A DNA-RNA-Protein translator mini-library in Typescript checkout the docs! or go straight to the npm repository and give it a test! https://www.npmjs.com/package/drptranslator
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
src
.gitattributes
.gitignore
.travis.yml
LICENSE
README.md
fuse.js
package-lock.json
package.json
tsconfig.json
tslint.json

README.md

Build Status

NOTICE

  • Since version 1.2.0 This library requires you to use node 6+

Hello everyone!

Welcome to DNA-RNA-Protein Translator or if you may drptranslator I have a very bad problem of naming but don't let that stop you!

DRPTranslator is a small library written in typescript, this is intended for a really low entry level of genetics, nothing really advanced since I'm not a genetist after all. However if you want this to help someone at school this can suit you well :)

At the moment these are some of the usages of the principal uses:

  • Translate a DNA sequence into a RNA sequence
  • Obtain the complementary DNA sequence from another DNA sequence
  • Translate directly from DNA to an Aminoacid sequence
  • Translate RNA to an Aminoacid sequence
  • Find starts and stops codons in a sequence

and some other cool stuff like a obtaining a codon array or find the first and last start and stop sequence.

Install

how can you consume this library? this is intended to be used in a nodejs environment so you can install it as a dependency

npm install --save drptranslator

Usage

Tou can Test it Here Javascript

const { RNATranslator, DNATranslator } = require("drptranslator");

const rTranslator = new RNATranslator();
const dTranslator = new DNATranslator();
const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");

console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
// "Met-Val-Cys"
// "Tyr-Gln-Thr"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
// "GGCTAGCTAGCGCTAGCTAGAACGAGT"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"

Typescript

import { RNATranslator, DNATranslator }  from "drptranslator";

const rTranslator = new RNATranslator();
const dTranslator = new DNATranslator();
const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");

console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
// "Met-Val-Cys"
// "Tyr-Gln-Thr"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
// "GGCTAGCTAGCGCTAGCTAGAACGAGT"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"

What's next?

  • Document source files
  • Creating a website for its API docs
  • Publish a demo of an app using the library
  • Adding more cappabilities

Suggestions

If you have an idea or you want to help to make this something bigger, raise an issue :) I'm glad to check out your ideas!