Skip to content
Permalink
Branch: master
Find file Copy path
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
295 lines (260 sloc) 52.7 KB
<beast version='2.0'
namespace='import beast.math.distributions.Prior:beast.util.TreeParser:beast.phylodynamics.epidemiology:master.beast:beast.core:beast.evolution.tree.coalescent:beast.core.util:beast.evolution.nuc:beast.evolution.operators:beast.evolution.sitemodel:beast.evolution.substitutionmodel:beast.evolution.likelihood:beast.core.parameter:beast.phylodynamics.epidemiology:beast.evolution.tree:beast.evolution.alignment'>
<data spec="beast.evolution.alignment.Alignment" id="HIV1_CL1" dataType="nucleotide">
<sequence id="seq_seq_00-100724" taxon="00-100724" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAGCTAAAGGAAGCTCTCTTAGACACAGGAGCAGATAATACAGTATTAGAAGAAATAGATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTGAGACAGTATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAGCTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAACTGGAACAGGAGGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAAACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTATTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAACCTTTCAGAAAACAAAATCCAGACATAGTGATCTGTCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAGAACATCTGTGGAAGTGGGGATTTTACACACCAGACA"/>
<sequence id="seq_seq_00-101582" taxon="00-101582" totalcount="4" value="CCTCAAATCACTCTTTGGCAGCGACCCATAGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCCCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAATTTGCAGGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGGCAGTATGATCAGGTACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAATATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAACCTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAGAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTGGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAGTATTCGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTCCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTACATGAAGACTTCAGAAAATATACTGCATTTACTATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTGCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTGATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAAAACATCTGCTGGCGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_00-102130" taxon="00-102130" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGGATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGGATTGGAGGTTTTATCAAAGTAAGACAGTATGAGCAGGTATCCATAGATATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATTTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGTATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCAGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAAATATAGTGATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGGAACTGAGAGAACATTTGTTGAGGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_00-107666" taxon="00-107666" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAGCTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAATTTGCCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAAACAGTATGATCAGGTACCCATAGAAATCTGTGGTCATAAAGTTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATTTGTTGACTCAGCTTGGCTGCACTCTAAATTTTCCCATTAGTCCTATTGAAACTGTGCCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTTAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTGCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGACGCATACTTTTCAGTTCCCTTAGATCCAGACTTTAGAAAGTATACTGCATTCACCATACCTAGTGTAAACAATGAGACACCAGGGATTAGATATCAGTATAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCGATATTCCAAAGTAGCATGACAAAAATCTTAGATCCTTTTAGAAAACAAAACCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAGAACATCTGTTAAAGTGGGGATTTACCACCCCAGACA"/>
<sequence id="seq_seq_00-107921" taxon="00-107921" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTTTATTAGATACAGGAGCAGATGACACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATCTGTGGACAGAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGTACTTTAAATTTTCCCATTAGTCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATCTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTCCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGAATTAGATATCAATATAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTTCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTGATTTATCAGTACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGGAACTGAGACAACATTTGTTGAAGTGGGGGTTTACCACACCAGACA"/>
<sequence id="seq_seq_00-109324" taxon="00-109324" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAGTAAAGATAGGGGGACAGCTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGGATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATCTGTGGACATAAGGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGGTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAGGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTCCAATTAGGAATACCACATCCTGCAGGATTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAGCTAGCATGACAAAGATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGACTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGGTTTACCACACCAGACA"/>
<sequence id="seq_seq_00-110776" taxon="00-110776" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAGAGTAGGGGGGCAATTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTACCAGGAAGGTGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTCATAGAAATCTGTGGAAAGAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATCAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAACCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAGAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAATTCCCTTAGATGAAAACTTCAGAAAGTATACTGCATTTACCATACCCAGTAGAAACAATGAGACACCAGGGATTAGATATCAATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAGAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGACTTACAACACCAGACA"/>
<sequence id="seq_seq_00-112762" taxon="00-112762" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGTGTTTGCCGGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATCTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTGAATAAAAGAACCCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGCTAAAAAAGAAAAAATCAGTAACAGTGCTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTCACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTGCCACAAGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATGGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAGCAAAAATAGAGGACCTGAGACAACATCTGTTGAAATGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_00-117504" taxon="00-117504" totalcount="4" value="CCTCAAATCACTCTTTGGCAGCGACCCATAGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAATTTGCAGGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGGCAGTATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAGAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATGGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAGTATTCGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTCCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTACATGAAGACTTCAGAAAATATACTGCATTTACTATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAATACAATGTGCTGCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGAAATAGTGATCTATCAATACATGGATGATTTATATGTAGGATCTGACTTAGAAATAGAGCAGCATAGAACAAAAATAGAGGAACTGAGAAAACATCTGCTGGCGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_00-119577" taxon="00-119577" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAAGTAGGGGGGCAACTAAAGGAAGCTCTATTGGATACAGGAGCAGATGATACAGTATTAGAAGAAATGCATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGGCAATATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATCTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTGGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTCACCATACCTAGTACAAACAATGAGACACCAGGGATTAGGTATCAGTACAATGTACTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_00-122753" taxon="00-122753" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTCTAAATTTTCCCATTAGTCCTATCGAAACTGTACCAGTGAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAGAAGGAAGGAAAAATTTCAAAGATAGGGCCTGAAAATCCCTACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCCGCAGGGTTAGAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGCAGACTTTAGAAAGTATACTGCATTTACCATACCTAGTATAAATAATGAGACACCAGGGGTTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGATCCTTTTAGGAAACAAAATCCAGACATAGTGATCTGTCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGACAGCATAGAACAAAAATAGAGGAATTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_00-122859" taxon="00-122859" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGTTCTATTGGATACAGGAGCAGATGATACAGTATTAGAAGACATGCATTTGCCAGGAAAATGGAAACCAAAAATAATAGGGGGGATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGGTACCCATAGAAATCTGCGGACATAAAGTTATAAGTACAGTATTAGTAGGACCTACACCTGTCAACGTAGTTGGAAGAAATTTGATGACTCAGCTTGGGTGCACTTTAAATTTTCCCATTAGTCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAGAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATATGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGAACAGTACTAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAGGACTTCTGGGAAGTTCAGTTAGGAATACCACATCTTCCAGGGTTAAAAAAGAAAAGATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATGGTGATCTATCAATACGTGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGGAACTGAGAGAACATTTGTTGAGGTGGGGATTTTTCACACCAGACC"/>
<sequence id="seq_seq_01-106570" taxon="01-106570" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAGCTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGGATTGGAGGTTTTATCAAAGTGAGACAGTATGATCAAATAGCCATAGAAATCTGCGGACATAAAGCTATAGGTACGGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACCCAGATTGGCTGCACTTTAAATTTTCCTATTAGTCCTATTGATACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGGGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGCTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTTACCATACCTAGTACAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAAAGTAGCATGACAAGAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTGATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGGAACTGAGAGAACATTTGTTGAGGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_01-107531" taxon="01-107531" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTAGTAGAAGAAATGAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATTTGTGGGCATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAACTTGGTTGTACTTTAAATTTTCCCATCAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATCTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGGCGGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAGCTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAACAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTTACCATACCTAGTGTAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGGTGGAAAGGATCACCAGCAATATTCCAAAGTAGTATGACAAAAATCTTGGAGCCTTTTAGAAAACAAAATCCAGACATAGTCATCTATCAGTACATGGACGATTTGCTTGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_01-108782" taxon="01-108782" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGGTACACATAGAAATCTGCGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGACGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCCGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTCTCAGTTCCATTAGATAAAGAATTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTGATTTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGATAAAAATAGAGAAACTGAGACAACATTTGTTGAGGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_01-109134" taxon="01-109134" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAGCTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGGATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATTTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAACTTGGTTGYACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAGGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGGGAACTTAATAAGAAAACTCAAGACTTCTGGGAAGTGCAATTAGGAATACCACATCCYGCAGGATTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGAGTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGAATTAGATACCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCGATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGAGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_01-110099" taxon="01-110099" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGAGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACCCATAGAAATCTGTGGACATAAAGcTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCGGTAAAATTAAAGCCAGGAATGGACGGCCCAAAAGTTAAACAATGGCCGTTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAGTATTTGCCATAAAGAAGAAAAACAGTACTAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAACGTGCTTCCAATGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACGTGGATGATTTGTATGTAGGATCTGATTTAGAAATGGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGATTCATCACACCAGATG"/>
<sequence id="seq_seq_01-110749" taxon="01-110749" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAGACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTTAGACAGTATGATCAGATACCTATAGAAATCTGTGGACATAAAACTATAGGTACAGTGTTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGATGACTAAGATTGGTTGCACTTTAAATTTCCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAATTGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTGTTTGCCATAAAGAAAAAAAACAGCACTAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAGGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAGAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACACAATCCAGACATAGTTATCTATCAATACATAGATGACTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAGTAGAGGAACTGAGACAATATCTGTGGAAGTGGGGATTTTACACACCAGACA"/>
<sequence id="seq_seq_01-110908" taxon="01-110908" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGGGGGGAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATAAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGGTACCAATAGAAATCTGCGGGCATAAAGCTGTAGGTACAGTTTTAGTAGGACCCACACCTGTCAACATAATTGGAAGAAATTTGATGACTCAGATTGGCTGTACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGAACAGTACTAGATGGAGAAAAGTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAATTCAATTAGGAATACCACATCCTGCAGGGTTAGAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTCTCAATTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTACGAACAATGAGACACCAGGGATTAGGTATCAGTATAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACGTGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGACAGCATAGAACAAAAGTAGAGGAACTGAGACAACATCTGATGAAGTGGGGACTTACCACACCAGACC"/>
<sequence id="seq_seq_01-118020" taxon="01-118020" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAGTAAAAATAGGGGGGCAACTAAAAGAAGCTCTACTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTCTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAGCTAAAGCCAGGAATGGACGGCCCAAAAGTTAAACAGTGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTGGTAGATTTCAGAGAACTTAATAAAAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACACCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTCCTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTGGATAAAGAATTCAGAAAGTATACTGCATTTACCATACCTAGTATCAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAATGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGACAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGATGGGGATTCACCACACCAGATA"/>
<sequence id="seq_seq_01-119287" taxon="01-119287" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGTTCTATTGGATACAGGAGCAGATGATACAGTATTAGAAGACATGCATTTGCCAGGAAAATGGAAACCAAAAATAATAGGGGGGATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGGTACCCATAGAAATCTGCGGACATAAAGTTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACGTAGTTGGAAGAAATTTGATGACTCAGCTTGGGTGCACTTTAAATTTTCCCATTAGTCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAGAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATATGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGAACAGTACTAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAGGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCTTCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTGATCTATCAATACGTGGATGATCTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGGAACTGAGAGAACATTTGTTGAGGTGGGGATTTTTCACACCAGACC"/>
<sequence id="seq_seq_01-123798" taxon="01-123798" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTTGTCACAATAAAGATAGGGGGGCAACTAAAGGAGGCTCTATTAGATACAGGGGCAGATGATACAGTATTAGAAGACATGAATTTGCCAGGAAGATGGAAGCCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATCTGTGGGCATAAAGCTATAGGTACAGTGTTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAACCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTGGAAATTTGTACAGAATTGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAAAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCTCTAGATCCAGACTTTAGAAAGTATACTGCATTTACAATACCTAGTATAAACAATGAGAAACCAGGAATTAGATATCAGTACAATGTGCTCCCACAGGGATGGAAGGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATGGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAAGAACTGAGACAACATCTGTGGAAGTGGGGATTTTACACTCCAGACA"/>
<sequence id="seq_seq_01-124664" taxon="01-124664" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAGTAAAAATAGGGGGGCAACTAAAAGAAGCTCTACTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCCGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTCTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAGTTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAGTGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTGGTAGATTTCAGAGAGCTTAATAAAAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACACCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTCCTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTGGATAAAGAATTTAGAAAGTATACTGCATTTACCATACCTAGTATCAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTTCAATGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGACAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGATGGGGATTCACCACACCAGATA"/>
<sequence id="seq_seq_01-125031" taxon="01-125031" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAAGTAGGGGGGCAACTAAAGGAAGCTCTATTGGATACAGGAGCAGATGATACAGTATTAGAAGAAATGCATTTGCCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGATTTATCAAAGTAAGGCAATATGATCAGATACTCATAGAAATTTGTGGACATAAAGCTATAGGTACAGTATTATTAGGACCTACACCTGTCAACATAATTGGAAGAAATTTGCTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATCTCAAAAATTGGGCCTGAAAATCCATACAATACTCCGATATTTGCCATAAAGAAAAAAGACAGTTCTAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGGACTCAAGACTTCTGGGAAGTTCAATTGGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTATATGAAGACTTCAGAAAGTATACTGCATTCACCATACCTAGTACAAACAATGAGACACCAGGGATTAGGTATCAGTACAATGTACTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATATAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGAAATAGTTATCTATCAATACGTGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGACAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_01-125265" taxon="01-125265" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAGTAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAACTTGCCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGCGGTTTTATCAAAGTGAGACAGTATGATCAAATACCCATAGAAATCTGCGGACATAAAGTCATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGCTGCACTTTAAATTTCCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAATTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACCAAATGGAGAAAATTAGTAGATTTCAGAGAACTGAATAAGAGAACCCAAGACTTTTGGGAAGTTCAATTAGGAATACCACACCCTGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTACAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGATCCTTTTAGAAAACAAAATCCAGACATAGTTATCTACCAATACGTGGATGATTTGTATGTAGGATCTGACTTAGAAATAGAACAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGGGATGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_01-127162" taxon="01-127162" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAGACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTTAGACAGTATGATCAGATACCTATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTCCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGCACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAGGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAGAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACACAATCCAGACATAGTCATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGACAGCATAGAACAAAAGTAGAGGAACTGAGACAACATCTGTTGGGGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_01-127232" taxon="01-127232" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAGGGTAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAACCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAGACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATCTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTCCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTACAAACAATGAGACACCAGGAATTAGATATCAATACAATGTGCTTCCACAGGGGTGGAAAGGATCACCAGCAATATTTCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTGATTTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGGAACTGAGACAACATTTGTTGAGGTGGGGGCTCACCACACCAGACA"/>
<sequence id="seq_seq_01-129841" taxon="01-129841" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAGAGTAGGGGGGCAATTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTACCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTCATAGAAATCTGTGGAAAGAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAACCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAAACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAGAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGACTTACAACACCAGACA"/>
<sequence id="seq_seq_02-101818" taxon="02-101818" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATTTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAACTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAGTTAAAACCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAACTAGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAGTTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGCTAGGAATACCACACCCCTCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTCTCAGTTCCCTTATATGAAGACTTCAGAAAATATACTGCATTTACTATACCTAGTATAAACAATGAAACACCAGGGATTAGATATCAATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAACCTTTTAGGAAACAAAATCCAGAAATAGTGATTTATCAATACGTGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGGCAAAAATAGAGGAACTGAGACAACATCTGTTGGCATGGGGATTTGACACACCAGACA"/>
<sequence id="seq_seq_02-102389" taxon="02-102389" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAGCTAAAGGAAGCTCTCTTAGACACAGGAGCAGATAATACAGTATTAGAAGAAATAGATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTGAGACAGTATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACTCCTGTCAACATAATTGGAAGAGATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAAGCATTAGTAGAAATCTGTACAGAACTGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCTATAAAGAAAAAGAACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTATTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTACTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAACCTTTCAGAAAACAAAATCCAGACATAGTGATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAGAACATCTGTGGAAGTGGGGATTTTACACACCAGACA"/>
<sequence id="seq_seq_02-110459" taxon="02-110459" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGGGGGCAACTAAAGGAAGCTCTATTGGATACAGGAGCAGATGATACAGTATTAGAAGAAATGCATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGCTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATTTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACGTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATCACAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTAATAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTGGGAATACCACATCCTGCAGGGTTAAAAAAGAAAAAGTCAGTAACAGTACTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGGTATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCCTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGACTTGTATGTAGGATCTGACTTAGAAATAGGGAAGCATAGAACAAAAATAGAGGAACTGAGAGAACATCTGTTGAAGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_02-112982" taxon="02-112982" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAAATAGGGGGGCAACTAAAGGAAGCTCTATTGGATACAGGAGCAGATGATACAGTATTAGAAGAAATGCATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGGCAATATGATCAGATACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTGAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATCTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTGGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATACTTCTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTCACCATACCTAGTACAAACAATGAGACACCAGGGATTAGGTATCAGTACAATGTACTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCCTAGAGCCTTTTAGAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTATATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_02-118343" taxon="02-118343" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAGTAAAGATAGGGGGACAGCTAAAAGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGACCAGGTACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTGAAATTAAAGCCAGGAATGGATGGCCCAAGAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAGGTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAGGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAGGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGATTTCAGAAAGTATACTGCATTTACCATACCTAGCATAAACAATGAGACACCAGGGACTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGCAGCATGACAAAAATTTTAGAGCCTTTTAGAAAACAAAATCCAGACATGGTTATCTATCAATACGTGGATGATTTATATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAAGTGGGGATTTACTACACCAGACA"/>
<sequence id="seq_seq_02-119339" taxon="02-119339" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCATAGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAATTTGCAGGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGGCAGTATGATCAGGTACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAGAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTGGAAATTTGTACAGAATTGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAGTATTTGCCATAAAGAAAAAGAACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTCCAGTTAGGAATACCACATCCCGCAGGGTTAAAGAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGAAAATATACTGCATTTACTATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTGCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTGATCTATCAATACGTGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAAAACATCTGCTGGCGTGGGGATTTTACACACCAGACA"/>
<sequence id="seq_seq_02-119986" taxon="02-119986" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAGAGTAGGGGGGCAATTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTACCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTCATAGAAATCTGTGGAAAGAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAACCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGATAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAAACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAGAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGACTTACAACACCAGACA"/>
<sequence id="seq_seq_02-121738" taxon="02-121738" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGGAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACCCATAGAAATTTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAATGGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAAGTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCTCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAGGACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATCAGATATCAATACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAATAATCTTAGAGCCTTTTAGGAAACAAAATCCAGACATAGTTATCTATCAGTACGTGGATGATTTGTATGTAGGATCTGATTTGGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGATGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_02-125866" taxon="02-125866" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTTGTCACAATAAAGATAGGGGGGCAAATAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTAGTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCGTAGAAATCTGCGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGGTGTACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGGGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGGATACCACATCCCGCTGGATTAAAAAAGAAAAAATCAGTAACAGTACTAGATGTGGGTGATGCATACTTTTCAGTTCCCTTGTATGAAGACTTCAGAAAGTATACTGCATTTACAATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCGATATTCCAATGTAGCATGACAAAAATCTTAGATCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAGATAGAAGAACTGAGACAACATCTGTTGAGATGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_03-101340" taxon="03-101340" totalcount="4" value="CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGGTAGGGGGGCAACTAAAAGAAGCTCTATTAGATACAGGGGCAGATGATACAGTATTAGAAGACATGAATTTgCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATGAGGTACCCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAACTTGGTTGTACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAACCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTAACAGAAGAGAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAGATTTCAAAAATTGGACCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAAGTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCCCATCCCTCAGGGATAAAAAAGAACAAATCAGTAACAGTACTAGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGAGTTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAGTACGTGGATGATTTATATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTAAAGTGGGGATTTGACACACCAGACA"/>
<sequence id="seq_seq_03-106211" taxon="03-106211" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAAATAGGGGGGCAGCTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGAATTTGCCAGGGAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAAACAGTATGATCAGGTACCTATAGAAATCTGTGGTCATAAAGTTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGCTGCACTCTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTTAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTGCAGTTAGGAATACCACATCCCGCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATGTGGGTGACGCATACTTTTCAGTTCCCTTAGATCCAGACTTTAGAAAGTATACTGCATTCACCATACCTAGTGTAAACAACGAGACACCAGGGATTAGATATCAGTATAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCGATATTCCAAGCTAGCATGACAAAAATCTTAGATCCTTTTAGAAAACAAAACCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAAATCATCTGTTAAGGTGGGGATTTACCACCCCAGACA"/>
<sequence id="seq_seq_03122985br" taxon="03-122985br" totalcount="4" value="CCTCAAATCACTCTTTGGCAACGACCACTTGTCACAATAATTATAGGGGGGCAACAAAAGGAAGCCCTATTAGATACAGGGGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAAACAGTATGATCAGGTAACCATAGACATCTGCGGACATAAAGTTGTAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAACTTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTGAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATATGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATCAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAGCTTAATAAAAGAACTCAGGACTTCTGGGAAGTTCAATTAGGAATACCACATCCTGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCATTTACCATACCCAGTGTAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGGAAACAAAATCCAGACATGGTTATCTATCAGTACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAGAACATCTGTTGAAGTGGGGATTTACCACACCAGACA"/>
<sequence id="seq_seq_29422899" taxon="29422899" totalcount="4" value="CCTCAAATCACTCTTTGGCAGCGACCCCTCGTCACAATAAAGGTAGGGGGGCAACTAAAGGAAGCCCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGGATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAGCAGATAACCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGGAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGACGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAGTAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCGGTGTTTGCCATAAAGAAAAAAGATGGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAAAGGACTCAAGACTTCTGGGAGATTCAATTAGGAATACCCCATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTCCTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATCCAAACTTCAGAAAATATACTGCATTTACCATACCTAGTACAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTACTCCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGTAGCATGACAAAAATTTTGGAGCCTTTTAGAAAACAAAATCCAGAGATAATTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAGCAAAAATAGAGGAACTGAGGCAACATTTGTTGAAGTGGGGATTTACCACCCCAGACA"/>
</data>
<taxonset id="unknownTips1a" spec="beast.evolution.alignment.TaxonSet">
<taxon id="03-122985br" spec="beast.evolution.alignment.Taxon"/> <!-- 2003-->
</taxonset>
<taxonset id="unknownTips1b" spec="beast.evolution.alignment.TaxonSet">
<taxon id="29422899" spec="beast.evolution.alignment.Taxon"/> <!-- 2001-->
</taxonset>
<trait id="tipDates" spec='beast.evolution.tree.TraitSet' traitname='date-forward' units='year' value='
00-100724 = 2000.0329,
00-101582 = 2000.0575,
00-102130 = 2000.0658,
00-107666 = 2000.274,
00-107921 = 1999.9616,
00-109324 = 2000.3397,
00-110776 = 2000.3233,
00-112762 = 2000.3753,
00-117504 = 2000.5534,
00-119577 = 2000.5123,
00-122753 = 2000.7945,
00-122859 = 2000.8384,
01-106570 = 2001.1781,
01-107531 = 2001.2329,
01-108782 = 2001.2712,
01-109134 = 2001.3288,
01-110099 = 2001.3123,
01-110749 = 2001.3397,
01-110908 = 2001.3534,
01-118020 = 2001.5781,
01-119287 = 2001.6192,
01-123798 = 2001.7397,
01-124664 = 2001.8082,
01-125031 = 2001.8192,
01-125265 = 2001.8301,
01-127162 = 2001.8959,
01-127232 = 2001.8959,
01-129841 = 2001.9808,
02-101818 = 2002.0274,
02-102389 = 2002.0438,
02-110459 = 2002.2795,
02-112982 = 2002.326,
02-118343 = 2002.526,
02-119339 = 2002.5562,
02-119986 = 2002.5753,
02-121738 = 2002.6247,
02-125866 = 2002.7534,
03-101340 = 2003.0384,
03-106211 = 2003.1534,
03-122985br = 2003.5,
29422899 = 2001.5'>
<taxa spec='beast.evolution.alignment.TaxonSet' alignment='@HIV1_CL1'/>
</trait>
<siteModel gammaCategoryCount="4" id="SiteModel" proportionInvariant="@proportionInvariant" spec="SiteModel">
<parameter dimension="1" id="mutationRate" name="mutationRate" value="1.0"/>
<parameter dimension="1" id="gammaShape" name="shape" value="0.5" lower="0.0" upper="1000.0"/>
<substModel id="gtr" rateAC="@rateAC" rateGT="@rateGT" rateAT="@rateAT" rateCG="@rateCG" rateCT="@rateCT" spec="GTR">
<parameter dimension="1" id="rateAG" lower="0.0" name="rateAG" value="1.0"/>
<frequencies estimate="true" id="freqs" spec="Frequencies">
<parameter name='frequencies' id='freqParameter' value='0.25' dimension='4' lower="0." upper="1."/>
</frequencies>
</substModel>
</siteModel>
<branchRateModel id="StrictClock" spec="beast.evolution.branchratemodel.StrictClockModel">
<parameter dimension="1" id="clock.rate" name="clock.rate" value="2e-3" lower="0." upper="1."/>
</branchRateModel>
<tree spec="beast.util.ClusterTree" id="tree" clusterType="upgma" trait="@tipDates">
<taxa idref="HIV1_CL1"/>
</tree>
<!-- Probability of sequence data given tree -->
<input spec='TreeLikelihood' id="treeLikelihood">
<data idref="HIV1_CL1"/>
<tree idref="tree"/>
<siteModel spec='SiteModel' idref='SiteModel'/>
<branchRateModel idref="StrictClock"/>
</input>
<!-- Parameter priors -->
<input spec='CompoundDistribution' id='parameterPriors'>
<distribution spec='beast.math.distributions.Prior' x="@volz.n_S0">
<distr spec='beast.math.distributions.LogNormalDistributionModel' M="7" S="1"/>
</distribution>
<distribution spec='beast.math.distributions.Prior' x="@volz.R0">
<distr spec="beast.math.distributions.LogNormalDistributionModel" M="1" S="1"/>
</distribution>
<distribution spec='beast.math.distributions.Prior' x="@volz.gamma">
<distr spec='beast.math.distributions.LogNormalDistributionModel' M="-1" S="1"/>
</distribution>
<distribution spec='beast.math.distributions.Prior' x="@volz.origin">
<distr spec="beast.math.distributions.Uniform" lower="0" upper="100"/>
</distribution>
<distribution x="@clock.rate" id="clockRatePrior" spec='beast.math.distributions.Prior'>
<distr spec='beast.math.distributions.Exponential' id='clockRatePrior.exp' mean="1." offset="0.0"/>
</distribution>
<distribution id="hky.frequencies.prior" spec="beast.math.distributions.Prior" x="@freqParameter">
<distr id="Uniform " lower="0.0" upper="1.0" spec="beast.math.distributions.Uniform" />
</distribution>
</input>
<run spec="MCMC" id="mcmc" chainLength="10000000">
<state id="state" storeEvery="1000">
<stateNode spec="RealParameter" id="volz.n_S0" value="999"/>
<stateNode spec="RealParameter" id="volz.R0" value="2.5"/>
<stateNode spec="RealParameter" id="volz.gamma" value="0.30"/>
<stateNode spec="RealParameter" id="volz.origin" value="30"/>
<stateNode idref="tree"/>
<stateNode idref="clock.rate"/>
<parameter dimension="1" id="rateAC" lower="0.0" upper="100.0" name="stateNode" value="1.0"/>
<parameter dimension="1" id="rateGT" lower="0.0" upper="100.0" name="stateNode" value="1.0"/>
<parameter dimension="1" id="rateAT" lower="0.0" upper="100.0" name="stateNode" value="1.0"/>
<parameter dimension="1" id="rateCG" lower="0.0" upper="100.0" name="stateNode" value="1.0"/>
<parameter dimension="1" id="rateCT" lower="0.0" upper="100.0" name="stateNode" value="1.0"/>
<parameter dimension="1" id="proportionInvariant" name="stateNode" value="0.1"/>
<stateNode idref="gammaShape"/>
<stateNode idref="freqParameter"/>
</state>
<distribution spec="CompoundDistribution" id="posterior">
<distribution idref="treeLikelihood"/>
<distribution id="coalescent" spec="Coalescent">
<treeIntervals spec='TreeIntervals' id='TreeIntervals'>
<tree idref="tree"/>
</treeIntervals>
<populationModel spec="SIRPopulationFunction" id='popFunc'>
<volzSIR spec="DeterministicCoalescentSIR" id="volzSIR" integrationStepCount='1001'>
<R0 idref="volz.R0"/>
<gamma idref="volz.gamma"/>
<n_S0 idref="volz.n_S0"/>
<origin idref="volz.origin"/>
</volzSIR>
</populationModel>
</distribution>
<distribution idref="parameterPriors"/>
</distribution>
<!-- OPERATORS! :D -->
<operator id='S0' spec='ScaleOperator' scaleFactor="0.8" optimise="false" weight="1">
<parameter idref="volz.n_S0"/>
</operator>
<operator id='gamma' spec='ScaleOperator' scaleFactor="0.8" optimise="false" weight="1">
<parameter idref="volz.gamma"/>
</operator>
<operator id='R0' spec='ScaleOperator' scaleFactor="0.8" optimise="false" weight="1">
<parameter idref="volz.R0"/>
</operator>
<operator id='origin' spec='ScaleOperator' scaleFactor="0.8" optimise="false" weight="1">
<parameter idref="volz.origin"/>
</operator>
<operator id='upDown' spec='UpDownOperator' scaleFactor="0.8" weight="1">
<up idref="volz.gamma"/>
<up idref="volz.n_S0"/>
</operator>
<!-- GTR model operators -->
<operator id="clock.rateScaler" parameter="@clock.rate" scaleFactor="0.75" spec="ScaleOperator" weight="1.0"/>
<operator spec='ScaleOperator' scaleFactor=".75" weight=".2" parameter="@rateAC"/>
<operator spec='ScaleOperator' scaleFactor=".75" weight=".2" parameter="@rateAT"/>
<operator spec='ScaleOperator' scaleFactor=".75" weight=".2" parameter="@rateCG"/>
<operator spec='ScaleOperator' scaleFactor=".75" weight=".2" parameter="@rateCT"/>
<operator spec='ScaleOperator' scaleFactor=".75" weight=".2" parameter="@rateGT"/>
<operator spec='ScaleOperator' scaleFactor=".75" weight=".2" parameter="@proportionInvariant"/>
<operator id='gammaShapeScaler' spec='ScaleOperator' scaleFactor=".75" weight=".2" parameter="@gammaShape"/>
<operator autoOptimize="true" delta="0.2" id="FrequenciesExchanger" integer="false" spec="DeltaExchangeOperator" weight="0.1" parameter="@freqParameter"/>
<!-- Treeeeeee operators -->
<operator id="updownTree" spec="UpDownOperator" scaleFactor=".95" optimise="false" weight="30">
<up idref="clock.rate"/>
<down idref="tree"/>
<down idref="volz.origin"/>
</operator>
<operator id='treeScaler' spec='ScaleOperator' scaleFactor=".95" weight="3" tree="@tree" scaleAllIndependently="false" rootOnly='true'/>
<operator spec='Uniform' weight="20" tree="@tree"/>
<operator spec='SubtreeSlide' weight="20" gaussian="true" size="1." tree="@tree"/>
<operator id='narrow' spec='Exchange' isNarrow='true' weight="10" tree="@tree"/>
<operator id='wide' spec='Exchange' isNarrow='false' weight="10" tree="@tree"/>
<operator spec='WilsonBalding' weight="10" tree="@tree"/>
<!-- Logger -->
<logger logEvery="1000" fileName="DeterCoalSIR_HIVcluster1.log">
<model idref='posterior'/>
<log idref="posterior"/>
<log idref="treeLikelihood"/>
<log idref="volz.R0"/>
<log idref="volz.gamma"/>
<log idref="volz.n_S0"/>
<log idref="volz.origin"/>
<log idref="volzSIR"/>
<log spec='beast.evolution.tree.TreeHeightLogger' tree='@tree'/>
<log idref="proportionInvariant"/>
<log idref="clock.rate"/>
<log idref="gammaShape"/>
<log idref="rateAC"/>
<log idref="rateAG"/>
<log idref="rateAT"/>
<log idref="rateCG"/>
<log idref="rateCT"/>
<log idref="rateGT"/>
</logger>
<logger fileName="DeterCoalSIR_HIVcluster1.trees" id="treelog" logEvery="1000" mode="tree">
<log spec='beast.evolution.tree.TreeWithMetaDataLogger' tree='@tree'>
<metadata idref="posterior"/>
</log>
</logger>
<logger logEvery="1000">
<model idref='posterior'/>
<log idref="posterior"/>
<log idref="treeLikelihood"/>
<log idref="volz.R0"/>
<log idref="volz.gamma"/>
<log idref="volz.n_S0"/>
<log idref="volz.origin"/>
<log idref="volzSIR"/>
<log spec='beast.evolution.tree.TreeHeightLogger' tree='@tree'/>
<log idref="proportionInvariant"/>
<log idref="clock.rate"/>
<log idref="gammaShape"/>
<log idref="rateAC"/>
<log idref="rateAG"/>
<log idref="rateAT"/>
<log idref="rateCG"/>
<log idref="rateCT"/>
<log idref="rateGT"/>
</logger>
</run>
</beast>
You can’t perform that action at this time.