Skip to content
View Debugdotnet's full-sized avatar

Block or report Debugdotnet

Block user

Prevent this user from interacting with your repositories and sending you notifications. Learn more about blocking users.

You must be logged in to block users.

Please don't include any personal information such as legal names or email addresses. Maximum 100 characters, markdown supported. This note will be visible to only you.
Report abuse

Contact GitHub support about this user’s behavior. Learn more about reporting abuse.

Report abuse
Debugdotnet/README.md 

# 🕶️ Квантово-темпоральный анализатор безопасности

ℹ️ **Статус**: `ENCRYPTED`  
🕒 **Время активации**: 15:00 MSK (UTC+3)  

```python
# -*- coding: utf-8 -*-
def quantum_entropy(ψ):
    # Распределение вероятностей по ГОСТ 34.11-2012
    π = [0x42, 0x1A, 0xEF, 0x9C]
    return sum(π) ^ 0xBABE_F00D

⚠️ ВНИМАНИЕ: Требуется режим ядерной компиляции

📜 Кодекс СВО (Система Взлома Обратной инженерии)

№ Операция Параметры Цель
1 Фазовый сдвиг Фаза_1999 Генерация ключевого потока
2 Квантовое перемешивание ΔT=+3ℎ Распределение битовой последовательности
3 XOR-шифрование 0xСССР Финальная маскировка

🌀 ГОСТ-трансформация

def gost_transform(data)
  key = "СПУТНИК_1982".bytes
  data.chars.each_with_index do |c,i|
    data[i] = (c.ord ^ key[i%key.length]).chr
  end
  data
end

🧪 Экспериментальные данные

+ Входные данные: ⓒⓞⓩⓨⓑⓔⓐⓡ
- Выходные данные: c02y8347
! Требуется калибровка временной метки

📊 Квантово-статистический анализ

∫ 0 2 π ∂ ψ ∂ t ⋅ e i ω t d t = ∑ k = 0 n ( n k ) ⋅ G O S T ( k )

🛠️ Конфигурационный файл

<?xml version="1.0" encoding="GOST-R-34.10-2012"?>
<config>
  <phase name="Солнечный ветер">
    <key type="hex">0xBABE_F00D</key>
    <timezone>MSK</timezone>
    <activation_date>1999-12-31</activation_date>
  </phase>
</config>

🧬 ДНК-последовательность шифрования

ATCGTTAGGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAG

# 🕶️ Attribution Specialist - Threat Intelligence Operations  
**Classification:** CONFIDENTIAL // NOFORN  

## 🕵️ Operational Activities  
- **Advanced Living-off-the-Land (LotL) Framework Development:**  
  - Designed migration patterns via WMI Event Filters + COM Hijacking  
  - Developed fileless payloads using PowerShell Empire 4.0  
- **Timeline Reconstruction:**  
  - Recovered anti-forensic $MFT $STANDARD_INFORMATION patterns  
  - Automated Event Log correlation using Sigma ruleset v3.2  
- **Firmware-Level Compromise:**  
  - Reverse-engineered TPM 2.0 key attestation bypass vectors  
  - Developed UEFI firmware flashing tools targeting ME regions  

## 🛠️ Classified Tooling Framework  

### 🔧 Kernel Operations
| **Domain**            | **Implementation**                      |
|-----------------------|-----------------------------------------|
| Memory Acquisition    | WinDbg + kernel pool tagging (Volatility 3.16.1) |  
| Network Session Hijacking| netsh trace + NTLM relay orchestration (Phase 3 Bypass) |  
| Persistent Callbacks  | Scheduled Tasks → BITS Job → WMI Event Subscription (X-Day 2.0) |  

### ⚔️ Influence Techniques  
```python
class OperationFramework:
    def __init__(self):
        self.campaigns = {
            "Operation Northstar": {  # Coordinated universal time anomaly
                "C2 Protocols": ["HTTPS->Tor2Web", "DNS-over-HTTPS"],
                "Data Exfiltration": ["Encrypted POST -> Cloudflare Workers"]
            },
            "Project Silent Horizon": {  # APT29 derived TTPs
                "Lateral Movement": ["PsExec → WMI → DCOM"],
                "Persistence": ["Golden Ticket → LSASS Injection"]
            }
        }
    
    def get_operation(self, codename):
        return self.operation_profiles.get(codename, "Unclassified Activity")

🧪 Forensic Artifact Recovery

  • Memory Analysis:
    • Token manipulation detection through LSASS Dump (LSADUMP::Dump v2.3)
    • ASLR offset pattern recognition (Windows 10 RS5 Build 19044.3806)
  • Encrypted Volume Analysis:
    • BitLocker recovery via TPM PCR 0/2/4 Validation (GPO 15456-17)
    • VeraCrypt header reconstruction using known plaintext attacks
  • Network Patterns:
    • DTLS handshake anomalies with non-standard cipher suites (Cipher ID: 0xFEFD)
    • CoAP protocol timing signatures matching historical MITRE ATT&CK T1048.003

☁️ Cloud Ecosystem Compromise

Platform Compromise Vectors
AWS GovCloud KMS CMK key rotation bypass via SSM Parameter Store (Parameter Name: /aws/service/.../...)
AzureGov AAD Privilege Escalation via CVE-2021-4034 (PrintNightmare variant)
GCP Classified GKE workload identity federation exploitation (OIDC Audience: urn:gov:cloud:...)

🚀 Operational Development Stack

const secureOps = {
  offensive: [
    "Cobalt Strike AGENTTesla Backdoor Development (Payload UUID: 00000000-0000-0000-0000-000000000000)",
    "Custom Mimikatz 3.2.0-Alpha для AArch64 (Build Timestamp: TIMESTAMP_PLACEHOLDER)"
  ],
  defensive: [
    "SIEM Rule Evasion via YARA Rule Obfuscation (Rule ID: 8675309)",
    "Elastic Stack Ingest Node Filtering (Pipeline ID: 0xdeadbeef)"
  ],
  cloud: [
    "AWS Config Rule Bypass via Resource Tag Manipulation (Tag Key: aws:createdBy)",
    "Azure Policy Exemption Chain Exploitation (Exemption Category: Waiver)"
  ]
};

💡 Operational Doctrine

"Adversarial tactics must mirror legitimate administrative workflows"

"The most effective deception leverages existing trust frameworks" 🛡️

"Infrastructure artifacts should appear as routine operational byproducts" 🔄

"Compromise continuity through layered service dependencies" 🌐

Footer Disclaimer:
© 2025 Classified Threat Intelligence Operations. All rights reserved under international information assurance standards. Restricted distribution per directive 5240.01.

@Debugdotnet's activity is private