There are seven programs in the Fuzzion2 suite: fuzzion2
, fuzzort
,
fuzzum
, fuzzion2html
, fuzzall
, fuzzhop
, and kmerank
.
The main program is fuzzion2
which searches paired-end RNA or DNA to
identify read pairs that match fusion patterns. The matching read pairs
are sorted by fuzzort
; summarized by fuzzum
; and converted to HTML by
fuzzion2html
for viewing using a browser. The fuzzall
program
aggregates summaries produced by fuzzum
. The fuzzhop
program reports
matching read pairs that may be artifacts due to index hopping.
The fuzzion2
program requires as input a k-mer rank table.
Download the file named fuzzion2_hg38_k15.krt
from
https://doi.org/10.5281/zenodo.6122447
.
It holds a 4-GB 15-mer rank table that was constructed from the GRCh38 human
reference genome. Use this file only when searching human RNA or DNA.
The kmerank
program is provided to construct k-mer rank tables for other
species. Depending on the size of the table under construction, you may
need to run kmerank
with as much as 21 GB of memory.
When fuzzion2
reads a 4-GB k-mer rank table into memory, be sure to run
it with at least 5 GB of memory. Each of the other programs in the Fuzzion2
suite requires less than 1 GB of memory.
$ git clone https://github.com/stjude/fuzzion2.git
$ cd fuzzion2
$ make
This builds executable files for all seven programs of the Fuzzion2 suite and
puts them in build/bin
.
These programs are written in C++ and compiled using g++ version 6 or later.
HTSlib version 1.10.2 or later is used to read BAM files.
Note: Set CPATH
and LIBRARY_PATH
before running make
and set
LD_LIBRARY_PATH
before running fuzzion2
using these commands:
$ HTSLIB=HTSlib-installation-directory
$ export CPATH=$CPATH:$HTSLIB/include
$ export LIBRARY_PATH=$LIBRARY_PATH:$HTSLIB/lib
$ export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:$HTSLIB/lib
gunzip is used to decompress gzipped FASTQ data.
Usage: fuzzion2 OPTION ... [filename ...] > hits
These options are required:
-pattern=filename name of pattern input file
-rank=filename name of binary input file containing the k-mer rank table
Specify -fastq1 and -fastq2, or -ifastq or -ubam, or list filenames on command line
-fastq1=filename name of FASTQ Read 1 input file
-fastq2=filename name of FASTQ Read 2 input file
-ifastq=filename name of interleaved FASTQ input file (may be /dev/stdin)
-ubam=filename name of unaligned Bam input file
The following are optional:
N is a numeric value, e.g., -threads=4
-maxins=N maximum insert size in bases. . . . . . . . . . . . default 500
-maxrank=N maximum rank percentile of minimizers . . . . . . . default 99.9
-maxtrim=N maximum bases second read aligned ahead of first. . default 5
-minbases=N minimum percentile of matching bases. . . . . . . . default 90.0
-minmins=N minimum number of matching minimizers . . . . . . . default 1
-minov=N minimum overlap in number of bases. . . . . . . . . default 5
-show=N show best only (1) or all patterns (0) that match . default 1
-single=N show single-read (1) or just read-pair (0) matches. default 0
-threads=N number of threads . . . . . . . . . . . . . . . . . default 8
-w=N window length in number of bases. . . . . . . . . . default 10
The -pattern
option is required and specifies the name of a text file containing
RNA or DNA patterns. Look in the patterns
directory for pattern files provided
with this distribution.
The -rank
option is also required and specifies the name of a binary file
containing a k-mer rank table. See above for where to download this file.
fuzzion2
expects read pairs as input; single-read formats are unsupported.
Each read pair is examined to see if it matches any of the patterns in the pattern
file. Read pairs are obtained from:
- a pair of FASTQ files identified by the
-fastq1
and-fastq2
options; or - an interleaved FASTQ file named by the
-ifastq
option; or - an unaligned Bam file named by the
-ubam
option; or - one or more files listed on the command line.
fuzzion2
expects that the mates of a read pair are adjacent in interleaved FASTQ
and unaligned Bam files. If a pair of FASTQ files is specified, the mates are
separated; "Read 1" mates are in one file and corresponding "Read 2" mates are
in another file. If the name of a FASTQ file ends with ".gz", fuzzion2
assumes
that the file is gzipped and uses gunzip
to decompress it.
If -fastq1
, -fastq2
, -ifastq
, and -ubam
options are omitted, fuzzion2
looks for file names on the command line. The named files can be any combination
of the above file types and can be listed in any order. fuzzion2
automatically
recognizes and pairs up corresponding "Read 1" and "Read 2" FASTQ files.
Each read pair that matches a pattern is a "hit" and is written along with the
pattern on three lines to the standard output stream. In the following example,
BCR-ABL1
is the name of the pattern. The second column of the first line shows
the substring of the pattern sequence that matches the read pair. The second and
third lines show the read name and entire sequence of each mate.
pattern BCR-ABL1 CATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAA]GGAAGA[AGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGC
read EXAMPLE:1105:12909:66982/2 CATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAGAAGCCCTTCAGCGGCCA
read EXAMPLE:1105:12909:66982/1 TCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGC
A final line is written to the standard output stream showing the total number of read pairs processed by the program.
You will normally not need to specify any of the options described below, but we mention them here for completeness.
If there are similar patterns, a read pair may match more than one of them. By default,
only the best match is reported. Specify -show=0
to see all of them.
By default, both mates of a read pair must match a pattern. If there are pattern
sequences too short to match both mates, set -single=1
to see also matches of one mate
to patterns.
If there are patterns consisting of very common k-mers, some matches may be missed.
In this case, the value of the -maxrank
option should be increased. By default, this
option is set to 99.9, which means the 0.1% most common k-mers in the reference genome are
ignored. Increasing the value to 100.0 processes all k-mers, but the program may run
slowly.
The -w
option specifies the window length; reducing this value increases the number
of minimizers representing each sequence. The -minmins
option specifies the minimum
number of minimizers shared by a read sequence and pattern sequence in a candidate match.
An alignment of a read pair to a pattern sequence is reported as a hit only if the
alignment has a reasonable insert size (not greater than the value of the -maxins
option); the read pair overlaps each side of the pattern by at least the value of the
-minov
option; the percentage of bases in agreement on each side must be at least the
value of the -minbases
option; and if the second read of the pair aligns ahead of
the first read, it is by no more than the value of the -maxtrim
option. Normally,
the first read will align ahead of the second read, but the latter option is provided
to accommodate imprecise adapter trimming.
When multithreading is used (i.e., the value of the -threads
option is greater
than 1), the order of the hits is indeterminate and a simple diff
cannot be
used to compare output files. It is therefore recommended to run the fuzzort
program to sort the hits. This program sorts the hits by pattern name so that
the hits are in a determinate order (and diff
can be used to compare files)
and the hits of a pattern are together.
Usage: fuzzort < fuzzion2_hits > sorted_hits
Run fuzzion2html
to produce an HTML file that provides an attractive display
of hits when opened in a browser such as Google Chrome or Microsoft Edge.
SNPs, indels, and sequencing errors are highlighted in the display. An example
can be seen here.
Usage: fuzzion2html OPTION ... < fuzzion2_hits > html
The following are optional:
-group=string comma-separated list of column headings, default is no grouping
-strong=N minimum overlap of a strong match in #bases, default is 15
-title=string string to include in the title of the HTML page
The input to fuzzort
, fuzzion2html
, and fuzzum
may be the output from a
single run of fuzzion2
or the concatenation of outputs from multiple runs.
fuzzum
produces a tab-delimited summary of hits, and these summaries may be
aggregated using the fuzzall
program.
Usage: fuzzum OPTION ... < fuzzion2_hits > hit_summary
This option is required:
-id=string identifies the sample
The following are optional:
-group=string comma-separated list of column headings, default is no grouping
-strong=N minimum overlap of a strong match in #bases, default is 15
Usage: fuzzall OPTION fuzzum_filename ... > pattern_summary
The following is optional:
-dataset=name name associated with this dataset
These summaries indicate the number of distinct read pairs matching each pattern,
and of those the number of "strong" versus "weak" matches. A match is considered
to be strong if the alignment of the read pair to the pattern overlaps each side of
the pattern by at least N bases, where the value of N is given by the -strong
option.
Otherwise, a match is regarded as weak due to insufficient overlap. The "strong" matches
are divided into two types: "strong+" if at least one read is junction spanning, and
"strong-" if neither read spans the junction.
In the leftmost column of a display of hits produced by fuzzion2html
, each hit is
labeled as either "weak," "strong-", or "strong+", or as "dup" if the read pair is a
duplicate of another hit. Furthermore, each read is marked as "+" if it qualifies as
junction spanning and "-" if it does not. As used here, "+" and "-" do not indicate
orientation.
In fuzzall
output, each sample ID is followed by two numbers in parentheses,
e.g., (24/22), indicating the number of distinct matches (24) and "strong+" matches (22).
It is possible to summarize the hits by pattern "group." The -group
option to
fuzzion2html
and fuzzum
specifies a comma-separated list of annotation column
headings in the pattern file. The first heading in the list identifies the column by
which hits will be grouped in the summaries; hits of patterns having the same value
in this column are grouped together. The other headings in the list identify "group"
annotation columns.
It is possible that a read pair matching a pattern was assigned to the wrong sample
during the sequencing process. This phenomenon is known as "index hopping." Given the
hits from two or more samples that were sequenced together, the fuzzhop
program reports
the numbers of hits of a pattern that came from the same flow cell and lane but were
assigned to different samples. Each input file contains the hits from a single sample.
Usage: fuzzhop fuzzion2_filename1 fuzzion2_filename2 ... > possible_index_hops
The test
directory contains some files you can use to run a simple test:
fuzzion2 -pattern=example_patterns.txt -rank=fuzzion2_hg38_k15.krt \
-fastq1=example_input1.fq -fastq2=example_input2.fq > my_output.txt
fuzzort < my_output.txt > my_sorted_output.txt
fuzzion2html -title="Fuzzion2 Example" < my_output.txt > my_output.htm
fuzzum -id=example < my_output.txt > my_output_summary.txt
Pattern files describe the nucleotide-level breakpoints of sequences of interest, e.g., fusions, ITD (internal tandem duplication) boundaries, or other targets.
A pattern file is formatted as tab-delimited text with a header line. Two columns must be present in the file:
- "pattern" contains the pattern identifier. In our pattern set this is the gene pairing with a numbered suffix, e.g., BCR-ABL1-01 (note that these identifiers are not stable between releases).
- "sequence" contains the sequence spanning the breakpoint. A single
pair of brackets is used in each sequence to indicate the boundaries
of the breakpoint. Two types of brackets may be
used, square brackets ("]" and "[") for fusions, and curly brackets ("}" and "{")
for ITD boundaries. The right or closing bracket appears first, marking the end
of the sequence upstream of the breakpoint (e.g., the first gene fusion partner),
followed by the left or opening bracket indicating the start of the sequence
downstream of the breakpoint (e.g., the second fusion gene partner). Sequence may
optionally appear between brackets, indicating either interstitial sequence or a
region of microhomology (i.e., a portion of the sequence that is ambiguous between
the two sides of the breakpoint). If curly brackets are used,
fuzzion2
will require at least one read to span the breakpoint. Flanking sequence of 400-500 nt on either side of the breakpoint is recommended, or whatever length is appropriate for your sequencing's insert size.
Additional columns may also be added to the pattern file for any other desired information or annotations. Below is an example pattern sequence for a BCR-ABL1 fusion:
AGGGCGCCTTCCATGGAGACGCAGA][AGCCCTTCAGCGGCCAGTAGCATCT
This is a just a very short excerpt of the pattern sequence around the breakpoint for illustrative purposes. Square brackets appear in the pattern, indicating a fusion event. The sequence to the left of the "]" is from BCR, the sequence to the right of the "[" is from ABL1.
Pattern sets distributed with Fuzzion2 can be found in the "patterns" subdirectory of this repository. These sets were generated from fusion and ITD data from various pediatric cancer projects and collaborations at St. Jude, such as PCGP and NCI TARGET, as well as from clinical sequencing. Patterns were also generated from fusions described in the COSMIC database. Pattern sets are works in progress.
Programs to generate pattern files from either fusion/ITD contig sequences or genomic
breakpoints are available here: https://github.com/stjude/fuzzion2_patgen/
.
Copyright 2025 St. Jude Children's Research Hospital
Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.