background was slightly higher in counts at higher Q than the sample 20 counts was added at all Q points to the sample data for visualisation and analysis. The data were plotted and seem to give a good curve for a Q range from 0.005 to around 0.2 inverse angstroms.\n\n[data]1336[/data]\n\nA quick Guinier analysis gave slopes varying from around 605 to 660 corresponding to an Rg between 43 and 50 angstroms.\n\n[data]1338[/data]\n\nThe Igor log file is attached along with images of the graphs. The output data is in [blog]11587[/blog]. This is broadly consistent with the DLS data recorded by Luke in [blog]4723[/blog] which gave an Rh of ~72 A which compares well with a spherical R (sqrt(5/3)*Rg) of ~58 from the SAXS data"}, "datestamp": "2009-08-26T13:04:27+01:00", "internal-links": ["11573", "11576", "11580", "11583", "11587", "4723"], "id": "11589"}, {"author": null, "timestamp": "2009-09-10T14:35:18+01:00", "section": "Procedures", "title": "Calculation of Scattering Length Densities for King/Frey Surfactants", "content": {"html": "Project: Frey-King_Surfactants
\nIn RB910360 A sea surface surfactant model was examined at air water interfaces. The model molecule was N-Me-Phenylalanine C18 ester and this was prepared in both fully hydrogenated and tail deuterated forms.

The following predicted properties were obtained from http://molinspiration.com (volume), and from http://www.ncnr.nist.gov/resources/sldcalc.html (SLD)


ComponentVolume (cubic Angstroms)MW(H)MW(D)SLD-HSLD-D
Full molecule4794464824.19E-75.14E-6
C18-O (tail)317267303-1.73E-76.91E-6
N-Phe-OMe173179N/A1.49E-6N/A


In addition to the pure molecules two samples were made in which tail-D and fully-H samples of surfactant were mixed. These were made in a nominal ration of 1:1 and 1:3 by weight. The notional SLDs for each of these samples are.


SampleTail SLDHead SLD
Fully-H-1.7E-71.34E-6
Tail-D6.91E-61.34E-6
1:1 D:H3.23E-61.34E-6
1:3 D:H1.49E-61.34E-6

\n", "bbcode": "In RB910360 A sea surface surfactant model was examined at air water interfaces. The model molecule was N-Me-Phenylalanine C18 ester and this was prepared in both fully hydrogenated and tail deuterated forms.\n\nThe following predicted properties were obtained from http://molinspiration.com (volume), and from http://www.ncnr.nist.gov/resources/sldcalc.html (SLD)\n\n[table]\n[row]Component[col]Volume (cubic Angstroms)[col]MW(H)[col]MW(D)[col]SLD-H[col]SLD-D[/row]\n[row]Full molecule[col]479[col]446[col]482[col]4.19E-7[col]5.14E-6[/row]\n[row]C18-O (tail)[col]317[col]267[col]303[col]-1.73E-7[col]6.91E-6[/row]\n[row]N-Phe-OMe[col]173[col]179[col]N/A[col]1.49E-6[col]N/A[/row]\n[/table]\n\nIn addition to the pure molecules two samples were made in which tail-D and fully-H samples of surfactant were mixed. These were made in a nominal ration of 1:1 and 1:3 by weight. The notional SLDs for each of these samples are.\n\n[table]\n[row]Sample[col]Tail SLD[col]Head SLD[/row]\n[row]Fully-H[col]-1.7E-7[col]1.34E-6[/row]\n[row]Tail-D[col]6.91E-6[col]1.34E-6[/row]\n[row]1:1 D:H[col]3.23E-6[col]1.34E-6[/row]\n[row]1:3 D:H[col]1.49E-6[col]1.34E-6[/row]\n[/table]"}, "datestamp": "2009-09-10T12:17:36+01:00", "internal-links": [], "id": "11621"}, {"author": null, "timestamp": "2009-09-25T09:25:56+01:00", "section": "Materials", "title": "Purified GFP lyophilised", "content": {"html": "Material: Powder
\nPurified GFP (Ni-column and gel filtered) prepared by Luke.
This Post is Linked By: Preparing samples of GFP and Lysozyme for SANS2d experiment;\n", "bbcode": "Purified GFP (Ni-column and gel filtered) prepared by Luke."}, "datestamp": "2009-09-25T09:25:56+01:00", "internal-links": [], "id": "11670"}, {"author": null, "timestamp": "2009-09-25T10:01:21+01:00", "section": "Templates", "title": "SAS sample template", "content": {"html": "[[box]]

[[Section>Materials]]
[[Material>Solution]]
[[Project>SANS2dfirstbio]]
\n", "bbcode": "[[box]]\n\n[[Section>Materials]]\n[[Material>Solution]]\n[[Project>SANS2dfirstbio]]"}, "datestamp": "2008-11-16T11:19:06+00:00", "internal-links": [], "id": "386"}, {"author": null, "timestamp": "2009-09-25T10:01:50+01:00", "section": "Materials", "title": "H2O Phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\n50 mM Phoshate buffer pH 7 in H2O


\n", "bbcode": "50 mM Phoshate buffer pH 7 in H2O\n\n"}, "datestamp": "2009-09-25T10:01:50+01:00", "internal-links": [], "id": "11675"}, {"author": null, "timestamp": "2009-09-25T10:02:19+01:00", "section": "Materials", "title": "D2O Phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\n50 mM Phosphate buffer pD 7 in D2O


\n", "bbcode": "50 mM Phosphate buffer pD 7 in D2O\n\n"}, "datestamp": "2009-09-25T10:02:19+01:00", "internal-links": [], "id": "11676"}, {"author": null, "timestamp": "2009-09-25T11:39:28+01:00", "section": "Procedures", "title": "Preparing samples of GFP and Lysozyme for SANS2d experiment", "content": {"html": "Project: SANS2dfirstbio
\nFirst biology on SANS2d! We will run samples of GFP and lysozyme at ~5mg/mL in D2O, H2O, and 70% D2O (contrast match of DNA). Will take around 10 mg of each and dissolve in 2 mL of H2O and D2O and then spin hard to remove aggregate. Then samples will be made up to order. Using 50 mM Na Phosphate buffer pH 7 previously made up by Luke.

~10 mL of buffer was filtered through 0.45um filters. At least 2 mL was pushed though and discarded before the good stuff was kept. This reduces any risk of glycerol or water contamination.


ProteinSolventWeightBuffer volVisible ppt?
LysozymeH2O12.70.77mLN
LysozymeD2O16.51.00 mLN
Purified GFP lyophilisedH2O11.71.17mLY
Purified GFP lyophilisedD2O10.01.00mLY


The samples were dissolved in the given voume of buffer and then spun for 10 minutes 10 20,000g in the cold room in a bench top centrifuge.

Supernatant of all samples was transferred to fresh eppendorfs and the GFP was re-spun. 250 uL of H and D samples were transferred to clean 1mm Helma cells for SANS as follows:


Lysozyme-H2OLysozyme sample in H2O phosphate buffer
Lysozyme-D2OLysozyme sample in D2O phosphate buffer
GFP-H2OGFP in H2O Phosphate buffer
GFP-D2OGFP in D2O Phosphate buffer


From the H and D stocks 175 uL of D-sample was mixed with 75ul of H-sample to give 250uL of 70% D2O sample in 1 mm helma cuvettes.


Lysozyme-70% D2OLysozyme sample in 70% D2O phosphate buffer
GFP-70% D2OGFP in 70% D2O Phosphate buffer

This Post is Linked By: GFP in D2O Phosphate buffer;Lysozyme sample in H2O phosphate buffer;Lysozyme sample in D2O phosphate buffer;GFP in H2O Phosphate buffer;GFP in 70% D2O Phosphate buffer;Lysozyme sample in 70% D2O phosphate buffer;\n", "bbcode": "First biology on SANS2d! We will run samples of GFP and lysozyme at ~5mg/mL in D2O, H2O, and 70% D2O (contrast match of DNA). Will take around 10 mg of each and dissolve in 2 mL of H2O and D2O and then spin hard to remove aggregate. Then samples will be made up to order. Using 50 mM Na Phosphate buffer pH 7 previously made up by Luke.\n\n~10 mL of buffer was filtered through 0.45um filters. At least 2 mL was pushed though and discarded before the good stuff was kept. This reduces any risk of glycerol or water contamination. \n\n[table]\n[row]Protein[col]Solvent[col]Weight[col]Buffer vol[col]Visible ppt?[/row]\n[row][blog]2777[/blog][col]H2O[col]12.7[col]0.77mL[col]N[/row]\n[row][blog]2777[/blog][col]D2O[col]16.5[col]1.00 mL[col]N[/row]\n[row][blog]11670[/blog][col]H2O[col]11.7[col]1.17mL[col]Y[/row]\n[row][blog]11670[/blog][col]D2O[col]10.0[col]1.00mL[col]Y[/row]\n[/table]\n\nThe samples were dissolved in the given voume of buffer and then spun for 10 minutes 10 20,000g in the cold room in a bench top centrifuge. \n\nSupernatant of all samples was transferred to fresh eppendorfs and the GFP was re-spun. 250 uL of H and D samples were transferred to clean 1mm Helma cells for SANS as follows:\n\n[table]\n[row]Lysozyme-H2O[col][blog]11680[/blog][/row]\n[row]Lysozyme-D2O[col][blog]11681[/blog][/row]\n[row]GFP-H2O[col][blog]11678[/blog][/row]\n[row]GFP-D2O[col][blog]11679[/blog][/row]\n[/table]\n\nFrom the H and D stocks 175 uL of D-sample was mixed with 75ul of H-sample to give 250uL of 70% D2O sample in 1 mm helma cuvettes.\n\n[table]\n[row]Lysozyme-70% D2O[col][blog]11683[/blog][/row]\n[row]GFP-70% D2O[col][blog]11682[/blog][/row]\n[/table]"}, "datestamp": "2009-09-25T10:32:53+01:00", "internal-links": ["2777", "2777", "11670", "11670", "11680", "11681", "11678", "11679", "11683", "11682"], "id": "11677"}, {"author": null, "timestamp": "2009-09-25T11:39:56+01:00", "section": "Materials", "title": "GFP in D2O Phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\nGFP sample from Preparing samples of GFP and Lysozyme for SANS2d experiment
This Post is Linked By: Preparing samples of GFP and Lysozyme for SANS2d experiment;\n", "bbcode": "GFP sample from [blog]11677[/blog]"}, "datestamp": "2009-09-25T11:35:08+01:00", "internal-links": ["11677"], "id": "11679"}, {"author": null, "timestamp": "2009-09-25T11:40:11+01:00", "section": "Materials", "title": "Lysozyme sample in H2O phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\nLysozyme sample from Preparing samples of GFP and Lysozyme for SANS2d experiment
This Post is Linked By: Preparing samples of GFP and Lysozyme for SANS2d experiment;\n", "bbcode": "Lysozyme sample from [blog]11677[/blog]"}, "datestamp": "2009-09-25T11:35:24+01:00", "internal-links": ["11677"], "id": "11680"}, {"author": null, "timestamp": "2009-09-25T11:40:22+01:00", "section": "Materials", "title": "Lysozyme sample in D2O phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\nLysozyme sample from Preparing samples of GFP and Lysozyme for SANS2d experiment
This Post is Linked By: Preparing samples of GFP and Lysozyme for SANS2d experiment;\n", "bbcode": "Lysozyme sample from [blog]11677[/blog]"}, "datestamp": "2009-09-25T11:35:38+01:00", "internal-links": ["11677"], "id": "11681"}, {"author": null, "timestamp": "2009-09-25T11:39:47+01:00", "section": "Materials", "title": "GFP in H2O Phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\nGFP sample from Preparing samples of GFP and Lysozyme for SANS2d experiment
This Post is Linked By: Preparing samples of GFP and Lysozyme for SANS2d experiment;\n", "bbcode": "GFP sample from [blog]11677[/blog]"}, "datestamp": "2009-09-25T11:34:52+01:00", "internal-links": ["11677"], "id": "11678"}, {"author": null, "timestamp": "2009-09-25T11:40:32+01:00", "section": "Materials", "title": "GFP in 70% D2O Phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\nGFP sample from Preparing samples of GFP and Lysozyme for SANS2d experiment
This Post is Linked By: Preparing samples of GFP and Lysozyme for SANS2d experiment;\n", "bbcode": "GFP sample from [blog]11677[/blog]"}, "datestamp": "2009-09-25T11:35:54+01:00", "internal-links": ["11677"], "id": "11682"}, {"author": null, "timestamp": "2009-09-25T11:40:45+01:00", "section": "Materials", "title": "Lysozyme sample in 70% D2O phosphate buffer", "content": {"html": "Material: Solution
\nProject: SANS2dfirstbio
\nLysozyme sample from Preparing samples of GFP and Lysozyme for SANS2d experiment
This Post is Linked By: Preparing samples of GFP and Lysozyme for SANS2d experiment;\n", "bbcode": "Lysozyme sample from [blog]11677[/blog]"}, "datestamp": "2009-09-25T11:36:08+01:00", "internal-links": ["11677"], "id": "11683"}, {"author": null, "timestamp": "2009-11-23T16:02:16+00:00", "section": "Data", "title": "Luke's PinA data", "content": {"html": "Data Type: SANS
\nSANS data collected at the LLB by Luke and others some time ago.

7.1 mg.mL PinA Data

This Post is Linked By: Quick analysis of Lukes PinA data;\n", "bbcode": "SANS data collected at the LLB by Luke and others some time ago.\n\n[data]1529[/data]"}, "datestamp": "2009-11-23T16:01:19+00:00", "internal-links": [], "id": "11854"}, {"author": null, "timestamp": "2009-11-23T16:24:15+00:00", "section": "Procedures", "title": "Quick analysis of Lukes PinA data", "content": {"html": "Procedure: Data_Analysis
\nProject: Pins
\nThe data from Luke's PinA data was loaded into Igor Pro and analysed using the SANS fitting routines from NIST. The data was fit to a cylinder model, a hollow cylinder, and a core-shell cylinder.

The cylinder model gave a radius of 39 A, and a length of 364 A, with scattering length density of the solvent set at 6.3E-6 cm-1 and the protein SLD set at 3.14E-6 cm-1. Allowing the protein SLD to float along with radius in the fit, with fixed solvent and scale parameter gave very consistent results confirming this fit to be physically sensible. Chi squared was around 20.

Cylinder Fit graph


Coefficient values \u00b1 one standard deviation
\tScale fact.\t=3.2652e-08 \u00b1 0
\tRadius\t=39.253 \u00b1 0.768
\tLength\t=364.99 \u00b1 59.1
\tProt SLD\t=3.14e-06 \u00b1 4.52e-08
\tSolv SLD\t=6.3e-06 \u00b1 0
\tBgd \t=2.1875e-06 \u00b1 4.54e-08
V_chisq = 19.9057
coef_cyl[0]= {3.26521e-08,39.253,364.991,3.14003e-06,6.3e-06,2.18753e-06}
W_sigma[0]= {0,0.768138,59.0652,4.52347e-08,0,4.53678e-08}

The hollow cylinder model gave reasonable fits with similar chi squared but with the protein and solvent SLD fixed the fits tended to give an internal cylinder diameter that tried to tend to zero, good fits gave values of less than 0.1 A which doesn't make physical sense. The large error on R1 is also consistent with an internal radius being poorly determined by the data, suggesting in turn of that fact that there isn't one!

Coefficient values \u00b1 one standard deviation
\tScale fact\t=3.1412e-08 \u00b1 4.39e-09
\tRadius 1\t=0.090734 \u00b1 537
\tRadius 2\t=39.858 \u00b1 1.9
\tLength\t=352.84 \u00b1 54.8
\tProt SLD\t=3.14e-06 \u00b1 0
\tSolv SLD\t=6.3e-06 \u00b1 0
\tBgd \t=2.2003e-06 \u00b1 4.43e-08
V_chisq = 22.2954
coef_Hcyl[0]= {3.14117e-08,0.0907338,39.8583,352.842,3.14e-06,6.3e-06,2.20034e-06}
W_sigma[0]= {4.39491e-09,536.55,1.90302,54.7849,0,0,4.42839e-08}


The core-shell model gave marginally better fits but required a SLD for the core of less than -8E-6 which does not make physical sense. A sensible value would be somewhere between the protein and solvent SLD for a highly hydrated protein segment.

Coefficient values \u00b1 one standard deviation
\tScale fact\t=7.3441e-09 \u00b1 8.13e+09
\tRadius 1\t=13.539 \u00b1 7.81
\tRadius 2\t=37.932 \u00b1 2.25
\tLength \t=272.04 \u00b1 0.0495
\tSLD core\t=-3.1389e-05 \u00b1 1.95e+06
\tSLD shell\t=3.14e-06 \u00b1 2.88e+07
\tSLD solv\t=6.3e-06 \u00b1 nan
\tBgd \t=1.8546e-06 \u00b1 nan
V_chisq = 12.2288
coef_cscyl[0]= {7.34406e-09,13.5393,37.9321,272.043,-3.13891e-05,3.14e-06,6.3e-06,1.85461e-06}
W_sigma[0]= {8.12631e+09,7.81095,2.2476,0.0494713,1.94775e+06,2.88406e+07,NaN,NaN}

Overall the data suggests strongly that the PinA complex in solution is a homogenous cylinder with a radius of about 40 A and a length of 350-400 A.
\n", "bbcode": "The data from [blog]11854[/blog] was loaded into Igor Pro and analysed using the SANS fitting routines from NIST. The data was fit to a cylinder model, a hollow cylinder, and a core-shell cylinder.\n\nThe cylinder model gave a radius of 39 A, and a length of 364 A, with scattering length density of the solvent set at 6.3E-6 cm-1 and the protein SLD set at 3.14E-6 cm-1. Allowing the protein SLD to float along with radius in the fit, with fixed solvent and scale parameter gave very consistent results confirming this fit to be physically sensible. Chi squared was around 20.\n\n[data]1537[/data]\n\n Coefficient values \u00b1 one standard deviation\n \tScale fact.\t=3.2652e-08 \u00b1 0\n \tRadius\t=39.253 \u00b1 0.768\n \tLength\t=364.99 \u00b1 59.1\n \tProt SLD\t=3.14e-06 \u00b1 4.52e-08\n \tSolv SLD\t=6.3e-06 \u00b1 0\n \tBgd \t=2.1875e-06 \u00b1 4.54e-08\n V_chisq = 19.9057\n coef_cyl[0]= {3.26521e-08,39.253,364.991,3.14003e-06,6.3e-06,2.18753e-06}\n W_sigma[0]= {0,0.768138,59.0652,4.52347e-08,0,4.53678e-08}\n\nThe hollow cylinder model gave reasonable fits with similar chi squared but with the protein and solvent SLD fixed the fits tended to give an internal cylinder diameter that tried to tend to zero, good fits gave values of less than 0.1 A which doesn't make physical sense. The large error on R1 is also consistent with an internal radius being poorly determined by the data, suggesting in turn of that fact that there isn't one!\n\n Coefficient values \u00b1 one standard deviation\n \tScale fact\t=3.1412e-08 \u00b1 4.39e-09\n \tRadius 1\t=0.090734 \u00b1 537\n \tRadius 2\t=39.858 \u00b1 1.9\n \tLength\t=352.84 \u00b1 54.8\n \tProt SLD\t=3.14e-06 \u00b1 0\n \tSolv SLD\t=6.3e-06 \u00b1 0\n \tBgd \t=2.2003e-06 \u00b1 4.43e-08\n V_chisq = 22.2954\n coef_Hcyl[0]= {3.14117e-08,0.0907338,39.8583,352.842,3.14e-06,6.3e-06,2.20034e-06}\n W_sigma[0]= {4.39491e-09,536.55,1.90302,54.7849,0,0,4.42839e-08}\n\n\nThe core-shell model gave marginally better fits but required a SLD for the core of less than -8E-6 which does not make physical sense. A sensible value would be somewhere between the protein and solvent SLD for a highly hydrated protein segment.\n\n Coefficient values \u00b1 one standard deviation\n \tScale fact\t=7.3441e-09 \u00b1 8.13e+09\n \tRadius 1\t=13.539 \u00b1 7.81\n \tRadius 2\t=37.932 \u00b1 2.25\n \tLength \t=272.04 \u00b1 0.0495\n \tSLD core\t=-3.1389e-05 \u00b1 1.95e+06\n \tSLD shell\t=3.14e-06 \u00b1 2.88e+07\n \tSLD solv\t=6.3e-06 \u00b1 nan\n \tBgd \t=1.8546e-06 \u00b1 nan\n V_chisq = 12.2288\n coef_cscyl[0]= {7.34406e-09,13.5393,37.9321,272.043,-3.13891e-05,3.14e-06,6.3e-06,1.85461e-06}\n W_sigma[0]= {8.12631e+09,7.81095,2.2476,0.0494713,1.94775e+06,2.88406e+07,NaN,NaN}\n\nOverall the data suggests strongly that the PinA complex in solution is a homogenous cylinder with a radius of about 40 A and a length of 350-400 A."}, "datestamp": "2009-11-23T16:10:02+00:00", "internal-links": ["11854"], "id": "11857"}, {"author": null, "timestamp": "2009-12-09T11:22:16+00:00", "section": "Data", "title": "GFP SANS Data from SANS2d - 6m D2O", "content": {"html": "Data Type: SANS_SANS2d
\nThe SANS data determined in #####
This Post is Linked By: Comparison of SANS2d and LOQ GFP data;\n", "bbcode": "The SANS data determined in #####"}, "datestamp": "2009-12-09T11:16:46+00:00", "internal-links": [], "id": "11910"}, {"author": null, "timestamp": "2009-12-09T11:36:23+00:00", "section": "Data", "title": "Lysozyme in D2O data from SANS2D", "content": {"html": "Data Type: SANS_SANS2d
\nData recorded on SANS2d in ******
This Post is Linked By: Comparison of SANS2d and LOQ Lysozyme data;\n", "bbcode": "Data recorded on SANS2d in ******"}, "datestamp": "2009-12-09T11:35:34+00:00", "internal-links": [], "id": "11918"}, {"author": null, "timestamp": "2009-12-09T16:52:43+00:00", "section": "Procedures", "title": "Comparison of SANS2d and LOQ Lysozyme data", "content": {"html": "Procedure: Data_Analysis
\nThe data from Lysozyme in D2O data from SANS2D was compared to data obtained on LOQ 44703 - 10mg/mL Lysozyme on LOQ.

LOQ data was scaled by 1.2 and compared to the SANS2D data. This was compared to a predicted pattern but as I have failed to note the precise crystal structure I used to predict this it isn't much use. The comparison of the two datasets looks pretty good. It should be noted that this is data from two different samples and that the SANS2d scaling is still being worked out in detail.


Lysozyme comparison

\n", "bbcode": "The data from [blog]11918[/blog] was compared to data obtained on LOQ [blog]186[/blog]. \n\nLOQ data was scaled by 1.2 and compared to the SANS2D data. This was compared to a predicted pattern but as I have failed to note the precise crystal structure I used to predict this it isn't much use. The comparison of the two datasets looks pretty good. It should be noted that this is data from two different samples and that the SANS2d scaling is still being worked out in detail.\n\n\n[data]1577[/data]"}, "datestamp": "2009-12-09T11:38:28+00:00", "internal-links": ["11918", "186"], "id": "11921"}, {"author": null, "timestamp": "2009-12-09T16:53:03+00:00", "section": "Procedures", "title": "Comparison of SANS2d and LOQ GFP data", "content": {"html": "Procedure: Data_Analysis
\nTwo datasets were compared and graphed. The SANS2d dataset GFP SANS Data from SANS2d - 6m D2O was compared to the old LOQ dataset GFP (10 mg/mL) in D2O buffer and graphed to give the following.

LOQ and SANS2d GFP comparison


The LOQ data was scaled by a factor of 0.72 (see log file for details) to fit onto the SANS2d data. The fit looks pretty good and will need to be compared to that predicted from the correct crystal structure. The low Q rise in the SANS2d data is almost certainly due to aggregation. It should be noted that this is data from two different samples and that the SANS2d scaling is still being worked out in detail.
\n", "bbcode": "Two datasets were compared and graphed. The SANS2d dataset [blog]11910[/blog] was compared to the old LOQ dataset [blog]131[/blog] and graphed to give the following.\n\n[data]1569[/data]\n\nThe LOQ data was scaled by a factor of 0.72 (see log file for details) to fit onto the SANS2d data. The fit looks pretty good and will need to be compared to that predicted from the correct crystal structure. The low Q rise in the SANS2d data is almost certainly due to aggregation. It should be noted that this is data from two different samples and that the SANS2d scaling is still being worked out in detail."}, "datestamp": "2009-12-09T11:23:14+00:00", "internal-links": ["11910", "131"], "id": "11913"}, {"author": null, "timestamp": "2009-12-10T14:50:32+00:00", "section": "Procedures", "title": "Some analysis of reflection data from Crisp Experiment", "content": {"html": "Procedure: Data_Analysis
\nI have previously done single layer fits of data from these experiments for the following contrasts:

H-tails D2O
D-tails NRW
D-tails 30% D2O
1:3 tails NRW
1:1 tails NRW

These show a reasonably reproducible thickening of the layer for the three surface pressure regimes.

On moving to a two layer model with the 7 mN data the fits really want to minimize the headgroup thickness. Hydration of the headgroup doesn't seem to effect the fit much. Some issues with SLD for the mixed tails, similar to what was seen previously with the single layer fits.

With the parameters taken from a two layer fit of the 7 mN data, the predicted NR fits kind of ok by eye to data from the D-Tail-D2O contrast with no further fitting (chi^2 around 70 for six data sets). Further fitting leads to a very thin (~1.5A) layer with high hydration suggesting a very minimal headgroup layer at this surface pressure.

screenshot from Rascal


Moved on the ~14 nm data and was getting very similar results until I realized I had the SLD for the heads fixed at the wrong value?!? On fixing this I can get reasonable fits with the correct SLD and a layer thickness of 2 A

14 mN two layer fit


After playing around with some roughness it doesn't really help. Hydration tends to go to 100% with a thinner layer. Still not well determined by the data though.

14mN Two layer after roughnesses


Looking at the 7 mN data with the correct SLD for the headgroups it is still difficult to see any evidence of the headgroups in the data. These fits are actually a lot worse than the single layer fits.

7mN-correct-SLD-roughness

\n", "bbcode": "I have previously done single layer fits of data from these experiments for the following contrasts:\n\nH-tails D2O\nD-tails NRW\nD-tails 30% D2O\n1:3 tails NRW\n1:1 tails NRW\n\nThese show a reasonably reproducible thickening of the layer for the three surface pressure regimes.\n\nOn moving to a two layer model with the 7 mN data the fits really want to minimize the headgroup thickness. Hydration of the headgroup doesn't seem to effect the fit much. Some issues with SLD for the mixed tails, similar to what was seen previously with the single layer fits. \n\nWith the parameters taken from a two layer fit of the 7 mN data, the predicted NR fits kind of ok by eye to data from the D-Tail-D2O contrast with no further fitting (chi^2 around 70 for six data sets). Further fitting leads to a very thin (~1.5A) layer with high hydration suggesting a very minimal headgroup layer at this surface pressure.\n\n[data]1584[/data]\n\nMoved on the ~14 nm data and was getting very similar results until I realized I had the SLD for the heads fixed at the wrong value?!? On fixing this I can get reasonable fits with the correct SLD and a layer thickness of 2 A\n\n[data]1586[/data]\n\nAfter playing around with some roughness it doesn't really help. Hydration tends to go to 100% with a thinner layer. Still not well determined by the data though.\n\n[data]1588[/data]\n\nLooking at the 7 mN data with the correct SLD for the headgroups it is still difficult to see any evidence of the headgroups in the data. These fits are actually a lot worse than the single layer fits.\n\n[data]1590[/data]"}, "datestamp": "2009-12-10T11:36:14+00:00", "internal-links": [], "id": "11928"}, {"author": null, "timestamp": "2010-03-09T19:31:48+00:00", "section": "Materials", "title": "Glur0 D2O Sample", "content": {"html": "Project: GluR0
\nGluR0 sample in D20

created from Bulk Purification of GluR0 for SANS Beamtime
\n", "bbcode": "GluR0 sample in D20\n\ncreated from [blog]12088[/blog]"}, "datestamp": "2010-03-09T19:31:48+00:00", "internal-links": ["12088"], "id": "12130"}, {"author": null, "timestamp": "2010-03-09T19:51:06+00:00", "section": "Materials", "title": "10mM DM H2O Buffer", "content": {"html": "Project: GluR0
\n20mM Tris 100mM KCl 10mM Decyl maltoside pH 7.6

Used as buffer for Dialysis
This Post is Linked By: Adding runs from March GLur0 SANS Expt;\n", "bbcode": "20mM Tris 100mM KCl 10mM Decyl maltoside pH 7.6\n\nUsed as buffer for Dialysis"}, "datestamp": "2010-03-09T19:51:06+00:00", "internal-links": [], "id": "12132"}, {"author": null, "timestamp": "2010-03-09T19:51:07+00:00", "section": "Materials", "title": "D2O Buffer for Glur0", "content": {"html": "Material: Solution
\nProject: Glur0
\n10 mM DM buffer in D2O


This Post is Linked By: Second set of GLur0 samples;First Glur0 runs - SANS2d;\n", "bbcode": "10 mM DM buffer in D2O\n\n"}, "datestamp": "2010-03-09T19:51:07+00:00", "internal-links": [], "id": "12133"}, {"author": null, "timestamp": "2010-03-09T19:51:30+00:00", "section": "Materials", "title": "H2O Buffer for Glur0", "content": {"html": "Material: Solution
\nProject: Glur0
\n10 mM DM buffer in H2O


This Post is Linked By: Second set of GLur0 samples;First Glur0 runs - SANS2d;\n", "bbcode": "10 mM DM buffer in H2O\n\n"}, "datestamp": "2010-03-09T19:51:30+00:00", "internal-links": [], "id": "12134"}, {"author": null, "timestamp": "2010-03-09T19:52:14+00:00", "section": "Materials", "title": "10mM DM D2O Buffer", "content": {"html": "Project: GluR0
\n20mM Tris 100mM KCl 10mM DM pD 7.6

Buffer used for final dialysis of the 100% D2O sample
This Post is Linked By: Adding runs from March GLur0 SANS Expt;\n", "bbcode": "20mM Tris 100mM KCl 10mM DM pD 7.6 \n\nBuffer used for final dialysis of the 100% D2O sample"}, "datestamp": "2010-03-09T19:52:14+00:00", "internal-links": [], "id": "12135"}, {"author": null, "timestamp": "2010-03-09T22:51:56+00:00", "section": "Data", "title": "3333-First Glur0 D2O reduced data", "content": {"html": "Data Type: SANS_SANS2d
\nFirst shot reduced data for one hour of collection for sample and buffer.
\n", "bbcode": "First shot reduced data for one hour of collection for sample and buffer."}, "datestamp": "2010-03-09T22:50:38+00:00", "internal-links": [], "id": "12139"}, {"author": null, "timestamp": "2010-03-09T23:15:38+00:00", "section": "Materials", "title": "Glur0 D2O Sample", "content": {"html": "Material: Solution
\nProject: Glur0
\nA glur0 sample in D2O. Concentration calculated by UV-Vis of 1.92 mg/ml.
This Post is Linked By: Second set of GLur0 samples;First Glur0 runs - SANS2d;Sortase A Assay with GluRO sample at 6C[Samples are belong to Cameron];Adding runs from March GLur0 SANS Expt;\n", "bbcode": "A glur0 sample in D2O. Concentration calculated by UV-Vis of 1.92 mg/ml."}, "datestamp": "2010-03-09T19:13:11+00:00", "internal-links": [], "id": "12125"}, {"author": null, "timestamp": "2010-03-09T23:17:34+00:00", "section": "Materials", "title": "Glur0 H2O Sample", "content": {"html": "Material: Solution
\nProject: Glur0
\nA sample of Glur0 in H2O. Concentration of 2.77 mg/ml

Sample created from Bulk Purification of GluR0 for SANS Beamtime
This Post is Linked By: Second set of GLur0 samples;Single run of Glur0 H2O;First Glur0 runs - SANS2d;Adding runs from March GLur0 SANS Expt;\n", "bbcode": "A sample of Glur0 in H2O. Concentration of 2.77 mg/ml\n\nSample created from [blog]12088[/blog]"}, "datestamp": "2010-03-09T19:13:35+00:00", "internal-links": ["12088"], "id": "12126"}, {"author": null, "timestamp": "2010-03-10T10:10:15+00:00", "section": "Procedures", "title": "Second set of GLur0 samples", "content": {"html": "Procedure: SANS
\nInstrument: SANS2d
\nProject: Glur0
\nThe following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
GlurO + glutamate D2OT63335
H2O Buffer for Glur0S403336
D2O Buffer for Glur0S403337
GlurO + glutamate D2OS403338
Glur0 D2O SampleS403339
Glur0 H2O SampleS403340
H2O Buffer for Glur0S403341
D2O Buffer for Glur0S403342
GlurO + glutamate D2OS403343


GCL script

\n", "bbcode": "The following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]12145[/blog][col]T[col]6[col]3335[col][blog][/blog][/row]\n[row][blog]12134[/blog][col]S[col]40[col]3336[col][blog][/blog][/row]\n[row][blog]12133[/blog][col]S[col]40[col]3337[col][blog][/blog][/row]\n[row][blog]12145[/blog][col]S[col]40[col]3338[col][blog][/blog][/row]\n[row][blog]12125[/blog][col]S[col]40[col]3339[col][blog][/blog][/row]\n[row][blog]12126[/blog][col]S[col]40[col]3340[col][blog][/blog][/row]\n[row][blog]12134[/blog][col]S[col]40[col]3341[col][blog][/blog][/row]\n[row][blog]12133[/blog][col]S[col]40[col]3342[col][blog][/blog][/row]\n[row][blog]12145[/blog][col]S[col]40[col]3343[col][blog][/blog][/row]\n[/table]\n\n[data]1710[/data]"}, "datestamp": "2010-03-10T10:09:23+00:00", "internal-links": ["12145", "12134", "12133", "12145", "12125", "12126", "12134", "12133", "12145"], "id": "12150"}, {"author": null, "timestamp": "2010-03-10T10:15:08+00:00", "section": "Note", "title": "Comments on Glur0 experiment in progress", "content": {"html": "Project: Glur0
\nData so far looks reasonably good for one hour runs in D2O and pretty ropey for one hour runs in H2O. This is not surprising. More worrying is that the scattering from the sample with glutamate looks remarkably similar to that for detergent on its own. Mike is going to do FTIR on the samples to quantify DM in each sample which should allow us to substract/correct properly.

Plan is to proceed with the contrast variation series for the unbound (no glutamate) samples. Data still needs to be properly reduced (added up etc.) as of 10am Wed 10th
\n", "bbcode": "Data so far looks reasonably good for one hour runs in D2O and pretty ropey for one hour runs in H2O. This is not surprising. More worrying is that the scattering from the sample with glutamate looks remarkably similar to that for detergent on its own. Mike is going to do FTIR on the samples to quantify DM in each sample which should allow us to substract/correct properly.\n\nPlan is to proceed with the contrast variation series for the unbound (no glutamate) samples. Data still needs to be properly reduced (added up etc.) as of 10am Wed 10th"}, "datestamp": "2010-03-10T10:15:08+00:00", "internal-links": [], "id": "12155"}, {"author": null, "timestamp": "2010-03-10T11:18:04+00:00", "section": "Materials", "title": "Glur0 in 22% D2O buffer", "content": {"html": "Material: Solution
\nProject: Glur0
\nUnliganded Glur0 in 22% D2O buffer


This Post is Linked By: Adding runs from March GLur0 SANS Expt;\n", "bbcode": "Unliganded Glur0 in 22% D2O buffer\n\n"}, "datestamp": "2010-03-10T11:18:04+00:00", "internal-links": [], "id": "12156"}, {"author": null, "timestamp": "2010-03-10T11:18:31+00:00", "section": "Materials", "title": "22% D2O Buffer", "content": {"html": "Material: Solution
\nProject: Glur0
\n10 mM DM buffer in 22% D2O


This Post is Linked By: Trans and SANS runs, 22% D2O unliganded Glur0 samples and D2O;\n", "bbcode": "10 mM DM buffer in 22% D2O\n\n"}, "datestamp": "2010-03-10T11:18:31+00:00", "internal-links": [], "id": "12157"}, {"author": null, "timestamp": "2010-03-10T11:20:51+00:00", "section": "Procedures", "title": "Single run of Glur0 H2O", "content": {"html": "Procedure: SANS
\nInstrument: SANS2d
\nProject: Glur0
\nThe following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C. Script is Cameron_6m_6.gcl (to be attached)


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
Glur0 H2O SampleS403345


GCL script

\n", "bbcode": "The following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C. Script is Cameron_6m_6.gcl (to be attached)\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]12126[/blog][col]S[col]40[col]3345[col][blog][/blog][/row]\n[/table]\n\n[data]1712[/data]"}, "datestamp": "2010-03-10T10:12:02+00:00", "internal-links": ["12126"], "id": "12153"}, {"author": null, "timestamp": "2010-03-10T18:33:35+00:00", "section": "Data", "title": "Glur0 H2O summed data", "content": {"html": "Data Type: SANS_SANS2d
\nInstrument: SANS2d
\nProject: Glur0
\n
Raw data fileData file
3334, 3340, 3345 - 3336, 3341


loq format
cansas xml format

\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]3334, 3340, 3345 - 3336, 3341[col][/row]\n[/table]\n\n[data]1720[/data][data]1722[/data]"}, "datestamp": "2010-03-10T18:32:58+00:00", "internal-links": [], "id": "12169"}, {"author": null, "timestamp": "2010-03-10T18:33:58+00:00", "section": "Data", "title": "Glur0 D2O summed data", "content": {"html": "Data Type: SANS_SANS2d
\nInstrument: SANS2d
\nProject: Glur0
\n
Raw data fileData file
3333, 3339 - 3325, 3337, 3342


q data
cansas xml

\n", "bbcode": "[table]\n[row]Raw data file[col]Data file[/row]\n[row]3333, 3339 - 3325, 3337, 3342[col][/row]\n[/table]\n\n[data]1716[/data][data]1718[/data]"}, "datestamp": "2010-03-10T18:30:21+00:00", "internal-links": [], "id": "12165"}, {"author": null, "timestamp": "2010-03-10T18:36:44+00:00", "section": "Materials", "title": "GlurO + glutamate D2O", "content": {"html": "Material: Solution
\nProject: GlurO
\nA sample of GlurO in 200 uM glutamate, 10 mM DM. With a concentration of 1.8 mg / ml. SANS data indicated the decyl maltoside concentration was high so FTIR was used the compare the CH2 assymetrical regions between the buffer at 10 mM DM and the sample with an unknown DM concentration. Relative peak areas indicated that the DM concentration in the sample was 116 mM DM (see attached data image)
This Post is Linked By: Second set of GLur0 samples;Sortase A Assay with GluRO sample at 6C[Samples are belong to Cameron];\n", "bbcode": "A sample of GlurO in 200 uM glutamate, 10 mM DM. With a concentration of 1.8 mg / ml. SANS data indicated the decyl maltoside concentration was high so FTIR was used the compare the CH2 assymetrical regions between the buffer at 10 mM DM and the sample with an unknown DM concentration. Relative peak areas indicated that the DM concentration in the sample was 116 mM DM (see attached data image)"}, "datestamp": "2010-03-09T23:21:43+00:00", "internal-links": [], "id": "12145"}, {"author": null, "timestamp": "2010-04-09T12:22:22+01:00", "section": "Procedures", "title": "Transformation of pSOT092 and pLLC146 into BL21(DE3)", "content": {"html": "Procedure: Transformation
\nPlasmid samples of pLLC146 (EGFP-LPETGG-His6) and pSOT092 (His6-sortase) were transformed into BL21(DE3) competent cells (Novagen).

1 uL of plasmid was added to the competent cells and incubated for 30 minutes on ice. The cells were then heatshocked at 42 deg for 30 seconds and placed back on ice before adding warm SOC medium and incubating at 37 C for one hour. The culture (50 uL) was then plated onto LB plates with 100 ug/mL ampicillin.
\n", "bbcode": "Plasmid samples of pLLC146 (EGFP-LPETGG-His6) and pSOT092 (His6-sortase) were transformed into BL21(DE3) competent cells (Novagen).\n\n1 uL of plasmid was added to the competent cells and incubated for 30 minutes on ice. The cells were then heatshocked at 42 deg for 30 seconds and placed back on ice before adding warm SOC medium and incubating at 37 C for one hour. The culture (50 uL) was then plated onto LB plates with 100 ug/mL ampicillin."}, "datestamp": "2010-04-09T12:22:22+01:00", "internal-links": [], "id": "12266"}, {"author": null, "timestamp": "2010-04-14T09:51:35+01:00", "section": "Materials", "title": "GFP Lysis Buffer", "content": {"html": "Material: Solution
\n20 mM Tris-HCl pH 7.7, 100 mM KCl, 8 mM imidazole
This Post is Linked By: GFP-First resin wash;Test purification of GFP;Purification of Sortase;\n", "bbcode": "20 mM Tris-HCl pH 7.7, 100 mM KCl, 8 mM imidazole"}, "datestamp": "2010-04-14T09:51:35+01:00", "internal-links": [], "id": "12272"}, {"author": null, "timestamp": "2010-04-14T11:56:22+01:00", "section": "Materials", "title": "GFP Cleared lysate", "content": {"html": "Material: Solution
\nCleared lysate from Test purification of GFP
This Post is Linked By: Test purification of GFP;GFP purification Gel;\n", "bbcode": "Cleared lysate from [blog]12273[/blog]"}, "datestamp": "2010-04-14T11:56:22+01:00", "internal-links": ["12273"], "id": "12275"}, {"author": null, "timestamp": "2010-04-14T12:12:13+01:00", "section": "Materials", "title": "GFP purification first filtrate", "content": {"html": "Material: Solution
\n50 mL of filtrate from Test purification of GFP
This Post is Linked By: Test purification of GFP;GFP purification Gel;\n", "bbcode": "50 mL of filtrate from [blog]12273[/blog]"}, "datestamp": "2010-04-14T12:12:13+01:00", "internal-links": ["12273"], "id": "12277"}, {"author": null, "timestamp": "2010-04-14T12:13:17+01:00", "section": "Materials", "title": "GFP purification second filtrate", "content": {"html": "Material: Solution
\nGreenish murky filtrate solution from Test purification of GFP
This Post is Linked By: Test purification of GFP;GFP purification Gel;\n", "bbcode": "Greenish murky filtrate solution from [blog]12273[/blog]"}, "datestamp": "2010-04-14T12:13:17+01:00", "internal-links": ["12273"], "id": "12278"}, {"author": null, "timestamp": "2010-04-14T12:32:38+01:00", "section": "Materials", "title": "GFP-Second resin wash", "content": {"html": "Material: Solution
\n100 mL flow though from second resin wash with Ammon-Acetate 20 mM imidazole wash buffer. Bright green!
This Post is Linked By: Test purification of GFP;Further purification of GFP fractions;GFP purifcation gel2;\n", "bbcode": "100 mL flow though from second resin wash with [blog]12281[/blog]. Bright green!"}, "datestamp": "2010-04-14T12:32:38+01:00", "internal-links": ["12281"], "id": "12283"}, {"author": null, "timestamp": "2010-04-14T12:29:41+01:00", "section": "Materials", "title": "Ammon-Acetate 20 mM imidazole wash buffer", "content": {"html": "Material: Solution
\n20 mM ammonium acetate (pH 7)
20 mM imidazole
This Post is Linked By: GFP-Second resin wash;Test purification of GFP;\n", "bbcode": "20 mM ammonium acetate (pH 7)\n20 mM imidazole"}, "datestamp": "2010-04-14T12:29:41+01:00", "internal-links": [], "id": "12281"}, {"author": null, "timestamp": "2010-04-14T12:20:06+01:00", "section": "Materials", "title": "GFP-First resin wash", "content": {"html": "Material: Solution
\nAbout 100 mL of flow through from the washed resin from Test purification of GFP in GFP Lysis Buffer
This Post is Linked By: Test purification of GFP;GFP purification Gel;SDS-Page Gel;\n", "bbcode": "About 100 mL of flow through from the washed resin from [blog]12273[/blog] in [blog]12272[/blog]"}, "datestamp": "2010-04-14T12:20:06+01:00", "internal-links": ["12273", "12272"], "id": "12280"}, {"author": null, "timestamp": "2010-04-14T12:45:15+01:00", "section": "Materials", "title": "Ammonium-acetate 400 mM elution buffer", "content": {"html": "Material: Solution
\n20 mM ammonium acetate pH 7
400 mM imidazole
This Post is Linked By: GFP-Third resin wash;Test purification of GFP;\n", "bbcode": "20 mM ammonium acetate pH 7\n400 mM imidazole"}, "datestamp": "2010-04-14T12:30:56+01:00", "internal-links": [], "id": "12282"}, {"author": null, "timestamp": "2010-04-14T12:46:16+01:00", "section": "Materials", "title": "GFP-Third resin wash", "content": {"html": "Material: Solution
\nElution of remaining GFP from Test purification of GFP with Ammonium-acetate 20 mM elution buffer
This Post is Linked By: Test purification of GFP;Concentration and exchange of GFP;\n", "bbcode": "Elution of remaining GFP from [blog]12273[/blog] with [blog]12282[/blog]"}, "datestamp": "2010-04-14T12:46:16+01:00", "internal-links": ["12273", "12282"], "id": "12286"}, {"author": null, "timestamp": "2010-04-15T12:04:49+01:00", "section": "Procedures", "title": "Test purification of GFP", "content": {"html": "Procedure: Protein_purification
\nProject: Protein-ligation
\nPellet of GFP expressing cells (bright green, |10.5 g) was resuspended in GFP Lysis Buffer (50 mL) to give an even suspension. The suspended cells were then lysed by sonication (3 x 10 minutes, 30sec on, 30 sec off, on ice) and the lysate cleared by centrifugation (SS-34, 18krpm, 20 minutes, 4 C) to generate GFP Cleared lysate (50 mL).

Half the cleared lysate was resuspended with 5 mL of Ni-NTA resin which was bright green on settling but the solution remained quite green. Another 5 mL of resin was added and both combined and filtered, to yield a GFP purification first filtrate which was a dirty green/yellow. The remainder of the lysate was then added and filtered to generate a GFP purification second filtrate which was slightly brighter green than first but really a murky yellow.

The resin was then washed with 90 mL of GFP Lysis Buffer to giving GFP-First resin wash. The resin was then washed with about 100 mL of Ammon-Acetate 20 mM imidazole wash buffer to give GFP-Second resin washbut this was very green! Possibly a result of pH dropping low enough to protonate the histidines?

This solution was collected, buffer pH was about 6.6 so could well be protonating. The resin was then washed with about 20 mL of Ammonium-acetate 400 mM elution buffer and the eluant collected as GFP-Third resin wash.

The samples were run on an SDS-PAGE gel.
This Post is Linked By: GFP Cleared lysate;GFP purification first filtrate;GFP purification second filtrate;GFP-First resin wash;GFP-Third resin wash;Extraction;\n", "bbcode": "Pellet of GFP expressing cells (bright green, |10.5 g) was resuspended in [blog]12272[/blog] (50 mL) to give an even suspension. The suspended cells were then lysed by sonication (3 x 10 minutes, 30sec on, 30 sec off, on ice) and the lysate cleared by centrifugation (SS-34, 18krpm, 20 minutes, 4 C) to generate [blog]12275[/blog] (50 mL).\n\nHalf the cleared lysate was resuspended with 5 mL of Ni-NTA resin which was bright green on settling but the solution remained quite green. Another 5 mL of resin was added and both combined and filtered, to yield a [blog]12277[/blog] which was a dirty green/yellow. The remainder of the lysate was then added and filtered to generate a [blog]12278[/blog] which was slightly brighter green than first but really a murky yellow.\n\nThe resin was then washed with 90 mL of [blog]12272[/blog] to giving [blog]12280[/blog]. The resin was then washed with about 100 mL of [blog]12281[/blog] to give [blog]12283[/blog]but this was very green! Possibly a result of pH dropping low enough to protonate the histidines?\n\nThis solution was collected, buffer pH was about 6.6 so could well be protonating. The resin was then washed with about 20 mL of [blog]12282[/blog] and the eluant collected as [blog]12286[/blog].\n\nThe samples were run on an SDS-PAGE gel."}, "datestamp": "2010-04-14T10:15:06+01:00", "internal-links": ["12272", "12275", "12277", "12278", "12272", "12280", "12281", "12283", "12282", "12286"], "id": "12273"}, {"author": null, "timestamp": "2010-04-15T12:14:27+01:00", "section": "Materials", "title": "GFP elution fraction 2", "content": {"html": "Material: Solution
\nA 400 mM imidazole elution fraction from Further purification of GFP fractions


This Post is Linked By: Further purification of GFP fractions;GFP purifcation gel2;Concentration and exchange of GFP;\n", "bbcode": "A 400 mM imidazole elution fraction from [blog]12293[/blog]\n\n"}, "datestamp": "2010-04-15T12:14:27+01:00", "internal-links": ["12293"], "id": "12298"}, {"author": null, "timestamp": "2010-04-15T12:10:25+01:00", "section": "Materials", "title": "GFP-repurification flow through", "content": {"html": "Material: Solution
\nFirst flow through from Further purification of GFP fractions
This Post is Linked By: Further purification of GFP fractions;\n", "bbcode": "First flow through from [blog]12293[/blog]"}, "datestamp": "2010-04-15T12:10:25+01:00", "internal-links": ["12293"], "id": "12294"}, {"author": null, "timestamp": "2010-04-15T12:11:32+01:00", "section": "Materials", "title": "GFP-repurification first wash", "content": {"html": "Material: Solution
\n20 mM imidazole wash from Further purification of GFP fractions
This Post is Linked By: Further purification of GFP fractions;\n", "bbcode": "20 mM imidazole wash from [blog]12293[/blog]"}, "datestamp": "2010-04-15T12:11:32+01:00", "internal-links": ["12293"], "id": "12295"}, {"author": null, "timestamp": "2010-04-15T12:13:52+01:00", "section": "Materials", "title": "GFP elution fraction 1", "content": {"html": "Material: Solution
\nA 400 mM imidazole elution fraction from Further purification of GFP fractions


This Post is Linked By: Further purification of GFP fractions;GFP purifcation gel2;Concentration and exchange of GFP;\n", "bbcode": "A 400 mM imidazole elution fraction from [blog]12293[/blog]\n\n"}, "datestamp": "2010-04-15T12:13:52+01:00", "internal-links": ["12293"], "id": "12297"}, {"author": null, "timestamp": "2010-04-15T12:14:31+01:00", "section": "Materials", "title": "GFP elution fraction 3", "content": {"html": "Material: Solution
\nA 400 mM imidazole elution fraction from Further purification of GFP fractions


This Post is Linked By: Further purification of GFP fractions;GFP purifcation gel2;Concentration and exchange of GFP;\n", "bbcode": "A 400 mM imidazole elution fraction from [blog]12293[/blog]\n\n"}, "datestamp": "2010-04-15T12:14:31+01:00", "internal-links": ["12293"], "id": "12299"}, {"author": null, "timestamp": "2010-04-15T12:14:38+01:00", "section": "Materials", "title": "GFP elution fraction 4", "content": {"html": "Material: Solution
\nA 400 mM imidazole elution fraction from Further purification of GFP fractions


This Post is Linked By: Further purification of GFP fractions;GFP purifcation gel2;Concentration and exchange of GFP;\n", "bbcode": "A 400 mM imidazole elution fraction from [blog]12293[/blog]\n\n"}, "datestamp": "2010-04-15T12:14:38+01:00", "internal-links": ["12293"], "id": "12300"}, {"author": null, "timestamp": "2010-04-15T12:14:50+01:00", "section": "Materials", "title": "GFP elution fraction 5", "content": {"html": "Material: Solution
\nA 400 mM imidazole elution fraction from Further purification of GFP fractions


This Post is Linked By: Further purification of GFP fractions;Concentration and exchange of GFP;\n", "bbcode": "A 400 mM imidazole elution fraction from [blog]12293[/blog]\n\n"}, "datestamp": "2010-04-15T12:14:50+01:00", "internal-links": ["12293"], "id": "12301"}, {"author": null, "timestamp": "2010-04-15T12:15:27+01:00", "section": "Procedures", "title": "Further purification of GFP fractions", "content": {"html": "Procedure: Protein_purification
\nSDS-PAGE had showed that GFP-Second resin wash contained quite a lot of not very pure GFP. This was therefore attempted to be re-purified using the same resin. Firstly 5 mL of 1 M Tris-HCl pH 8 was added to the solution and the solution then flowed over the resin. Binding seemed poor so the flow through was re-diluted by half with Tris-HCl buffer and re-applied to the resin again. This appeared to bind much better.

The flow through was collected to give - GFP-repurification flow through
The resin was then washed with 20 mM imidazole in Tris-HCl buffer to give GFP-repurification first wash.

The resin was then washed with 400 mM imidazole in Tris-HCl buffer and 10-15 mL fractions collected to give.

GFP elution fraction 1
GFP elution fraction 2
GFP elution fraction 3
GFP elution fraction 4
GFP elution fraction 5
This Post is Linked By: GFP elution fraction 2;GFP-repurification flow through;GFP-repurification first wash;GFP elution fraction 1;GFP elution fraction;GFP elution fraction 3;GFP elution fraction 4;GFP elution fraction 5;\n", "bbcode": "SDS-PAGE had showed that [blog]12283[/blog] contained quite a lot of not very pure GFP. This was therefore attempted to be re-purified using the same resin. Firstly 5 mL of 1 M Tris-HCl pH 8 was added to the solution and the solution then flowed over the resin. Binding seemed poor so the flow through was re-diluted by half with Tris-HCl buffer and re-applied to the resin again. This appeared to bind much better.\n\nThe flow through was collected to give - [blog]12294[/blog] \nThe resin was then washed with 20 mM imidazole in Tris-HCl buffer to give [blog]12295[/blog].\n\nThe resin was then washed with 400 mM imidazole in Tris-HCl buffer and 10-15 mL fractions collected to give.\n\n[blog]12297[/blog]\n[blog]12298[/blog]\n[blog]12299[/blog]\n[blog]12300[/blog]\n[blog]12301[/blog]"}, "datestamp": "2010-04-15T12:10:04+01:00", "internal-links": ["12283", "12294", "12295", "12297", "12298", "12299", "12300", "12301"], "id": "12293"}, {"author": null, "timestamp": "2010-04-15T12:27:23+01:00", "section": "Materials", "title": "Sortase cleared lysate", "content": {"html": "Material: Solution
\nThe cleared lysate from Purification of Sortase
This Post is Linked By: Purification of Sortase;\n", "bbcode": "The cleared lysate from [blog]12303[/blog]"}, "datestamp": "2010-04-15T12:27:23+01:00", "internal-links": ["12303"], "id": "12304"}, {"author": null, "timestamp": "2010-04-15T14:04:40+01:00", "section": "Materials", "title": "Sortase flow through fraction", "content": {"html": "Material: Solution
\nThe flow through fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;Concentration and exchange of sortase;\n", "bbcode": "The flow through fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T14:04:40+01:00", "internal-links": ["12303"], "id": "12308"}, {"author": null, "timestamp": "2010-04-15T15:13:53+01:00", "section": "Materials", "title": "Sortase elution fraction 4", "content": {"html": "Material: Solution
\nThe fourth elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;Concentration and exchange of sortase;\n", "bbcode": "The fourth elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T15:13:53+01:00", "internal-links": ["12303"], "id": "12314"}, {"author": null, "timestamp": "2010-04-15T14:04:02+01:00", "section": "Templates", "title": "fraction", "content": {"html": "The [[box]] fraction from Purification of Sortase

[[Section>Materials]]
[[Material>Solution]]
\n", "bbcode": "The [[box]] fraction from [blog]12303[/blog]\n\n[[Section>Materials]]\n[[Material>Solution]]"}, "datestamp": "2010-04-15T12:13:41+01:00", "internal-links": ["12303"], "id": "12296"}, {"author": null, "timestamp": "2010-04-15T14:06:13+01:00", "section": "Materials", "title": "Sortase first wash fraction", "content": {"html": "Material: Solution
\nThe 8 mM imidazole wash fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;\n", "bbcode": "The 8 mM imidazole wash fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T14:06:13+01:00", "internal-links": ["12303"], "id": "12309"}, {"author": null, "timestamp": "2010-04-15T15:15:53+01:00", "section": "Materials", "title": "Sortase 20 mM imidazole wash fraction", "content": {"html": "Material: Solution
\nThe 20 mM imidazole fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;Concentration and exchange of sortase;\n", "bbcode": "The 20 mM imidazole fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T15:15:53+01:00", "internal-links": ["12303"], "id": "12315"}, {"author": null, "timestamp": "2010-04-15T15:13:24+01:00", "section": "Materials", "title": "Sortase elution fraction 2", "content": {"html": "Material: Solution
\nThe second elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;Concentration and exchange of sortase;\n", "bbcode": "The second elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T15:13:24+01:00", "internal-links": ["12303"], "id": "12312"}, {"author": null, "timestamp": "2010-04-15T15:13:38+01:00", "section": "Materials", "title": "Sortase elution fraction 3", "content": {"html": "Material: Solution
\nThe third elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;Concentration and exchange of sortase;\n", "bbcode": "The third elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T15:13:38+01:00", "internal-links": ["12303"], "id": "12313"}, {"author": null, "timestamp": "2010-04-15T15:13:10+01:00", "section": "Materials", "title": "Sortase elution fraction 1", "content": {"html": "Material: Solution
\nThe first elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;Concentration and exchange of sortase;\n", "bbcode": "The first elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T15:13:10+01:00", "internal-links": ["12303"], "id": "12311"}, {"author": null, "timestamp": "2010-04-15T16:16:35+01:00", "section": "Materials", "title": "Sortase elution fraction 6", "content": {"html": "Material: Solution
\nThe sixth elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;\n", "bbcode": "The sixth elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T16:16:35+01:00", "internal-links": ["12303"], "id": "12320"}, {"author": null, "timestamp": "2010-04-15T16:16:52+01:00", "section": "Materials", "title": "Sortase elution fraction 7", "content": {"html": "Material: Solution
\nThe seventh elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;SDS-Page Gel;\n", "bbcode": "The seventh elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T16:16:52+01:00", "internal-links": ["12303"], "id": "12321"}, {"author": null, "timestamp": "2010-04-15T16:17:36+01:00", "section": "Materials", "title": "Sortase elution fraction 8", "content": {"html": "Material: Solution
\nThe 8th elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;Sortase purification SDS-Page Gel;\n", "bbcode": "The 8th elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T16:17:36+01:00", "internal-links": ["12303"], "id": "12322"}, {"author": null, "timestamp": "2010-04-15T16:17:47+01:00", "section": "Materials", "title": "Sortase elution fraction 9", "content": {"html": "Material: Solution
\nThe ninth elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;\n", "bbcode": "The ninth elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T16:17:47+01:00", "internal-links": ["12303"], "id": "12323"}, {"author": null, "timestamp": "2010-04-15T16:17:59+01:00", "section": "Materials", "title": "Sortase elution fraction 10", "content": {"html": "Material: Solution
\nThe tenth elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;\n", "bbcode": "The tenth elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T16:17:59+01:00", "internal-links": ["12303"], "id": "12324"}, {"author": null, "timestamp": "2010-04-15T16:18:59+01:00", "section": "Procedures", "title": "Purification of Sortase", "content": {"html": "Procedure: Protein_purification
\nSix sortase stocks were grown up and induced (1L each). A gel of the six growths suggested good expression of Sortase in all cases. Pellet (21.1 g) was resuspended in around 105 mL of GFP Lysis Buffer. The suspensions were sonicated to lyse and then cleared by centrifugation (20 minutes, 18krpm, SS-34, 4 C) to give Sortase cleared lysate.

The lysate was poured over 10 mL of cleaned Ni-NTA Sepharose resin, to yield Sortase flow through fraction, a somewhat murky brown solution. The resin also turned an unpleasant brownish tinge. The resin was then washed with 100 mL of 20 mM Tris-HCl, 8 mM imidazole to yield Sortase first wash fraction. The resin was then washed with 20 mM imidazole buffer to yield Sortase 20 mM imidazole wash fraction.

The resin remained a dull blueish colour during this process. The resin was then washed with 20 mM Tris-HCl, 400 mM imidazole and 10-15 mL fractions collected to give: Sortase elution fraction 1, Sortase elution fraction 2, Sortase elution fraction 3, Sortase elution fraction 4, Sortase elution fraction 5, Sortase elution fraction 6, Sortase elution fraction 7, Sortase elution fraction 8, Sortase elution fraction 9, Sortase elution fraction 10.

As the resin was eluted it returned to a clearer blue colour. Quick bradford tests (but with old bradford reagent) showed the flow through to have a high protein concentration but the washes and the fractions to have relatively low concentration. Probably best to tell on a gel.
This Post is Linked By: Sortase cleared lysate;Sortase flow through fraction;Sortase elution fraction 4;GFP elution fraction;Sortase first wash fraction;Sortase 20 mM imidazole wash fraction;Sortase elution fraction 2;Sortase elution fraction 3;Sortase elution fraction 1;Sortase elution fraction 6;Sortase elution fraction 7;Sortase elution fraction 8;Sortase elution fraction 9;Sortase elution fraction 10;Sortase elution fraction 5;\n", "bbcode": "Six sortase stocks were grown up and induced (1L each). A gel of the six growths suggested good expression of Sortase in all cases. Pellet (21.1 g) was resuspended in around 105 mL of [blog]12272[/blog]. The suspensions were sonicated to lyse and then cleared by centrifugation (20 minutes, 18krpm, SS-34, 4 C) to give [blog]12304[/blog].\n\nThe lysate was poured over 10 mL of cleaned Ni-NTA Sepharose resin, to yield [blog]12308[/blog], a somewhat murky brown solution. The resin also turned an unpleasant brownish tinge. The resin was then washed with 100 mL of 20 mM Tris-HCl, 8 mM imidazole to yield [blog]12309[/blog]. The resin was then washed with 20 mM imidazole buffer to yield [blog]12315[/blog].\n\nThe resin remained a dull blueish colour during this process. The resin was then washed with 20 mM Tris-HCl, 400 mM imidazole and 10-15 mL fractions collected to give: [blog]12311[/blog], [blog]12312[/blog], [blog]12313[/blog], [blog]12314[/blog], [blog]12319[/blog], [blog]12320[/blog], [blog]12321[/blog], [blog]12322[/blog], [blog]12323[/blog], [blog]12324[/blog].\n\nAs the resin was eluted it returned to a clearer blue colour. Quick bradford tests (but with old bradford reagent) showed the flow through to have a high protein concentration but the washes and the fractions to have relatively low concentration. Probably best to tell on a gel."}, "datestamp": "2010-04-15T12:27:10+01:00", "internal-links": ["12272", "12304", "12308", "12309", "12315", "12311", "12312", "12313", "12314", "12319", "12320", "12321", "12322", "12323", "12324"], "id": "12303"}, {"author": null, "timestamp": "2010-04-15T16:16:23+01:00", "section": "Materials", "title": "Sortase elution fraction 5", "content": {"html": "Material: Solution
\nThe fifth elution fraction from Purification of Sortase


This Post is Linked By: Purification of Sortase;\n", "bbcode": "The fifth elution fraction from [blog]12303[/blog]\n\n"}, "datestamp": "2010-04-15T16:16:23+01:00", "internal-links": ["12303"], "id": "12319"}, {"author": null, "timestamp": "2010-04-16T09:18:33+01:00", "section": "Materials", "title": "Sigma Wide Range SDS-PAGE Marker", "content": {"html": "Material: Solution
\nTODO: Link to webpage
This Post is Linked By: GFP purifcation gel2;GFP purification Gel;Sortase purification SDS-Page Gel;\n", "bbcode": "TODO: Link to webpage"}, "datestamp": "2010-04-16T09:18:33+01:00", "internal-links": [], "id": "12328"}, {"author": null, "timestamp": "2010-04-16T09:48:10+01:00", "section": "Templates", "title": "SDS-Page Gel", "content": {"html": "

Lane		Sampleul

1		[[Material:Solution]][[box]]

2		[[Material:Solution]][[box]]

3		[[Material:Solution]][[box]]

4		[[Material:Solution]][[box]]

5		[[Material:Solution]][[box]]

6		[[Material:Solution]][[box]]

7		[[Material:Solution]][[box]]

8		[[Material:Solution]][[box]]

9		[[Material:Solution]][[box]]

10		[[Material:Solution]][[box]]


A [[box]]% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.

[[Section>Procedures]]
[[Procedure>SDS_PAGE]]
\n", "bbcode": "[table]\n[row]\nLane[col]Sample[col]ul\n[/row]\n\n[row]\n1[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n2[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n3[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n4[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n5[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n6[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n7[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n8[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n9[col][[Material:Solution]][col][[box]]\n[/row]\n\n[row]\n10[col][[Material:Solution]][col][[box]]\n[/row]\n\n\n[/table]\n\nA [[box]]% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.\n\n[[Section>Procedures]]\n[[Procedure>SDS_PAGE]]"}, "datestamp": "2010-04-16T09:17:38+01:00", "internal-links": [], "id": "12327"}, {"author": null, "timestamp": "2010-04-16T09:47:29+01:00", "section": "Procedures", "title": "GFP purifcation gel2", "content": {"html": "Procedure: SDS_PAGE
\n

Lane		Sampleul

1		Sigma Wide Range SDS-PAGE Marker5

2		GFP-Second resin wash5 fraction1

3		GFP-Second resin wash5 fraction2

4		GFP elution fraction 15

5		GFP elution fraction 25

6		GFP elution fraction 35

7		GFP elution fraction 45

8

9

10


A 12% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.

GFP second gel

This Post is Linked By: Concentration and exchange of GFP;\n", "bbcode": "[table]\n[row]\nLane[col]Sample[col]ul\n[/row]\n\n[row]\n1[col][blog]12328[/blog][col]5\n[/row]\n\n[row]\n2[col][blog]12283[/blog][col]5 fraction1\n[/row]\n\n[row]\n3[col][blog]12283[/blog][col]5 fraction2\n[/row]\n\n[row]\n4[col][blog]12297[/blog][col]5\n[/row]\n\n[row]\n5[col][blog]12298[/blog][col]5\n[/row]\n\n[row]\n6[col][blog]12299[/blog][col]5\n[/row]\n\n[row]\n7[col][blog]12300[/blog][col]5\n[/row]\n\n[row]\n8[col][blog][/blog][col]\n[/row]\n\n[row]\n9[col][blog][/blog][col]\n[/row]\n\n[row]\n10[col][blog][/blog][col]\n[/row]\n\n\n[/table]\n\nA 12% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.\n\n[data]1767[/data]"}, "datestamp": "2010-04-16T09:45:39+01:00", "internal-links": ["12328", "12283", "12283", "12297", "12298", "12299", "12300"], "id": "12334"}, {"author": null, "timestamp": "2010-04-16T14:22:51+01:00", "section": "Procedures", "title": "Concentration and exchange of GFP", "content": {"html": "Procedure: Protein_purification
\nProject: Protein-ligation
\nOn the basis of the gel GFP purifcation gel2, the following fractions: GFP elution fraction 1, GFP elution fraction 2, GFP elution fraction 3, GFP elution fraction 4, GFP elution fraction 5, and GFP-Third resin wash, total of about 100 mL were combined and concentrated by Amicon (10 kDa cutoff).

It was assumed that the repurification proceeded as did the first and these samples were reasonably pure. The resulting concentrated solution (about 30 mL) was dialyzed against 4 L of water overnight and then three further changes of 4 L prior to being frozen at -80 and freeze dried over the weekend to yield Freeze dried GFP.
This Post is Linked By: Freeze dried GFP;\n", "bbcode": "On the basis of the gel [blog]12334[/blog], the following fractions: [blog]12297[/blog], [blog]12298[/blog], [blog]12299[/blog], [blog]12300[/blog], [blog]12301[/blog], and [blog]12286[/blog], total of about 100 mL were combined and concentrated by Amicon (10 kDa cutoff).\n\nIt was assumed that the repurification proceeded as did the first and these samples were reasonably pure. The resulting concentrated solution (about 30 mL) was dialyzed against 4 L of water overnight and then three further changes of 4 L prior to being frozen at -80 and freeze dried over the weekend to yield [blog]12345[/blog]."}, "datestamp": "2010-04-15T14:01:06+01:00", "internal-links": ["12334", "12297", "12298", "12299", "12300", "12301", "12286", "12345"], "id": "12306"}, {"author": null, "timestamp": "2010-04-21T09:30:53+01:00", "section": "Materials", "title": "Frozen Sortase solution", "content": {"html": "Material: Solution
\nThe frozen dialysate from Concentration and exchange of sortase
This Post is Linked By: Concentration and exchange of sortase;\n", "bbcode": "The frozen dialysate from [blog]12344[/blog]"}, "datestamp": "2010-04-21T09:30:53+01:00", "internal-links": ["12344"], "id": "12357"}, {"author": null, "timestamp": "2010-04-16T09:47:41+01:00", "section": "Procedures", "title": "GFP purification Gel", "content": {"html": "Procedure: SDS_PAGE
\n

Lane		Sampleul

1		Sigma Wide Range SDS-PAGE Marker5

2		GFP Cleared lysate5

3		GFP purification first filtrate5

4		GFP purification second filtrate5

5		GFP-First resin wash5 fraction1

6		GFP-First resin wash5 fraction2


A 12% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.

Essentially no useful bands visible on gel.
\n", "bbcode": "[table]\n[row]\nLane[col]Sample[col]ul\n[/row]\n\n[row]\n1[col][blog]12328[/blog][col]5\n[/row]\n\n[row]\n2[col][blog]12275[/blog][col]5\n[/row]\n\n[row]\n3[col][blog]12277[/blog][col]5\n[/row]\n\n[row]\n4[col][blog]12278[/blog][col]5 \n[/row]\n\n[row]\n5[col][blog]12280[/blog][col]5 fraction1\n[/row]\n\n[row]\n6[col][blog]12280[/blog][col]5 fraction2\n[/row]\n\n\n[/table]\n\nA 12% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.\n\nEssentially no useful bands visible on gel."}, "datestamp": "2010-04-16T09:42:04+01:00", "internal-links": ["12328", "12275", "12277", "12278", "12280", "12280"], "id": "12332"}, {"author": null, "timestamp": "2010-04-16T09:47:54+01:00", "section": "Procedures", "title": "Sortase purification SDS-Page Gel", "content": {"html": "Procedure: SDS_PAGE
\n

Lane		Sampleul

1		Sigma Wide Range SDS-PAGE Marker5

2		Sortase flow through fraction5

3		Sortase first wash fraction5

4		Sortase 20 mM imidazole wash fraction5

5		Sortase elution fraction 15

6		Sortase elution fraction 25

7		Sortase elution fraction 35

8		Sortase elution fraction 45

9		Sortase elution fraction 65

10		Sortase elution fraction 85


A 12% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.

Sortase purification gel

This Post is Linked By: Concentration and exchange of sortase;\n", "bbcode": "[table]\n[row]\nLane[col]Sample[col]ul\n[/row]\n\n[row]\n1[col][blog]12328[/blog][col]5\n[/row]\n\n[row]\n2[col][blog]12308[/blog][col]5\n[/row]\n\n[row]\n3[col][blog]12309[/blog][col]5\n[/row]\n\n[row]\n4[col][blog]12315[/blog][col]5\n[/row]\n\n[row]\n5[col][blog]12311[/blog][col]5\n[/row]\n\n[row]\n6[col][blog]12312[/blog][col]5\n[/row]\n\n[row]\n7[col][blog]12313[/blog][col]5\n[/row]\n\n[row]\n8[col][blog]12314[/blog][col]5\n[/row]\n\n[row]\n9[col][blog]12320[/blog][col]5\n[/row]\n\n[row]\n10[col][blog]12322[/blog][col]5\n[/row]\n\n\n[/table]\n\nA 12% SDS-PAGE gel was polymerized according to Sambrook. Samples were loaded in gel loading buffer and the gel run at 180 V for approximately 1 hour.\n\n[data]1765[/data]"}, "datestamp": "2010-04-16T09:20:13+01:00", "internal-links": ["12328", "12308", "12309", "12315", "12311", "12312", "12313", "12314", "12320", "12322"], "id": "12329"}, {"author": null, "timestamp": "2010-04-21T09:37:13+01:00", "section": "Materials", "title": "Freeze dried Sortase", "content": {"html": "Material: Powder
\nThe freeze dried Sortase from Concentration and exchange of sortase.

Total weight of material: 141 mg


TubeEmpty weight (g)With protein (g)Protein (mg)
19.77399.801527.5
29.76289.791228.5
39.81499.844429.5
49.998410.027229
59.77449.801926.5

This Post is Linked By: Concentration and exchange of sortase;Ligation test of GFP and Fluor;\n", "bbcode": "The freeze dried Sortase from [blog]12344[/blog].\n\nTotal weight of material: 141 mg\n\n[table]\n[row]Tube[col]Empty weight (g)[col]With protein (g)[col]Protein (mg)[/row]\n[row]1[col]9.7739[col]9.8015[col]27.5[/row]\n[row]2[col]9.7628[col]9.7912[col]28.5[/row]\n[row]3[col]9.8149[col]9.8444[col]29.5[/row]\n[row]4[col]9.9984[col]10.0272[col]29[/row]\n[row]5[col]9.7744[col]9.8019[col]26.5[/row]\n[/table]"}, "datestamp": "2010-04-21T09:37:13+01:00", "internal-links": ["12344"], "id": "12358"}, {"author": null, "timestamp": "2010-04-21T09:29:17+01:00", "section": "Materials", "title": "Freeze dried GFP", "content": {"html": "Material: Powder
\nThe final product of freeze dried purified GFP from Concentration and exchange of GFP.

Total weight of material: 141 mg


TubeEmpty weight (g)With protein (g)Protein (mg)
19.80309.862960
29.80229.883181


I may have mixed up the lids for the two tubes but the total weight should be correct regardless.
This Post is Linked By: Concentration and exchange of GFP;Ligation test of GFP and Fluor;\n", "bbcode": "The final product of freeze dried purified GFP from [blog]12306[/blog].\n\nTotal weight of material: 141 mg\n\n[table]\n[row]Tube[col]Empty weight (g)[col]With protein (g)[col]Protein (mg)[/row]\n[row]1[col]9.8030[col]9.8629[col]60[/row]\n[row]2[col]9.8022[col]9.8831[col]81[/row]\n[/table]\n\nI may have mixed up the lids for the two tubes but the total weight should be correct regardless."}, "datestamp": "2010-04-16T14:22:39+01:00", "internal-links": ["12306"], "id": "12345"}, {"author": null, "timestamp": "2010-04-21T09:40:23+01:00", "section": "Procedures", "title": "Concentration and exchange of sortase", "content": {"html": "Procedure: Protein_purification
\nProject: Protein-ligation
\nOn the basis of the gel Sortase purification SDS-Page Gel the solution from Sortase flow through fraction was repurified as before and equivalent fractions were combined. The Sortase 20 mM imidazole wash fraction, around 200 mL was combined and concentrated to around 30 mL at which point it had started to precipitate and then dialyzed against 4L of water over the weekend at 4C.

The fractions Sortase elution fraction 1, Sortase elution fraction 2, Sortase elution fraction 3, Sortase elution fraction 4 and the equivalent from the repurified sample were combined and concentrated to a total of around 80 mL and dialyzed against 4 L of water over the weekend at 4C.

One dialysis tube (about 30 mL) was taken and the solution frozen directly at -80 C to give Frozen Sortase solution. The remainder was combined and freeze dried to give Freeze dried Sortase
This Post is Linked By: Frozen Sortase solution;Freeze dried Sortase;\n", "bbcode": "On the basis of the gel [blog]12329[/blog] the solution from [blog]12308[/blog] was repurified as before and equivalent fractions were combined. The [blog]12315[/blog], around 200 mL was combined and concentrated to around 30 mL at which point it had started to precipitate and then dialyzed against 4L of water over the weekend at 4C. \n\nThe fractions [blog]12311[/blog], [blog]12312[/blog], [blog]12313[/blog], [blog]12314[/blog] and the equivalent from the repurified sample were combined and concentrated to a total of around 80 mL and dialyzed against 4 L of water over the weekend at 4C.\n\nOne dialysis tube (about 30 mL) was taken and the solution frozen directly at -80 C to give [blog]12357[/blog]. The remainder was combined and freeze dried to give [blog]12358[/blog]"}, "datestamp": "2010-04-16T09:52:40+01:00", "internal-links": ["12329", "12308", "12315", "12311", "12312", "12313", "12314", "12357", "12358"], "id": "12344"}, {"author": null, "timestamp": "2010-06-22T15:08:11+01:00", "section": "Templates", "title": "SANS2d run template", "content": {"html": "The following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]
[[Material:Solution]][[box=2]][[Box=5]][[Box=5]][[Blog]]



[[Section>Procedures]]
[[Procedure>SANS]]
[[Instrument>SANS2d]]
[[Project>Glur0]]
\n", "bbcode": "The following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[row][[Material:Solution]][col][[box=2]][col][[Box=5]][col][[Box=5]][col][[Blog]][/row]\n[/table]\n\n\n[[Section>Procedures]]\n[[Procedure>SANS]]\n[[Instrument>SANS2d]]\n[[Project>Glur0]]"}, "datestamp": "2010-03-09T19:49:06+00:00", "internal-links": [], "id": "12131"}, {"author": null, "timestamp": "2010-06-23T09:51:01+01:00", "section": "Procedures", "title": "First Glur0 runs - SANS2d", "content": {"html": "Procedure: SANS
\nInstrument: SANS2d
\nProject: Glur0
\nThe following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C. The run script is attached.


SampleSANS/TRANSExposure time (uamp.hr)Run #Data
D2O Buffer for Glur0S403325
Empty beamS153326
Glur0 D2O SampleT63328
Glur0 H2O SampleT63329
H2O Buffer for Glur0T63330
D2O Buffer for Glur0T63331
empty beamS83332
Glur0 D2O SampleS403333
Glur0 H2O SampleS403334


GCL script

\n", "bbcode": "The following samples were run as described on SANS2d at ISIS. The samples were run in 1 mm path length rectangular cells (200 uL samples) at a temperature of 20 C. The run script is attached.\n\n[table]\n[row]Sample[col]SANS/TRANS[col]Exposure time (uamp.hr)[col]Run #[col]Data[/row]\n[row][blog]12133[/blog][col]S[col]40[col]3325[col][blog][/blog][/row]\n[row]Empty beam[col]S[col]15[col]3326[col][blog][/blog][/row]\n[row][blog]12125[/blog][col]T[col]6[col]3328[col][blog][/blog][/row]\n[row][blog]12126[/blog][col]T[col]6[col]3329[col][blog][/blog][/row]\n[row][blog]12134[/blog][col]T[col]6[col]3330[col][blog][/blog][/row]\n[row][blog]12133[/blog][col]T[col]6[col]3331[col][blog][/blog][/row]\n[row]empty beam[col]S[col]8[col]3332[col][blog][/blog][/row]\n[row][blog]12125[/blog][col]S[col]40[col]3333[col][blog][/blog][/row]\n[row][blog]12126[/blog][col]S[col]40[col]3334[col][blog][/blog][/row]\n\n[/table]\n\n[data]1707[/data]"}, "datestamp": "2010-03-09T22:28:27+00:00", "internal-links": ["12133", "12125", "12126", "12134", "12133", "12125", "12126"], "id": "12137"}, {"author": null, "timestamp": "2010-08-12T16:53:35+01:00", "section": "Procedures", "title": "Purification of Tus-Ter complex", "content": {"html": "Procedure: Sample_Preparation
\nJon Burns mixed Tus (about 30 uM, 200 uL) with 21-mer Ter DNA and 500 uL of the resultant solution was run on the S75 column yielding a large number of fractions. The trace showed some aggregate eluting in the void volume (about 20 mL) and some absorbances at 260. The apparent protein peak (complex) eluted at around 48 mL which is earlier than that from the protein alone on this column. There were three presumed DNA peaks which is worrying. Running the DNA alone replicated those three peaks providing confidence that the new peak with a strong 280 nm absorbance was the complex.

Fractions D6 to E3 were combined and concentrated to
\n", "bbcode": "Jon Burns mixed Tus (about 30 uM, 200 uL) with 21-mer Ter DNA and 500 uL of the resultant solution was run on the S75 column yielding a large number of fractions. The trace showed some aggregate eluting in the void volume (about 20 mL) and some absorbances at 260. The apparent protein peak (complex) eluted at around 48 mL which is earlier than that from the protein alone on this column. There were three presumed DNA peaks which is worrying. Running the DNA alone replicated those three peaks providing confidence that the new peak with a strong 280 nm absorbance was the complex.\n\nFractions D6 to E3 were combined and concentrated to"}, "datestamp": "2010-08-12T16:36:54+01:00", "internal-links": [], "id": "13150"}, {"author": null, "timestamp": "2010-08-13T10:47:19+01:00", "section": "Procedures", "title": "Purification of Tus-Ter(14mer) complex, Tus-NS(21mer), Tus-Ter(Ext)", "content": {"html": "Procedure: Sample_Preparation
\nSample of Ter DNA (14 mer from Kamada paper) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75.

There seem to be two relevant peaks, one at 49 mL and one at 62. Will concentrate 62 mL peak (E10-F8) but this may be free protein.

Sample of NS DNA (21 mer from biochemistry paper) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75. Main protein peak at 62 minutes, concentrate fraction E9-F9.

Sample of Ter DNA (Jon's extended sequence) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75.

Trace is a bit of a mess. Can't see a clear protein peak and seem to have three DNA peaks. Not sure what to do with this.

Sample of NS DNA (extended) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75. Main protein peak at 62 minutes, concentrate fraction E9-F9.

Again, as with the Ter case the trace is not convincing. The peak at 55-59 mL was selected and concentrated.
This Post is Linked By: Concentrated sample from Tus-NS(21mer) S75 column;Concentrated sample from Tus-Ter(14mer) S75 column;\n", "bbcode": "Sample of Ter DNA (14 mer from Kamada paper) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75.\n\nThere seem to be two relevant peaks, one at 49 mL and one at 62. Will concentrate 62 mL peak (E10-F8) but this may be free protein.\n\nSample of NS DNA (21 mer from biochemistry paper) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75. Main protein peak at 62 minutes, concentrate fraction E9-F9.\n\nSample of Ter DNA (Jon's extended sequence) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75.\n\nTrace is a bit of a mess. Can't see a clear protein peak and seem to have three DNA peaks. Not sure what to do with this.\n\nSample of NS DNA (extended) was mixed with 297 uL of Tus sample, incubated at RT for 10 minutes and then loaded onto the S75. Main protein peak at 62 minutes, concentrate fraction E9-F9.\n\nAgain, as with the Ter case the trace is not convincing. The peak at 55-59 mL was selected and concentrated."}, "datestamp": "2010-08-12T21:48:55+01:00", "internal-links": [], "id": "13156"}, {"author": null, "timestamp": "2010-08-13T11:12:19+01:00", "section": "Materials", "title": "Concentrated sample from Tus-NS(21mer) S75 column", "content": {"html": "Material: Solution
\nSample from Purification of Tus-Ter(14mer) complex, Tus-NS(21mer), Tus-Ter(Ext)
\n", "bbcode": "Sample from [blog]13156[/blog]"}, "datestamp": "2010-08-13T11:12:19+01:00", "internal-links": ["13156"], "id": "13169"}, {"author": null, "timestamp": "2010-08-13T11:11:18+01:00", "section": "Materials", "title": "Concentrated sample from Tus-Ter(14mer) S75 column", "content": {"html": "Material: Solution
\nSample from Purification of Tus-Ter(14mer) complex, Tus-NS(21mer), Tus-Ter(Ext)
\n", "bbcode": "Sample from [blog]13156[/blog]"}, "datestamp": "2010-08-13T11:11:18+01:00", "internal-links": ["13156"], "id": "13168"}, {"author": null, "timestamp": "2010-09-13T11:51:36+01:00", "section": "Data", "title": "3339 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3339



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2171[/data]\n\n"}, "datestamp": "2010-09-13T11:51:36+01:00", "internal-links": [], "id": "13249"}, {"author": null, "timestamp": "2010-09-13T11:52:12+01:00", "section": "Data", "title": "3395 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3395



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2173[/data]\n\n"}, "datestamp": "2010-09-13T11:52:12+01:00", "internal-links": [], "id": "13250"}, {"author": null, "timestamp": "2010-09-13T11:52:50+01:00", "section": "Data", "title": "3397 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3397



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2175[/data]\n\n"}, "datestamp": "2010-09-13T11:52:50+01:00", "internal-links": [], "id": "13251"}, {"author": null, "timestamp": "2010-09-13T11:53:30+01:00", "section": "Data", "title": "3393 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3393



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2177[/data]\n\n"}, "datestamp": "2010-09-13T11:53:30+01:00", "internal-links": [], "id": "13252"}, {"author": null, "timestamp": "2010-09-13T11:55:08+01:00", "section": "Data", "title": "3345 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3345



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2179[/data]\n\n"}, "datestamp": "2010-09-13T11:55:08+01:00", "internal-links": [], "id": "13253"}, {"author": null, "timestamp": "2010-09-13T11:55:08+01:00", "section": "Procedures", "title": "SANS Data Reduction", "content": {"html": "Procedure: Data_reduction
\n
SANS RunSANS TransBgd RunBgd TransReduced data
33393328334233313339 - reduced SANS data
33953355339633563395 - reduced SANS data
33973353339233543397 - reduced SANS data
33933346339433473393 - reduced SANS data
33453329334133303345 - reduced SANS data


\n", "bbcode": "[table][row]SANS Run[col]SANS Trans[col]Bgd Run[col]Bgd Trans[col]Reduced data[col][/row]\n[row]3339[col]3328[col]3342[col]3331[col][blog]13249[/blog][col][/row]\n[row]3395[col]3355[col]3396[col]3356[col][blog]13250[/blog][col][/row]\n[row]3397[col]3353[col]3392[col]3354[col][blog]13251[/blog][col][/row]\n[row]3393[col]3346[col]3394[col]3347[col][blog]13252[/blog][col][/row]\n[row]3345[col]3329[col]3341[col]3330[col][blog]13253[/blog][col][/row]\n[/table]\n"}, "datestamp": "2010-09-13T11:55:08+01:00", "internal-links": ["13249", "13250", "13251", "13252", "13253"], "id": "13254"}, {"author": null, "timestamp": "2010-09-23T10:40:03+01:00", "section": "Data", "title": "3361 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3361



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2199[/data]\n\n"}, "datestamp": "2010-09-23T10:40:03+01:00", "internal-links": [], "id": "13323"}, {"author": null, "timestamp": "2010-09-23T10:40:31+01:00", "section": "Data", "title": "3367 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3367



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2201[/data]\n\n"}, "datestamp": "2010-09-23T10:40:31+01:00", "internal-links": [], "id": "13324"}, {"author": null, "timestamp": "2010-09-23T10:40:58+01:00", "section": "Data", "title": "3377 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3377



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2203[/data]\n\n"}, "datestamp": "2010-09-23T10:40:58+01:00", "internal-links": [], "id": "13325"}, {"author": null, "timestamp": "2010-09-23T10:41:27+01:00", "section": "Data", "title": "3386 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3386



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2205[/data]\n\n"}, "datestamp": "2010-09-23T10:41:27+01:00", "internal-links": [], "id": "13326"}, {"author": null, "timestamp": "2010-09-23T10:41:57+01:00", "section": "Data", "title": "3395 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3395



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2207[/data]\n\n"}, "datestamp": "2010-09-23T10:41:57+01:00", "internal-links": [], "id": "13327"}, {"author": null, "timestamp": "2010-09-23T10:47:45+01:00", "section": "Procedure", "title": "SANS Data Reduction", "content": {"html": "Procedure: Data_reduction
\nI've reduced each of the 80% D2O runs individually to check whether there is something wrong with one of them as the background subtraction for the whole set gives strange results.

SANS RunSANS TransBgd RunBgd TransReduced data
33613355336233563361 - reduced SANS data
33673355336233563367 - reduced SANS data
33773355336233563377 - reduced SANS data
33863355336233563386 - reduced SANS data
33953355336233563395 - reduced SANS data


Based on the graph there doesn't seem much difference, although there is some evidence of aggregation for the later samples. Next job is to check the backgrounds for variation.
Comparison graph

\n", "bbcode": "I've reduced each of the 80% D2O runs individually to check whether there is something wrong with one of them as the background subtraction for the whole set gives strange results.\n\n[table][row]SANS Run[col]SANS Trans[col]Bgd Run[col]Bgd Trans[col]Reduced data[col][/row]\n[row]3361[col]3355[col]3362[col]3356[col][blog]13323[/blog][col][/row]\n[row]3367[col]3355[col]3362[col]3356[col][blog]13324[/blog][col][/row]\n[row]3377[col]3355[col]3362[col]3356[col][blog]13325[/blog][col][/row]\n[row]3386[col]3355[col]3362[col]3356[col][blog]13326[/blog][col][/row]\n[row]3395[col]3355[col]3362[col]3356[col][blog]13327[/blog][col][/row]\n[/table]\n\nBased on the graph there doesn't seem much difference, although there is some evidence of aggregation for the later samples. Next job is to check the backgrounds for variation.\n[data]2209[/data]"}, "datestamp": "2010-09-23T10:41:58+01:00", "internal-links": ["13323", "13324", "13325", "13326", "13327"], "id": "13328"}, {"author": null, "timestamp": "2010-09-23T10:55:45+01:00", "section": "Data", "title": "3362 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3362



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2211[/data]\n\n"}, "datestamp": "2010-09-23T10:55:45+01:00", "internal-links": [], "id": "13332"}, {"author": null, "timestamp": "2010-09-23T10:56:19+01:00", "section": "Data", "title": "3368 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3368



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2213[/data]\n\n"}, "datestamp": "2010-09-23T10:56:19+01:00", "internal-links": [], "id": "13333"}, {"author": null, "timestamp": "2010-09-23T10:56:51+01:00", "section": "Data", "title": "3378 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3378



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2215[/data]\n\n"}, "datestamp": "2010-09-23T10:56:51+01:00", "internal-links": [], "id": "13334"}, {"author": null, "timestamp": "2010-09-23T10:57:19+01:00", "section": "Data", "title": "3383 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3383



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2217[/data]\n\n"}, "datestamp": "2010-09-23T10:57:19+01:00", "internal-links": [], "id": "13335"}, {"author": null, "timestamp": "2010-09-23T10:57:49+01:00", "section": "Data", "title": "3387 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3387



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2219[/data]\n\n"}, "datestamp": "2010-09-23T10:57:49+01:00", "internal-links": [], "id": "13336"}, {"author": null, "timestamp": "2010-09-23T10:58:18+01:00", "section": "Data", "title": "3396 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3396



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2221[/data]\n\n"}, "datestamp": "2010-09-23T10:58:18+01:00", "internal-links": [], "id": "13337"}, {"author": null, "timestamp": "2010-09-23T11:03:14+01:00", "section": "Procedure", "title": "SANS Data Reduction", "content": {"html": "Procedure: Data_reduction
\nAs the sample runs looked very similar for 80% D2O samples am now checking the buffers to see whether one of them is out of wack.

SANS RunSANS TransBgd RunBgd TransReduced data
33623356334933483362 - reduced SANS data
33683356334933483368 - reduced SANS data
33783356334933483378 - reduced SANS data
33833356334933483383 - reduced SANS data
33873356334933483387 - reduced SANS data
33963356334933483396 - reduced SANS data


Comparing the buffers (using D2O as the background) clearly 3383 is somehow out of wack. Possibly just not labelled correctly, looks suspiciously like a water background.

Buffer scattering comparison


Will need to re-do the add file for 80% D2O background and then re-do the reductions.
\n", "bbcode": "As the sample runs looked very similar for 80% D2O samples am now checking the buffers to see whether one of them is out of wack.\n\n[table][row]SANS Run[col]SANS Trans[col]Bgd Run[col]Bgd Trans[col]Reduced data[col][/row]\n[row]3362[col]3356[col]3349[col]3348[col][blog]13332[/blog][col][/row]\n[row]3368[col]3356[col]3349[col]3348[col][blog]13333[/blog][col][/row]\n[row]3378[col]3356[col]3349[col]3348[col][blog]13334[/blog][col][/row]\n[row]3383[col]3356[col]3349[col]3348[col][blog]13335[/blog][col][/row]\n[row]3387[col]3356[col]3349[col]3348[col][blog]13336[/blog][col][/row]\n[row]3396[col]3356[col]3349[col]3348[col][blog]13337[/blog][col][/row]\n[/table]\n\nComparing the buffers (using D2O as the background) clearly 3383 is somehow out of wack. Possibly just not labelled correctly, looks suspiciously like a water background.\n\n[data]2223[/data]\n\nWill need to re-do the add file for 80% D2O background and then re-do the reductions."}, "datestamp": "2010-09-23T10:58:19+01:00", "internal-links": ["13332", "13333", "13334", "13335", "13336", "13337"], "id": "13338"}, {"author": null, "timestamp": "2010-09-23T11:12:08+01:00", "section": "Procedures", "title": "Adding runs from March GLur0 SANS Expt", "content": {"html": "Procedure: SANS
\nInstrument: SANS2d
\nA bunch of runs weren't explicitly recorded for this experiment so I am recording the complete set of runs here.


SampleRunsTransmission
D2O33493373338233913348
Glur0 H2O Sample3334334033453329
Glur0 in 22% D2O buffer3350335933653375338433933346
Glur0-42% D2O33573363336933703379338833973353
Glur0-80% D2O336133673377338633953355
Glur0 D2O Sample333333393328
10mM DM H2O Buffer333633413330
10 mM DM 22%D2O buffer3351336033663376338533943347
10 mM DM 40%D2O buffer335833643370337433923354
10 mM DM 80%D2O buffer336233683378338733963356
10mM DM D2O Buffer3325333733423331


Empty beam transmission: 3332

Run 3383 does not appear to be an 80% D2O run but probably water. This run was taken out of subsequently added sets.
\n", "bbcode": "A bunch of runs weren't explicitly recorded for this experiment so I am recording the complete set of runs here.\n\n[table]\n[row]Sample[col]Runs[col][col][col][col][col][col][col][col]Transmission[/row]\n[row]D2O[col]3349[col]3373[col]3382[col]3391[col][col][col][col][col]3348[/row]\n[row][blog]12126[/blog][col]3334[col]3340[col]3345[col][col][col][col][col][col]3329[/row]\n[row][blog]12156[/blog][col]3350[col]3359[col]3365[col]3375[col]3384[col]3393[col][col][col]3346[/row]\n[row]Glur0-42% D2O[col]3357[col]3363[col]3369[col]3370[col]3379[col]3388[col]3397[col][col]3353[/row]\n[row]Glur0-80% D2O[col]3361[col]3367[col]3377[col]3386[col]3395[col][col][col][col]3355[/row]\n[row][blog]12125[/blog][col]3333[col]3339[col][col][col][col][col][col][col]3328[/row]\n[row][/row]\n[row][blog]12132[/blog][col]3336[col]3341[col][col][col][col][col][col][col]3330[/row]\n[row]10 mM DM 22%D2O buffer[col]3351[col]3360[col]3366[col]3376[col]3385[col]3394[col][col][col]3347[/row]\n[row]10 mM DM 40%D2O buffer[col]3358[col]3364[col]3370[col]3374[col]3392[col][col][col][col]3354[/row]\n[row]10 mM DM 80%D2O buffer[col]3362[col]3368[col]3378[col][col]3387[col]3396[col][col][col]3356[/row]\n[row][blog]12135[/blog][col]3325[col]3337[col]3342[col][col][col][col][col][col]3331[/row]\n[/table]\n\nEmpty beam transmission: 3332\n\nRun 3383 does not appear to be an 80% D2O run but probably water. This run was taken out of subsequently added sets."}, "datestamp": "2010-09-13T09:21:20+01:00", "internal-links": ["12126", "12156", "12125", "12132", "12135"], "id": "13247"}, {"author": null, "timestamp": "2010-09-23T11:33:25+01:00", "section": "Data", "title": "3345 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3345



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2233[/data]\n\n"}, "datestamp": "2010-09-23T11:33:25+01:00", "internal-links": [], "id": "13346"}, {"author": null, "timestamp": "2010-09-23T11:34:05+01:00", "section": "Data", "title": "3393 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3393



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2235[/data]\n\n"}, "datestamp": "2010-09-23T11:34:05+01:00", "internal-links": [], "id": "13347"}, {"author": null, "timestamp": "2010-09-23T11:34:46+01:00", "section": "Data", "title": "3397 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3397



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2237[/data]\n\n"}, "datestamp": "2010-09-23T11:34:46+01:00", "internal-links": [], "id": "13348"}, {"author": null, "timestamp": "2010-09-23T11:35:36+01:00", "section": "Data", "title": "3395 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3395



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2239[/data]\n\n"}, "datestamp": "2010-09-23T11:35:36+01:00", "internal-links": [], "id": "13349"}, {"author": null, "timestamp": "2010-09-23T11:36:16+01:00", "section": "Data", "title": "3339 - reduced SANS data", "content": {"html": "Instrument: SANS2D
\nData Type: SANS
\nReduced SANS Data

3339



This Post is Linked By: SANS Data Reduction;\n", "bbcode": "Reduced SANS Data\n\n[data]2241[/data]\n\n"}, "datestamp": "2010-09-23T11:36:16+01:00", "internal-links": [], "id": "13350"}, {"author": null, "timestamp": "2010-09-23T11:42:45+01:00", "section": "Procedure", "title": "SANS Data Reduction", "content": {"html": "Procedure: Data_reduction
\nReduced data for the contrast series of Glur0 in DM micelles from D2O to H2O. Samples are 100% D2O, 80% D2O, 42% D2O, 20% D2O, and H2O in that order.

SANS RunSANS TransBgd RunBgd TransReduced data
33453329334133303345 - reduced SANS data
33933346339433473393 - reduced SANS data
33973353339233543397 - reduced SANS data
33953355339633563395 - reduced SANS data
33393328334233313339 - reduced SANS data


Contrast series graph


Initial graph. The later runs show some aggregation based on the other examples so should possibly look to compare those and see which parts of the curve are reliable compared to others.a
\n", "bbcode": "Reduced data for the contrast series of Glur0 in DM micelles from D2O to H2O. Samples are 100% D2O, 80% D2O, 42% D2O, 20% D2O, and H2O in that order.\n\n[table][row]SANS Run[col]SANS Trans[col]Bgd Run[col]Bgd Trans[col]Reduced data[col][/row]\n[row]3345[col]3329[col]3341[col]3330[col][blog]13346[/blog][col][/row]\n[row]3393[col]3346[col]3394[col]3347[col][blog]13347[/blog][col][/row]\n[row]3397[col]3353[col]3392[col]3354[col][blog]13348[/blog][col][/row]\n[row]3395[col]3355[col]3396[col]3356[col][blog]13349[/blog][col][/row]\n[row]3339[col]3328[col]3342[col]3331[col][blog]13350[/blog][col][/row]\n[/table]\n\n[data]2243[/data]\n\nInitial graph. The later runs show some aggregation based on the other examples so should possibly look to compare those and see which parts of the curve are reliable compared to others.a"}, "datestamp": "2010-09-23T11:36:17+01:00", "internal-links": ["13346", "13347", "13348", "13349", "13350"], "id": "13351"}, {"author": null, "timestamp": "2010-10-01T08:57:28+01:00", "section": "Data", "title": "uuluruwnbupbpchmwjht, online radio, FQGLFQT, [url=http://literadio.net/]radio online[/url], zlVcoey, http://literadio.net/ radio online, azcNVgO.", "content": {"html": "Material: online_radio
\nuuluruwnbupbpchmwjht, online radio, FQGLFQT, radio online, zlVcoey, http://literadio.net/ radio online, azcNVgO.
\n", "bbcode": "uuluruwnbupbpchmwjht, online radio, FQGLFQT, [url=http://literadio.net/]radio online[/url], zlVcoey, http://literadio.net/ radio online, azcNVgO."}, "datestamp": "2010-03-10T18:15:38+00:00", "internal-links": [], "id": "12160"}] \ No newline at end of file