/bowtie2

Permalink
Switch branches/tags
Nothing to show
Find file
bowtie2/MANUAL
Fetching contributors…
Cannot retrieve contributors at this time
Raw Blame History
2028 lines (1492 sloc) 89.1 KB
Introduction
============
What is Bowtie 2?
-----------------
[Bowtie 2] is an ultrafast and memory-efficient tool for aligning sequencing
reads to long reference sequences. It is particularly good at aligning reads of
about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian)
genomes. Bowtie 2 indexes the genome with an [FM Index] (based on the
[Burrows-Wheeler Transform] or [BWT]) to keep its memory footprint small: for
the human genome, its memory footprint is typically around 3.2 gigabytes of RAM.
Bowtie 2 supports gapped, local, and paired-end alignment modes. Multiple
processors can be used simultaneously to achieve greater alignment speed.
Bowtie 2 outputs alignments in [SAM] format, enabling interoperation with a
large number of other tools (e.g. [SAMtools], [GATK]) that use SAM. Bowtie 2 is
distributed under the [GPLv3 license], and it runs on the command line under
Windows, Mac OS X and Linux.
[Bowtie 2] is often the first step in pipelines for comparative genomics,
including for variation calling, ChIP-seq, RNA-seq, BS-seq. [Bowtie 2] and
[Bowtie] (also called "[Bowtie 1]" here) are also tightly integrated into some
tools, including [TopHat]: a fast splice junction mapper for RNA-seq reads,
[Cufflinks]: a tool for transcriptome assembly and isoform quantitiation from
RNA-seq reads, [Crossbow]: a cloud-enabled software tool for analyzing
resequencing data, and [Myrna]: a cloud-enabled software tool for aligning
RNA-seq reads and measuring differential gene expression.
If you use [Bowtie 2] for your published research, please cite the [Bowtie
paper]. Thank you!
[Bowtie 2]: http://bowtie-bio.sf.net/bowtie2
[Bowtie]: http://bowtie-bio.sf.net
[Bowtie 1]: http://bowtie-bio.sf.net
[Burrows-Wheeler Transform]: http://en.wikipedia.org/wiki/Burrows-Wheeler_transform
[BWT]: http://en.wikipedia.org/wiki/Burrows-Wheeler_transform
[FM Index]: http://en.wikipedia.org/wiki/FM-index
[SAM]: http://samtools.sourceforge.net/SAM1.pdf
[SAMtools]: http://samtools.sourceforge.net
[GATK]: http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit
[TopHat]: http://tophat.cbcb.umd.edu/
[Cufflinks]: http://cufflinks.cbcb.umd.edu/
[Crossbow]: http://bowtie-bio.sf.net/crossbow
[Myrna]: http://bowtie-bio.sf.net/myrna
[Bowtie paper]: http://genomebiology.com/2009/10/3/R25
[GPLv3 license]: http://www.gnu.org/licenses/gpl-3.0.html
How is Bowtie 2 different from Bowtie 1?
----------------------------------------
Bowtie 1 was released in 2009 and was geared toward aligning the relatively
short sequencing reads (up to 25-50 nucleotides) prevalent at the time. Since
then, technology has improved both sequencing throughput (more nucleotides
produced per sequencer per day) and read length (more nucleotides per read).
The chief differences between Bowtie 1 and Bowtie 2 are:
1. For reads longer than about 50 bp Bowtie 2 is generally faster, more
sensitive, and uses less memory than Bowtie 1. For relatively short reads (e.g.
less than 50 bp) Bowtie 1 is sometimes faster and/or more sensitive.
B
2. Bowtie 2 supports gapped alignment with affine gap penalties. Number of gaps
and gap lengths are not restricted, except by way of the configurable scoring
scheme. Bowtie 1 finds just ungapped alignments.
3. Bowtie 2 supports [local alignment], which doesn't require reads to align
end-to-end. Local alignments might be "trimmed" ("soft clipped") at one or both
extremes in a way that optimizes alignment score. Bowtie 2 also supports
[end-to-end alignment] which, like Bowtie 1, requires that the read align
entirely.
4. There is no upper limit on read length in Bowtie 2. Bowtie 1 had an upper
limit of around 1000 bp.
5. Bowtie 2 allows alignments to [overlap ambiguous characters] (e.g. `N`s) in
the reference. Bowtie 1 does not.
6. Bowtie 2 does away with Bowtie 1's notion of alignment "stratum", and its
distinction between "Maq-like" and "end-to-end" modes. In Bowtie 2 all
alignments lie along a continuous spectrum of alignment scores where the
[scoring scheme], similar to [Needleman-Wunsch] and [Smith-Waterman].
7. Bowtie 2's [paired-end alignment] is more flexible. E.g. for pairs that do
not align in a paired fashion, Bowtie 2 attempts to find unpaired alignments for
each mate.
8. Bowtie 2 reports a spectrum of mapping qualities, in contrast for Bowtie 1
which reports either 0 or high.
9. Bowtie 2 does not align colorspace reads.
Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's command-line
arguments and genome index format are both different from Bowtie 1's.
[Needleman-Wunsch]: http://en.wikipedia.org/wiki/Needleman-Wunsch_algorithm
[Smith-Waterman]: http://en.wikipedia.org/wiki/Smith_waterman
What isn't Bowtie 2?
--------------------
Bowtie 1 and Bowtie 2 are not general-purpose alignment tools like [MUMmer],
[BLAST] or [Vmatch]. Bowtie 2 works best when aligning to large genomes, though
it supports arbitrarily small reference sequences (e.g. amplicons). It handles
very long reads (i.e. upwards of 10s or 100s of kilobases), but it is optimized
for the read lengths and error modes yielded by recent sequencers, such as the
Illumina HiSeq 2000, Roche 454, and Ion Torrent instruments.
If your goal is to align two very large sequences (e.g. two genomes), consider
using [MUMmer]. If your goal is very sensitive alignment to a relatively short
reference sequence (e.g. a bacterial genome), this can be done with Bowtie 2 but
you may want to consider using tools like [NUCmer], [BLAT], or [BLAST]. These
tools can be extremely slow when the reference genome is long, but are often
adequate when the reference is short.
Bowtie 2 does not support alignment of colorspace reads.
[MUMmer]: http://mummer.sourceforge.net/
[NUCmer]: http://mummer.sourceforge.net/manual/#nucmer
[BLAST]: http://blast.ncbi.nlm.nih.gov/Blast.cgi
[BLAT]: http://genome.ucsc.edu/cgi-bin/hgBlat?command=start
[Vmatch]: http://www.vmatch.de/
What does it mean that some older Bowtie 2 versions are "beta"?
--------------------------------------------------------------
We said those Bowtie 2 versions were in "beta" to convey that it was not as
polished as a tool that had been around for a while, and was still in flux.
Since version 2.0.1, we declared Bowtie 2 was no longer "beta".
Obtaining Bowtie 2
==================
Download Bowtie 2 sources and binaries from the [Download] section of the
Sourceforge site. Binaries are available for the Intel `x86_64` architecture
running Linux, Mac OS X, and Windows. If you plan to compile Bowtie 2 yourself,
make sure to get the source package, i.e., the filename that ends in
"-source.zip".
Building from source
--------------------
Building Bowtie 2 from source requires a GNU-like environment with GCC, GNU Make
and other basics. It should be possible to build Bowtie 2 on most vanilla Linux
installations or on a Mac installation with [Xcode] installed. Bowtie 2 can
also be built on Windows using a 64-bit MinGW distribution and MSYS. In order
to simplify the MinGW setup it might be worth investigating popular MinGW personal
builds since these are coming already prepared with most of the toolchains needed.
First, download the source package from the [sourceforge site]. Make sure
you're getting the source package; the file downloaded should end in
`-source.zip`. Unzip the file, change to the unzipped directory, and build the
Bowtie 2 tools by running GNU `make` (usually with the command `make`, but
sometimes with `gmake`) with no arguments. If building with MinGW, run `make`
from the MSYS environment.
+Bowtie 2 is using the multithreading software model in order to
+speed up execution times on SMP architectures where this is possible.
+The Threading Building Blocks library, TBB, is now the default
+threading library in Bowtie 2. On POSIX platforms (like Linux, Mac
+OS, etc.) if TBB is not available the pthread library will be used.
+Although it is possible to use pthread library on Windows, a non-POSIX
+platform, due to performance reasons Bowtie 2 will try to use Windows
+native multithreading if possible. We recommend that you first
+install the [Threading Building Blocks library], but if unable to
+do so please specify `make NO_TBB=1`. TBB comes installed by default
+on many popular Linux distros. Please note, packages built without
+TBB will have _-legacy_ appended to the name.
[MinGW]: http://www.mingw.org/
[MSYS]: http://www.mingw.org/wiki/msys
[pthreads]: http://sourceware.org/pthreads-win32/
[GnuWin32]: http://gnuwin32.sf.net/packages/coreutils.htm
[Threading Building Blocks library]: https://www.threadingbuildingblocks.org
[Download]: https://sourceforge.net/projects/bowtie-bio/files/bowtie2/
[sourceforge site]: https://sourceforge.net/projects/bowtie-bio/files/bowtie2/
[Xcode]: http://developer.apple.com/xcode/
Adding to PATH
--------------
By adding your new Bowtie 2 directory to your [PATH environment variable], you
ensure that whenever you run `bowtie2`, `bowtie2-build` or `bowtie2-inspect`
from the command line, you will get the version you just installed without
having to specify the entire path. This is recommended for most users. To do
this, follow your operating system's instructions for adding the directory to
your [PATH].
If you would like to install Bowtie 2 by copying the Bowtie 2 executable files
to an existing directory in your [PATH], make sure that you copy all the
executables, including `bowtie2`, `bowtie2-align-s`, `bowtie2-align-l`,
`bowtie2-build`, `bowtie2-build-s`, `bowtie2-build-l`, `bowtie2-inspect`,
`bowtie2-inspect-s` and `bowtie2-inspect-l`.
[PATH environment variable]: http://en.wikipedia.org/wiki/PATH_(variable)
[PATH]: http://en.wikipedia.org/wiki/PATH_(variable)
The `bowtie2` aligner
=====================
`bowtie2` takes a Bowtie 2 index and a set of sequencing read files and outputs
a set of alignments in SAM format.
"Alignment" is the process by which we discover how and where the read sequences
are similar to the reference sequence. An "alignment" is a result from this
process, specifically: an alignment is a way of "lining up" some or all of the
characters in the read with some characters from the reference in a way that
reveals how they're similar. For example:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
Where dash symbols represent gaps and vertical bars show where aligned
characters match.
We use alignment to make an educated guess as to where a read originated with
respect to the reference genome. It's not always possible to determine this
with certainty. For instance, if the reference genome contains several long
stretches of As (`AAAAAAAAA` etc.) and the read sequence is a short stretch of As
(`AAAAAAA`), we cannot know for certain exactly where in the sea of `A`s the
read originated.
End-to-end alignment versus local alignment
-------------------------------------------
By default, Bowtie 2 performs end-to-end read alignment. That is, it searches
for alignments involving all of the read characters. This is also called an
"untrimmed" or "unclipped" alignment.
When the --local option is specified, Bowtie 2 performs local read alignment. In
this mode, Bowtie 2 might "trim" or "clip" some read characters from one or both
ends of the alignment if doing so maximizes the alignment score.
### End-to-end alignment example
The following is an "end-to-end" alignment because it involves all the
characters in the read. Such an alignment can be produced by Bowtie 2 in either
end-to-end mode or in local mode.
Read: GACTGGGCGATCTCGACTTCG
Reference: GACTGCGATCTCGACATCG
Alignment:
Read: GACTGGGCGATCTCGACTTCG
||||| |||||||||| |||
Reference: GACTG--CGATCTCGACATCG
### Local alignment example
The following is a "local" alignment because some of the characters at the ends
of the read do not participate. In this case, 4 characters are omitted (or
"soft trimmed" or "soft clipped") from the beginning and 3 characters are
omitted from the end. This sort of alignment can be produced by Bowtie 2 only
in local mode.
Read: ACGGTTGCGTTAATCCGCCACG
Reference: TAACTTGCGTTAAATCCGCCTGG
Alignment:
Read: ACGGTTGCGTTAA-TCCGCCACG
||||||||| ||||||
Reference: TAACTTGCGTTAAATCCGCCTGG
Scores: higher = more similar
-----------------------------
An alignment score quantifies how similar the read sequence is to the reference
sequence aligned to. The higher the score, the more similar they are. A score
is calculated by subtracting penalties for each difference (mismatch, gap, etc.)
and, in local alignment mode, adding bonuses for each match.
The scores can be configured with the `--ma` (match bonus), `--mp` (mismatch
penalty), `--np` (penalty for having an N in either the read or the
reference), `--rdg` (affine read gap penalty) and `--rfg` (affine reference
gap penalty) options.
### End-to-end alignment score example
A mismatched base at a high-quality position in the read receives a penalty of
-6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for
the gap open, -3 for the first extension, -3 for the second extension). Thus,
in end-to-end alignment mode, if the read is 50 bp long and it matches the
reference exactly except for one mismatch at a high-quality position and one
length-2 read gap, then the overall score is -(6 + 11) = -17.
The best possible alignment score in end-to-end mode is 0, which happens when
there are no differences between the read and the reference.
### Local alignment score example
A mismatched base at a high-quality position in the read receives a penalty of
-6 by default. A length-2 read gap receives a penalty of -11 by default (-5 for
the gap open, -3 for the first extension, -3 for the second extension). A base
that matches receives a bonus of +2 be default. Thus, in local alignment mode,
if the read is 50 bp long and it matches the reference exactly except for one
mismatch at a high-quality position and one length-2 read gap, then the overall
score equals the total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.
The best possible score in local mode equals the match bonus times the length of
the read. This happens when there are no differences between the read and the
reference.
### Valid alignments meet or exceed the minimum score threshold
For an alignment to be considered "valid" (i.e. "good enough") by Bowtie 2, it
must have an alignment score no less than the minimum score threshold. The
threshold is configurable and is expressed as a function of the read length. In
end-to-end alignment mode, the default minimum score threshold is `-0.6 + -0.6 *
L`, where `L` is the read length. In local alignment mode, the default minimum
score threshold is `20 + 8.0 * ln(L)`, where L is the read length. This can be
configured with the `--score-min` option. For details on how to set options
like `--score-min` that correspond to functions, see the section on [setting
function options].
Mapping quality: higher = more unique
-------------------------------------
The aligner cannot always assign a read to its point of origin with high
confidence. For instance, a read that originated inside a repeat element might
align equally well to many occurrences of the element throughout the genome,
leaving the aligner with no basis for preferring one over the others.
Aligners characterize their degree of confidence in the point of origin by
reporting a mapping quality: a non-negative integer Q = -10 log10 p, where p is
an estimate of the probability that the alignment does not correspond to the
read's true point of origin. Mapping quality is sometimes abbreviated MAPQ, and
is recorded in the [SAM] `MAPQ` field.
Mapping quality is related to "uniqueness." We say an alignment is unique if it
has a much higher alignment score than all the other possible alignments. The
bigger the gap between the best alignment's score and the second-best
alignment's score, the more unique the best alignment, and the higher its mapping
quality should be.
Accurate mapping qualities are useful for downstream tools like variant callers.
For instance, a variant caller might choose to ignore evidence from alignments
with mapping quality less than, say, 10. A mapping quality of 10 or less
indicates that there is at least a 1 in 10 chance that the read truly originated
elsewhere.
[SAM]: http://samtools.sourceforge.net/SAM1.pdf
Aligning pairs
--------------
A "paired-end" or "mate-pair" read consists of pair of mates, called mate 1 and
mate 2. Pairs come with a prior expectation about (a) the relative orientation
of the mates, and (b) the distance separating them on the original DNA molecule.
Exactly what expectations hold for a given dataset depends on the lab procedures
used to generate the data. For example, a common lab procedure for producing
pairs is Illumina's Paired-end Sequencing Assay, which yields pairs with a
relative orientation of FR ("forward, reverse") meaning that if mate 1 came from
the Watson strand, mate 2 very likely came from the Crick strand and vice versa.
Also, this protocol yields pairs where the expected genomic distance from end
to end is about 200-500 base pairs.
For simplicity, this manual uses the term "paired-end" to refer to any pair of
reads with some expected relative orientation and distance. Depending on the
protocol, these might actually be referred to as "paired-end" or "mate-paired."
Also, we always refer to the individual sequences making up the pair as "mates."
### Paired inputs
Pairs are often stored in a pair of files, one file containing the mate 1s and
the other containing the mates 2s. The first mate in the file for mate 1 forms
a pair with the first mate in the file for mate 2, the second with the second,
and so on. When aligning pairs with Bowtie 2, specify the file with the mate 1s
mates using the `-1` argument and the file with the mate 2s using the `-2`
argument. This causes Bowtie 2 to take the paired nature of the reads into
account when aligning them.
### Paired SAM output
When Bowtie 2 prints a SAM alignment for a pair, it prints two records (i.e. two
lines of output), one for each mate. The first record describes the alignment
for mate 1 and the second record describes the alignment for mate 2. In both
records, some of the fields of the SAM record describe various properties of the
alignment; for instance, the 7th and 8th fields (`RNEXT` and `PNEXT`
respectively) indicate the reference name and position where the other mate
aligned, and the 9th field indicates the inferred length of the DNA fragment
from which the two mates were sequenced. See the [SAM specification] for more
details regarding these fields.
### Concordant pairs match pair expectations, discordant pairs don't
A pair that aligns with the expected relative mate orientation and with the
expected range of distances between mates is said to align "concordantly". If
both mates have unique alignments, but the alignments do not match paired-end
expectations (i.e. the mates aren't in the expected relative orientation, or
aren't within the expected distance range, or both), the pair is said to align
"discordantly". Discordant alignments may be of particular interest, for
instance, when seeking [structural variants].
The expected relative orientation of the mates is set using the `--ff`,
`--fr`, or `--rf` options. The expected range of inter-mates distances (as
measured from the furthest extremes of the mates; also called "outer distance")
is set with the `-I` and `-X` options. Note that setting `-I` and `-X`
far apart makes Bowtie 2 slower. See documentation for `-I` and `-X`.
To declare that a pair aligns discordantly, Bowtie 2 requires that both mates
align uniquely. This is a conservative threshold, but this is often desirable
when seeking structural variants.
By default, Bowtie 2 searches for both concordant and discordant alignments,
though searching for discordant alignments can be disabled with the
`--no-discordant` option.
[structural variants]: http://www.ncbi.nlm.nih.gov/dbvar/content/overview/
### Mixed mode: paired where possible, unpaired otherwise
If Bowtie 2 cannot find a paired-end alignment for a pair, by default it will go
on to look for unpaired alignments for the constituent mates. This is called
"mixed mode." To disable mixed mode, set the `--no-mixed` option.
Bowtie 2 runs a little faster in `--no-mixed` mode, but will only consider
alignment status of pairs per se, not individual mates.
### Some SAM FLAGS describe paired-end properties
The SAM `FLAGS` field, the second field in a SAM record, has multiple bits that
describe the paired-end nature of the read and alignment. The first (least
significant) bit (1 in decimal, 0x1 in hexadecimal) is set if the read is part
of a pair. The second bit (2 in decimal, 0x2 in hexadecimal) is set if the read
is part of a pair that aligned in a paired-end fashion. The fourth bit (8 in
decimal, 0x8 in hexadecimal) is set if the read is part of a pair and the other
mate in the pair had at least one valid alignment. The sixth bit (32 in
decimal, 0x20 in hexadecimal) is set if the read is part of a pair and the other
mate in the pair aligned to the Crick strand (or, equivalently, if the reverse
complement of the other mate aligned to the Watson strand). The seventh bit (64
in decimal, 0x40 in hexadecimal) is set if the read is mate 1 in a pair. The
eighth bit (128 in decimal, 0x80 in hexadecimal) is set if the read is mate 2 in
a pair. See the [SAM specification] for a more detailed description of the
`FLAGS` field.
### Some SAM optional fields describe more paired-end properties
The last several fields of each SAM record usually contain SAM optional fields,
which are simply tab-separated strings conveying additional information about
the reads and alignments. A SAM optional field is formatted like this: "XP:i:1"
where "XP" is the `TAG`, "i" is the `TYPE` ("integer" in this case), and "1" is
the `VALUE`. See the [SAM specification] for details regarding SAM optional
fields.
### Mates can overlap, contain, or dovetail each other
The fragment and read lengths might be such that alignments for the two mates
from a pair overlap each other. Consider this example:
(For these examples, assume we expect mate 1 to align to the left of mate 2.)
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTT
Mate 2: TGTTTGGGGTGACACATTACGCGTCTTTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
It's also possible, though unusual, for one mate alignment to contain the other,
as in these examples:
Mate 1: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TGTTTGGGGTGACACATTACGC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
Mate 1: CAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: CTACGATATTGTTTGGGGTGAC
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
And it's also possible, though unusual, for the mates to "dovetail", with the
mates seemingly extending "past" each other as in this example:
Mate 1: GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
Mate 2: TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT
Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
In some situations, it's desirable for the aligner to consider all these cases
as "concordant" as long as other paired-end constraints are not violated. Bowtie
2's default behavior is to consider overlapping and containing as being
consistent with concordant alignment. By default, dovetailing is considered
inconsistent with concordant alignment.
These defaults can be overridden. Setting `--no-overlap` causes Bowtie 2 to
consider overlapping mates as non-concordant. Setting `--no-contain` causes
Bowtie 2 to consider cases where one mate alignment contains the other as
non-concordant. Setting `--dovetail` causes Bowtie 2 to consider cases where
the mate alignments dovetail as concordant.
Reporting
---------
The reporting mode governs how many alignments Bowtie 2 looks for, and how to
report them. Bowtie 2 has three distinct reporting modes. The default
reporting mode is similar to the default reporting mode of many other read
alignment tools, including [BWA]. It is also similar to Bowtie 1's `-M`
alignment mode.
In general, when we say that a read has an alignment, we mean that it has a
[valid alignment]. When we say that a read has multiple alignments, we mean
that it has multiple alignments that are valid and distinct from one another.
[BWA]: http://bio-bwa.sourceforge.net/
### Distinct alignments map a read to different places
Two alignments for the same individual read are "distinct" if they map the same
read to different places. Specifically, we say that two alignments are distinct
if there are no alignment positions where a particular read offset is aligned
opposite a particular reference offset in both alignments with the same
orientation. E.g. if the first alignment is in the forward orientation and
aligns the read character at read offset 10 to the reference character at
chromosome 3, offset 3,445,245, and the second alignment is also in the forward
orientation and also aligns the read character at read offset 10 to the
reference character at chromosome 3, offset 3,445,245, they are not distinct
alignments.
Two alignments for the same pair are distinct if either the mate 1s in the two
paired-end alignments are distinct or the mate 2s in the two alignments are
distinct or both.
### Default mode: search for multiple alignments, report the best one
By default, Bowtie 2 searches for distinct, valid alignments for each read. When
it finds a valid alignment, it generally will continue to look for alignments
that are nearly as good or better. It will eventually stop looking, either
because it exceeded a limit placed on search effort (see `-D` and `-R`) or
because it already knows all it needs to know to report an alignment.
Information from the best alignments are used to estimate mapping quality (the
`MAPQ` [SAM] field) and to set SAM optional fields, such as `AS:i` and
`XS:i`. Bowtie 2 does not guarantee that the alignment reported is the best
possible in terms of alignment score.
See also: `-D`, which puts an upper limit on the number of dynamic programming
problems (i.e. seed extensions) that can "fail" in a row before Bowtie 2 stops
searching. Increasing `-D` makes Bowtie 2 slower, but increases the
likelihood that it will report the correct alignment for a read that aligns many
places.
See also: `-R`, which sets the maximum number of times Bowtie 2 will "re-seed"
when attempting to align a read with repetitive seeds. Increasing `-R` makes
Bowtie 2 slower, but increases the likelihood that it will report the correct
alignment for a read that aligns many places.
### -k mode: search for one or more alignments, report each
In `-k` mode, Bowtie 2 searches for up to N distinct, valid alignments for
each read, where N equals the integer specified with the `-k` parameter. That
is, if `-k 2` is specified, Bowtie 2 will search for at most 2 distinct
alignments. It reports all alignments found, in descending order by alignment
score. The alignment score for a paired-end alignment equals the sum of the
alignment scores of the individual mates. Each reported read or pair alignment
beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS
field. See the [SAM specification] for details.
Bowtie 2 does not "find" alignments in any specific order, so for reads that
have more than N distinct, valid alignments, Bowtie 2 does not guarantee that
the N alignments reported are the best possible in terms of alignment score.
Still, this mode can be effective and fast in situations where the user cares
more about whether a read aligns (or aligns a certain number of times) than
where exactly it originated.
[SAM specification]: http://samtools.sourceforge.net/SAM1.pdf
### -a mode: search for and report all alignments
`-a` mode is similar to `-k` mode except that there is no upper limit on the
number of alignments Bowtie 2 should report. Alignments are reported in
descending order by alignment score. The alignment score for a paired-end
alignment equals the sum of the alignment scores of the individual mates. Each
reported read or pair alignment beyond the first has the SAM 'secondary' bit
(which equals 256) set in its FLAGS field. See the [SAM specification] for
details.
Some tools are designed with this reporting mode in mind. Bowtie 2 is not! For
very large genomes, this mode is very slow.
[SAM specification]: http://samtools.sourceforge.net/SAM1.pdf
### Randomness in Bowtie 2
Bowtie 2's search for alignments for a given read is "randomized." That is,
when Bowtie 2 encounters a set of equally-good choices, it uses a pseudo-random
number to choose. For example, if Bowtie 2 discovers a set of 3 equally-good
alignments and wants to decide which to report, it picks a pseudo-random integer
0, 1 or 2 and reports the corresponding alignment. Arbitrary choices can crop up
at various points during alignment.
The pseudo-random number generator is re-initialized for every read, and the
seed used to initialize it is a function of the read name, nucleotide string,
quality string, and the value specified with `--seed`. If you run the same
version of Bowtie 2 on two reads with identical names, nucleotide strings, and
quality strings, and if `--seed` is set the same for both runs, Bowtie 2 will
produce the same output; i.e., it will align the read to the same place, even if
there are multiple equally good alignments. This is intuitive and desirable in
most cases. Most users expect Bowtie to produce the same output when run twice
on the same input.
However, when the user specifies the `--non-deterministic` option, Bowtie 2
will use the current time to re-initialize the pseudo-random number generator.
When this is specified, Bowtie 2 might report different alignments for identical
reads. This is counter-intuitive for some users, but might be more appropriate
in situations where the input consists of many identical reads.
Multiseed heuristic
-------------------
To rapidly narrow the number of possible alignments that must be considered,
Bowtie 2 begins by extracting substrings ("seeds") from the read and its reverse
complement and aligning them in an ungapped fashion with the help of the [FM
Index]. This is "multiseed alignment" and it is similar to what [Bowtie 1
does], except Bowtie 1 attempts to align the entire read this way.
This initial step makes Bowtie 2 much faster than it would be without such a
filter, but at the expense of missing some valid alignments. For instance, it
is possible for a read to have a valid overall alignment but to have no valid
seed alignments because each potential seed alignment is interrupted by too many
mismatches or gaps.
The trade-off between speed and sensitivity/accuracy can be adjusted by setting
the seed length (`-L`), the interval between extracted seeds (`-i`), and the
number of mismatches permitted per seed (`-N`). For more sensitive alignment,
set these parameters to (a) make the seeds closer together, (b) make the seeds
shorter, and/or (c) allow more mismatches. You can adjust these options
one-by-one, though Bowtie 2 comes with some useful combinations of options
prepackaged as "[preset options]."
`-D` and `-R` are also options that adjust the trade-off between speed and
sensitivity/accuracy.
### FM Index memory footprint
Bowtie 2 uses the [FM Index] to find ungapped alignments for seeds. This step
accounts for the bulk of Bowtie 2's memory footprint, as the [FM Index] itself
is typically the largest data structure used. For instance, the memory
footprint of the [FM Index] for the human genome is about 3.2 gigabytes of RAM.
[Bowtie 1 does]: http://genomebiology.com/2009/10/3/R25
[Bowtie 1 paper]: http://genomebiology.com/2009/10/3/R25
[FM Index]: http://portal.acm.org/citation.cfm?id=796543
[bi-directional BWT approach]: http://www.computer.org/portal/web/csdl/doi/10.1109/BIBM.2009.42
Ambiguous characters
--------------------
Non-whitespace characters besides A, C, G or T are considered "ambiguous." N is
a common ambiguous character that appears in reference sequences. Bowtie 2
considers all ambiguous characters in the reference (including [IUPAC nucleotide
codes]) to be Ns.
Bowtie 2 allows alignments to overlap ambiguous characters in the reference. An
alignment position that contains an ambiguous character in the read, reference,
or both, is penalized according to `--np`. `--n-ceil` sets an upper limit
on the number of positions that may contain ambiguous reference characters in a
valid alignment. The optional field `XN:i` reports the number of ambiguous
reference characters overlapped by an alignment.
Note that the [multiseed heuristic] cannot find *seed* alignments that overlap
ambiguous reference characters. For an alignment overlapping an ambiguous
reference character to be found, it must have one or more seed alignments that
do not overlap ambiguous reference characters.
[IUPAC nucleotide codes]: http://www.bioinformatics.org/sms/iupac.html
Presets: setting many settings at once
--------------------------------------
Bowtie 2 comes with some useful combinations of parameters packaged into shorter
"preset" parameters. For example, running Bowtie 2 with the `--very-sensitive`
option is the same as running with options: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`.
The preset options that come with Bowtie 2 are designed to cover a wide area of
the speed/sensitivity/accuracy trade-off space, with the presets ending in `fast`
generally being faster but less sensitive and less accurate, and the presets
ending in `sensitive` generally being slower but more sensitive and more
accurate. See the [documentation for the preset options] for details.
Filtering
---------
Some reads are skipped or "filtered out" by Bowtie 2. For example, reads may be
filtered out because they are extremely short or have a high proportion of
ambiguous nucleotides. Bowtie 2 will still print a SAM record for such a read,
but no alignment will be reported and the `YF:i` SAM optional field will be
set to indicate the reason the read was filtered.
* `YF:Z:LN`: the read was filtered because it had length less than or equal to
the number of seed mismatches set with the `-N` option.
* `YF:Z:NS`: the read was filtered because it contains a number of ambiguous
characters (usually `N` or `.`) greater than the ceiling specified with
`--n-ceil`.
* `YF:Z:SC`: the read was filtered because the read length and the match bonus
(set with `--ma`) are such that the read can't possibly earn an alignment
score greater than or equal to the threshold set with `--score-min`
* `YF:Z:QC`: the read was filtered because it was marked as failing quality
control and the user specified the `--qc-filter` option. This only happens
when the input is in Illumina's QSEQ format (i.e. when `--qseq` is specified)
and the last (11th) field of the read's QSEQ record contains `1`.
If a read could be filtered for more than one reason, the value `YF:Z` flag will
reflect only one of those reasons.
Alignment summary
------------------
When Bowtie 2 finishes running, it prints messages summarizing what happened.
These messages are printed to the "standard error" ("stderr") filehandle. For
datasets consisting of unpaired reads, the summary might look like this:
20000 reads; of these:
20000 (100.00%) were unpaired; of these:
1247 (6.24%) aligned 0 times
18739 (93.69%) aligned exactly 1 time
14 (0.07%) aligned >1 times
93.77% overall alignment rate
For datasets consisting of pairs, the summary might look like this:
10000 reads; of these:
10000 (100.00%) were paired; of these:
650 (6.50%) aligned concordantly 0 times
8823 (88.23%) aligned concordantly exactly 1 time
527 (5.27%) aligned concordantly >1 times
----
650 pairs aligned concordantly 0 times; of these:
34 (5.23%) aligned discordantly 1 time
----
616 pairs aligned 0 times concordantly or discordantly; of these:
1232 mates make up the pairs; of these:
660 (53.57%) aligned 0 times
571 (46.35%) aligned exactly 1 time
1 (0.08%) aligned >1 times
96.70% overall alignment rate
The indentation indicates how subtotals relate to totals.
Wrapper scripts
---------------
The `bowtie2`, `bowtie2-build` and `bowtie2-inspect` executables are actually
wrapper scripts that call binary programs as appropriate. The wrappers shield
users from having to distinguish between "small" and "large" index formats,
discussed briefly in the following section. Also, the `bowtie2` wrapper
provides some key functionality, like the ability to handle compressed inputs,
and the functionality for `--un`, `--al` and related options.
It is recommended that you always run the bowtie2 wrappers and not run the
binaries directly.
Small and large indexes
-----------------------
`bowtie2-build` can index reference genomes of any size. For genomes less than
about 4 billion nucleotides in length, `bowtie2-build` builds a "small" index
using 32-bit numbers in various parts of the index. When the genome is longer,
`bowtie2-build` builds a "large" index using 64-bit numbers. Small indexes are
stored in files with the `.bt2` extension, and large indexes are stored in
files with the `.bt2l` extension. The user need not worry about whether a
particular index is small or large; the wrapper scripts will automatically build
and use the appropriate index.
Performance tuning
------------------
1. If your computer has multiple processors/cores, use `-p`
The `-p` option causes Bowtie 2 to launch a specified number of parallel
search threads. Each thread runs on a different processor/core and all
threads find alignments in parallel, increasing alignment throughput by
approximately a multiple of the number of threads (though in practice,
speedup is somewhat worse than linear).
2. If reporting many alignments per read, try reducing
`bowtie2-build --offrate`
If you are using `-k` or `-a` options and Bowtie 2 is reporting many
alignments per read, using an index with a denser SA sample can speed
things up considerably. To do this, specify a smaller-than-default
`-o`/`--offrate` value when running `bowtie2-build`.
A denser SA sample yields a larger index, but is also particularly
effective at speeding up alignment when many alignments are reported per
read.
3. If `bowtie2` "thrashes", try increasing `bowtie2-build --offrate`
If `bowtie2` runs very slowly on a relatively low-memory computer, try
setting `-o`/`--offrate` to a *larger* value when building the index.
This decreases the memory footprint of the index.
Command Line
------------
### Setting function options
Some Bowtie 2 options specify a function rather than an individual number or
setting. In these cases the user specifies three parameters: (a) a function
type `F`, (b) a constant term `B`, and (c) a coefficient `A`. The available
function types are constant (`C`), linear (`L`), square-root (`S`), and natural
log (`G`). The parameters are specified as `F,B,A` - that is, the function type,
the constant term, and the coefficient are separated by commas with no
whitespace. The constant term and coefficient may be negative and/or
floating-point numbers.
For example, if the function specification is `L,-0.4,-0.6`, then the function
defined is:
f(x) = -0.4 + -0.6 * x
If the function specification is `G,1,5.4`, then the function defined is:
f(x) = 1.0 + 5.4 * ln(x)
See the documentation for the option in question to learn what the parameter `x`
is for. For example, in the case if the `--score-min` option, the function
`f(x)` sets the minimum alignment score necessary for an alignment to be
considered valid, and `x` is the read length.
### Usage
bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r>} -S [<hit>]
### Main arguments
-x <bt2-idx>
The basename of the index for the reference genome. The basename is the name of
any of the index files up to but not including the final `.1.bt2` / `.rev.1.bt2`
/ etc. `bowtie2` looks for the specified index first in the current directory,
then in the directory specified in the `BOWTIE2_INDEXES` environment variable.
-1 <m1>
Comma-separated list of files containing mate 1s (filename usually includes
`_1`), e.g. `-1 flyA_1.fq,flyB_1.fq`. Sequences specified with this option must
correspond file-for-file and read-for-read with those specified in `<m2>`. Reads
may be a mix of different lengths. If `-` is specified, `bowtie2` will read the
mate 1s from the "standard in" or "stdin" filehandle.
-2 <m2>
Comma-separated list of files containing mate 2s (filename usually includes
`_2`), e.g. `-2 flyA_2.fq,flyB_2.fq`. Sequences specified with this option must
correspond file-for-file and read-for-read with those specified in `<m1>`. Reads
may be a mix of different lengths. If `-` is specified, `bowtie2` will read the
mate 2s from the "standard in" or "stdin" filehandle.
-U <r>
Comma-separated list of files containing unpaired reads to be aligned, e.g.
`lane1.fq,lane2.fq,lane3.fq,lane4.fq`. Reads may be a mix of different lengths.
If `-` is specified, `bowtie2` gets the reads from the "standard in" or "stdin"
filehandle.
-S <hit>
File to write SAM alignments to. By default, alignments are written to the
"standard out" or "stdout" filehandle (i.e. the console).
### Options
#### Input options
-q
Reads (specified with `<m1>`, `<m2>`, `<s>`) are FASTQ files. FASTQ files
usually have extension `.fq` or `.fastq`. FASTQ is the default format. See
also: `--solexa-quals` and `--int-quals`.
--interleaved
Reads interleaved FASTQ files where the first two records (8 lines)
represent a mate pair.
--tab5
Each read or pair is on a single line. An unpaired read line is
[name]\t[seq]\t[qual]\n. A paired-end read line is
[name]\t[seq1]\t[qual1]\t[seq2]\t[qual2]\n. An input file can be a
mix of unpaired and paired-end reads and Bowtie 2 recognizes each
according to the number of fields, handling each as it should.
--tab6
Similar to `--tab5` except, for paired-end reads, the second end can have a
different name from the first:
[name1]\t[seq1]\t[qual1]\t[name2]\t[seq2]\t[qual2]\n
--qseq
Reads (specified with `<m1>`, `<m2>`, `<s>`) are QSEQ files. QSEQ files usually
end in `_qseq.txt`. See also: `--solexa-quals` and `--int-quals`.
-f
Reads (specified with `<m1>`, `<m2>`, `<s>`) are FASTA files. FASTA files
usually have extension `.fa`, `.fasta`, `.mfa`, `.fna` or similar. FASTA files
do not have a way of specifying quality values, so when `-f` is set, the result
is as if `--ignore-quals` is also set.
-r
Reads (specified with `<m1>`, `<m2>`, `<s>`) are files with one input sequence
per line, without any other information (no read names, no qualities). When
`-r` is set, the result is as if `--ignore-quals` is also set.
-c
The read sequences are given on command line. I.e. `<m1>`, `<m2>` and
`<singles>` are comma-separated lists of reads rather than lists of read files.
There is no way to specify read names or qualities, so `-c` also implies
`--ignore-quals`.
-s/--skip <int>
Skip (i.e. do not align) the first `<int>` reads or pairs in the input.
-u/--qupto <int>
Align the first `<int>` reads or read pairs from the input (after the
`-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit.
-5/--trim5 <int>
Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0).
-3/--trim3 <int>
Trim `<int>` bases from 3' (right) end of each read before alignment (default:
0).
--phred33
Input qualities are ASCII chars equal to the [Phred quality] plus 33. This is
also called the "Phred+33" encoding, which is used by the very latest Illumina
pipelines.
[Phred quality]: http://en.wikipedia.org/wiki/Phred_quality_score
--phred64
[Phred quality]: http://en.wikipedia.org/wiki/Phred_quality_score
Input qualities are ASCII chars equal to the [Phred quality] plus 64. This is
also called the "Phred+64" encoding.
--solexa-quals
Convert input qualities from [Solexa][Phred quality] (which can be negative) to
[Phred][Phred quality] (which can't). This scheme was used in older Illumina GA
Pipeline versions (prior to 1.3). Default: off.
--int-quals
Quality values are represented in the read input file as space-separated ASCII
integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
Integers are treated as being on the [Phred quality] scale unless
`--solexa-quals` is also specified. Default: off.
#### Preset options in `--end-to-end` mode
--very-fast
Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50`
--fast
Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50`
--sensitive
Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode)
--very-sensitive
Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
#### Preset options in `--local` mode
--very-fast-local
Same as: `-D 5 -R 1 -N 0 -L 25 -i S,1,2.00`
--fast-local
Same as: `-D 10 -R 2 -N 0 -L 22 -i S,1,1.75`
--sensitive-local
Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode)
--very-sensitive-local
Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
#### Alignment options
-N <int>
Sets the number of mismatches to allowed in a seed alignment during [multiseed
alignment]. Can be set to 0 or 1. Setting this higher makes alignment slower
(often much slower) but increases sensitivity. Default: 0.
-L <int>
Sets the length of the seed substrings to align during [multiseed alignment].
Smaller values make alignment slower but more sensitive. Default: the
`--sensitive` preset is used by default, which sets `-L` to 20 both in
`--end-to-end` mode and in `--local` mode.
-i <func>
Sets a function governing the interval between seed substrings to use during
[multiseed alignment]. For instance, if the read has 30 characters, and seed
length is 10, and the seed interval is 6, the seeds extracted will be:
Read: TAGCTACGCTCTACGCTATCATGCATAAAC
Seed 1 fw: TAGCTACGCT
Seed 1 rc: AGCGTAGCTA
Seed 2 fw: CGCTCTACGC
Seed 2 rc: GCGTAGAGCG
Seed 3 fw: ACGCTATCAT
Seed 3 rc: ATGATAGCGT
Seed 4 fw: TCATGCATAA
Seed 4 rc: TTATGCATGA
Since it's best to use longer intervals for longer reads, this parameter sets
the interval as a function of the read length, rather than a single
one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the
interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length.
See also: [setting function options]. If the function returns a result less than
1, it is rounded up to 1. Default: the `--sensitive` preset is used by
default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75`
in `--local` mode.
--n-ceil <func>
Sets a function governing the maximum number of ambiguous characters (usually
`N`s and/or `.`s) allowed in a read as a function of read length. For instance,
specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
where x is the read length. See also: [setting function options]. Reads
exceeding this ceiling are [filtered out]. Default: `L,0,0.15`.
--dpad <int>
"Pads" dynamic programming problems by `<int>` columns on either side to allow
gaps. Default: 15.
--gbar <int>
Disallow gaps within `<int>` positions of the beginning or end of the read.
Default: 4.
--ignore-quals
When calculating a mismatch penalty, always consider the quality value at the
mismatched position to be the highest possible, regardless of the actual value.
I.e. input is treated as though all quality values are high. This is also the
default behavior when the input doesn't specify quality values (e.g. in `-f`,
`-r`, or `-c` modes).
--nofw/--norc
If `--nofw` is specified, `bowtie2` will not attempt to align unpaired reads to
the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will
not attempt to align unpaired reads against the reverse-complement (Crick)
reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those
paired-end configurations corresponding to fragments from the reverse-complement
(Crick) strand. Default: both strands enabled.
--no-1mm-upfront
By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch
end-to-end alignment for the read *before* trying the [multiseed heuristic]. Such
alignments can be found very quickly, and many short read alignments have exact or
near-exact end-to-end alignments. However, this can lead to unexpected
alignments when the user also sets options governing the [multiseed heuristic],
like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal
to the length of the read, the user will be surprised to find 1-mismatch alignments
reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end
alignments before using the [multiseed heuristic], which leads to the expected
behavior when combined with options such as `-L` and `-N`. This comes at the
expense of speed.
--end-to-end
In this mode, Bowtie 2 requires that the entire read align from one end to the
other, without any trimming (or "soft clipping") of characters from either end.
The match bonus `--ma` always equals 0 in this mode, so all alignment scores
are less than or equal to 0, and the greatest possible alignment score is 0.
This is mutually exclusive with `--local`. `--end-to-end` is the default mode.
--local
In this mode, Bowtie 2 does not require that the entire read align from one end
to the other. Rather, some characters may be omitted ("soft clipped") from the
ends in order to achieve the greatest possible alignment score. The match bonus
`--ma` is used in this mode, and the best possible alignment score is equal to
the match bonus (`--ma`) times the length of the read. Specifying `--local`
and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying
the local version of the preset (`--very-fast-local`). This is mutually
exclusive with `--end-to-end`. `--end-to-end` is the default mode.
#### Scoring options
--ma <int>
Sets the match bonus. In `--local` mode `<int>` is added to the alignment
score for each position where a read character aligns to a reference character
and the characters match. Not used in `--end-to-end` mode. Default: 2.
--mp MX,MN
Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A
number less than or equal to `MX` and greater than or equal to `MN` is
subtracted from the alignment score for each position where a read character
aligns to a reference character, the characters do not match, and neither is an
`N`. If `--ignore-quals` is specified, the number subtracted quals `MX`.
Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2.
--np <int>
Sets penalty for positions where the read, reference, or both, contain an
ambiguous character such as `N`. Default: 1.
--rdg <int1>,<int2>
Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties. A read gap of
length N gets a penalty of `<int1>` + N * `<int2>`. Default: 5, 3.
--rfg <int1>,<int2>
Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties. A
reference gap of length N gets a penalty of `<int1>` + N * `<int2>`. Default:
5, 3.
--score-min <func>
Sets a function governing the minimum alignment score needed for an alignment to
be considered "valid" (i.e. good enough to report). This is a function of read
length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting
function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and
the default in `--local` mode is `G,20,8`.
#### Reporting options
-k <int>
By default, `bowtie2` searches for distinct, valid alignments for each read.
When it finds a valid alignment, it continues looking for alignments that are
nearly as good or better. The best alignment found is reported (randomly
selected from among best if tied). Information about the best alignments is
used to estimate mapping quality and to set SAM optional fields, such as
`AS:i` and `XS:i`.
When `-k` is specified, however, `bowtie2` behaves differently. Instead, it
searches for at most `<int>` distinct, valid alignments for each read. The
search terminates when it can't find more distinct valid alignments, or when it
finds `<int>`, whichever happens first. All alignments found are reported in
descending order by alignment score. The alignment score for a paired-end
alignment equals the sum of the alignment scores of the individual mates. Each
reported read or pair alignment beyond the first has the SAM 'secondary' bit
(which equals 256) set in its FLAGS field. For reads that have more than
`<int>` distinct, valid alignments, `bowtie2` does not guarantee that the
`<int>` alignments reported are the best possible in terms of alignment score.
`-k` is mutually exclusive with `-a`.
Note: Bowtie 2 is not designed with large values for `-k` in mind, and when
aligning reads to long, repetitive genomes large `-k` can be very, very slow.
-a
Like `-k` but with no upper limit on number of alignments to search for. `-a`
is mutually exclusive with `-k`.
Note: Bowtie 2 is not designed with `-a` mode in mind, and when
aligning reads to long, repetitive genomes this mode can be very, very slow.
#### Effort options
-D <int>
Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2
moves on, using the alignments found so far. A seed extension "fails" if it
does not yield a new best or a new second-best alignment. This limit is
automatically adjusted up when -k or -a are specified. Default: 15.
-R <int>
`<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with
repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads
(same length, same number of mismatches allowed) at different offsets and
searches for more alignments. A read is considered to have repetitive seeds if
the total number of seed hits divided by the number of seeds that aligned at
least once is greater than 300. Default: 2.
#### Paired-end options
-I/--minins <int>
The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is
specified and a paired-end alignment consists of two 20-bp alignments in the
appropriate orientation with a 20-bp gap between them, that alignment is
considered valid (as long as `-X` is also satisfied). A 19-bp gap would not
be valid in that case. If trimming options `-3` or `-5` are also used, the
`-I` constraint is applied with respect to the untrimmed mates.
The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
run. This is because larger differences between `-I` and `-X` require that
Bowtie 2 scan a larger window to determine if a concordant alignment exists.
For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
efficient.
Default: 0 (essentially imposing no minimum)
-X/--maxins <int>
The maximum fragment length for valid paired-end alignments. E.g. if `-X 100`
is specified and a paired-end alignment consists of two 20-bp alignments in the
proper orientation with a 60-bp gap between them, that alignment is considered
valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in
that case. If trimming options `-3` or `-5` are also used, the `-X`
constraint is applied with respect to the untrimmed mates, not the trimmed
mates.
The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
run. This is because larger differences between `-I` and `-X` require that
Bowtie 2 scan a larger window to determine if a concordant alignment exists.
For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
efficient.
Default: 500.
--fr/--rf/--ff
The upstream/downstream mate orientations for a valid paired-end alignment
against the forward reference strand. E.g., if `--fr` is specified and there is
a candidate paired-end alignment where mate 1 appears upstream of the reverse
complement of mate 2 and the fragment length constraints (`-I` and `-X`) are
met, that alignment is valid. Also, if mate 2 appears upstream of the reverse
complement of mate 1 and all other constraints are met, that too is valid.
`--rf` likewise requires that an upstream mate1 be reverse-complemented and a
downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1
and a downstream mate 2 to be forward-oriented. Default: `--fr` (appropriate
for Illumina's Paired-end Sequencing Assay).
--no-mixed
By default, when `bowtie2` cannot find a concordant or discordant alignment for
a pair, it then tries to find alignments for the individual mates. This option
disables that behavior.
--no-discordant
By default, `bowtie2` looks for discordant alignments if it cannot find any
concordant alignments. A discordant alignment is an alignment where both mates
align uniquely, but that does not satisfy the paired-end constraints
(`--fr`/`--rf`/`--ff`, `-I`, `-X`). This option disables that behavior.
--dovetail
If the mates "dovetail", that is if one mate alignment extends past the
beginning of the other such that the wrong mate begins upstream, consider that
to be concordant. See also: [Mates can overlap, contain or dovetail each
other]. Default: mates cannot dovetail in a concordant alignment.
--no-contain
If one mate alignment contains the other, consider that to be non-concordant.
See also: [Mates can overlap, contain or dovetail each other]. Default: a mate
can contain the other in a concordant alignment.
--no-overlap
If one mate alignment overlaps the other at all, consider that to be
non-concordant. See also: [Mates can overlap, contain or dovetail each other].
Default: mates can overlap in a concordant alignment.
#### Output options
-t/--time
Print the wall-clock time required to load the index files and align the reads.
This is printed to the "standard error" ("stderr") filehandle. Default: off.
--un <path>
--un-gz <path>
--un-bz2 <path>
--un-lz4 <path>
Write unpaired reads that fail to align to file at `<path>`. These reads
correspond to the SAM records with the FLAGS `0x4` bit set and neither the
`0x40` nor `0x80` bits set. If `--un-gz` is specified, output will be gzip
compressed. If `--un-bz2` or `--un-lz4` is specified, output will be bzip2 or
lz4 compressed. Reads written in this way will appear exactly as they did in
the input file, without any modification (same sequence, same name, same quality
string, same quality encoding). Reads will not necessarily appear in the same
order as they did in the input.
--al <path>
--al-gz <path>
--al-bz2 <path>
--al-lz4 <path>
Write unpaired reads that align at least once to file at `<path>`. These reads
correspond to the SAM records with the FLAGS `0x4`, `0x40`, and `0x80` bits
unset. If `--al-gz` is specified, output will be gzip compressed. If `--al-bz2`
is specified, output will be bzip2 compressed. Similarly if `--al-lz4` is specified,
output will be lz4 compressed. Reads written in this way will
appear exactly as they did in the input file, without any modification (same
sequence, same name, same quality string, same quality encoding). Reads will
not necessarily appear in the same order as they did in the input.
--un-conc <path>
--un-conc-gz <path>
--un-conc-bz2 <path>
--un-conc-lz4 <path>
Write paired-end reads that fail to align concordantly to file(s) at `<path>`.
These reads correspond to the SAM records with the FLAGS `0x4` bit set and
either the `0x40` or `0x80` bit set (depending on whether it's mate #1 or #2).
`.1` and `.2` strings are added to the filename to distinguish which file
contains mate #1 and mate #2. If a percent symbol, `%`, is used in `<path>`,
the percent symbol is replaced with `1` or `2` to make the per-mate filenames.
Otherwise, `.1` or `.2` are added before the final dot in `<path>` to make the
per-mate filenames. Reads written in this way will appear exactly as they did
in the input files, without any modification (same sequence, same name, same
quality string, same quality encoding). Reads will not necessarily appear in
the same order as they did in the inputs.
--al-conc <path>
--al-conc-gz <path>
--al-conc-bz2 <path>
--al-conc-lz4 <path>
Write paired-end reads that align concordantly at least once to file(s) at
`<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit
unset and either the `0x40` or `0x80` bit set (depending on whether it's mate #1
or #2). `.1` and `.2` strings are added to the filename to distinguish which
file contains mate #1 and mate #2. If a percent symbol, `%`, is used in
`<path>`, the percent symbol is replaced with `1` or `2` to make the per-mate
filenames. Otherwise, `.1` or `.2` are added before the final dot in `<path>` to
make the per-mate filenames. Reads written in this way will appear exactly as
they did in the input files, without any modification (same sequence, same name,
same quality string, same quality encoding). Reads will not necessarily appear
in the same order as they did in the inputs.
--quiet
Print nothing besides alignments and serious errors.
--met-file <path>
Write `bowtie2` metrics to file `<path>`. Having alignment metric can be useful
for debugging certain problems, especially performance issues. See also:
`--met`. Default: metrics disabled.
--met-stderr <path>
Write `bowtie2` metrics to the "standard error" ("stderr") filehandle. This is
not mutually exclusive with `--met-file`. Having alignment metric can be
useful for debugging certain problems, especially performance issues. See also:
`--met`. Default: metrics disabled.
--met <int>
Write a new `bowtie2` metrics record every `<int>` seconds. Only matters if
either `--met-stderr` or `--met-file` are specified. Default: 1.
#### SAM options
--no-unal
Suppress SAM records for reads that failed to align.
--no-hd
Suppress SAM header lines (starting with `@`).
--no-sq
Suppress `@SQ` SAM header lines.
--rg-id <text>
Set the read group ID to `<text>`. This causes the SAM `@RG` header line to be
printed, with `<text>` as the value associated with the `ID:` tag. It also
causes the `RG:Z:` extra field to be attached to each SAM output record, with
value set to `<text>`.
--rg <text>
Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
`@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id`
must also be specified. This is because the `ID` tag is required by the [SAM
Spec][SAM]. Specify `--rg` multiple times to set multiple fields. See the
[SAM Spec][SAM] for details about what fields are legal.
--omit-sec-seq
When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`
and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterisk
in those fields instead.
#### Performance options
-o/--offrate <int>
Override the offrate of the index with `<int>`. If `<int>` is greater
than the offrate used to build the index, then some row markings are
discarded when the index is read into memory. This reduces the memory
footprint of the aligner but requires more time to calculate text
offsets. `<int>` must be greater than the value used to build the
index.
-p/--threads NTHREADS
Launch `NTHREADS` parallel search threads (default: 1). Threads will run on
separate processors/cores and synchronize when parsing reads and outputting
alignments. Searching for alignments is highly parallel, and speedup is close
to linear. Increasing `-p` increases Bowtie 2's memory footprint. E.g. when
aligning to a human genome index, increasing `-p` from 1 to 8 increases the
memory footprint by a few hundred megabytes. This option is only available if
`bowtie` is linked with the `pthreads` library (i.e. if `BOWTIE_PTHREADS=0` is
not specified at build time).
--reorder
Guarantees that output SAM records are printed in an order corresponding to the
order of the reads in the original input file, even when `-p` is set greater
than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie
2 to run somewhat slower and use somewhat more memory then if `--reorder` were
not specified. Has no effect if `-p` is set to 1, since output order will
naturally correspond to input order in that case.
--mm
Use memory-mapped I/O to load the index, rather than typical file I/O.
Memory-mapping allows many concurrent `bowtie` processes on the same computer to
share the same memory image of the index (i.e. you pay the memory overhead just
once). This facilitates memory-efficient parallelization of `bowtie` in
situations where using `-p` is not possible or not preferable.
#### Other options
--qc-filter
Filter out reads for which the QSEQ filter field is non-zero. Only has an
effect when read format is `--qseq`. Default: off.
--seed <int>
Use `<int>` as the seed for pseudo-random number generator. Default: 0.
--non-deterministic
Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It
seeds the generator with a number derived from (a) the read name, (b) the
nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed`
option. This means that if two reads are identical (same name, same
nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s)
for both, even if there was ambiguity. When `--non-deterministic` is specified,
Bowtie 2 re-initializes its pseudo-random generator for each read using the
current time. This means that Bowtie 2 will not necessarily report the same
alignment for two identical reads. This is counter-intuitive for some users,
but might be more appropriate in situations where the input consists of many
identical reads.
--version
Print version information and quit.
-h/--help
Print usage information and quit.
SAM output
----------
Following is a brief description of the [SAM] format as output by `bowtie2`.
For more details, see the [SAM format specification][SAM].
By default, `bowtie2` prints a SAM header with `@HD`, `@SQ` and `@PG` lines.
When one or more `--rg` arguments are specified, `bowtie2` will also print
an `@RG` line that includes all user-specified `--rg` tokens separated by
tabs.
Each subsequent line describes an alignment or, if the read failed to align, a
read. Each line is a collection of at least 12 fields separated by tabs; from
left to right, the fields are:
1. Name of read that aligned.
Note that the [SAM specification] disallows whitespace in the read name.
If the read name contains any whitespace characters, Bowtie 2 will truncate
the name at the first whitespace character. This is similar to the
behavior of other tools. The standard behavior of truncating at the first
whitespace can be suppressed with `--sam-noqname-trunc` at the expense of
generating non-standard SAM.
2. Sum of all applicable flags. Flags relevant to Bowtie are:
1
The read is one of a pair
2
The alignment is one end of a proper paired-end alignment
4
The read has no reported alignments
8
The read is one of a pair and has no reported alignments
16
The alignment is to the reverse reference strand
32
The other mate in the paired-end alignment is aligned to the
reverse reference strand
64
The read is mate 1 in a pair
128
The read is mate 2 in a pair
Thus, an unpaired read that aligns to the reverse reference strand
will have flag 16. A paired-end read that aligns and is the first
mate in the pair will have flag 83 (= 64 + 16 + 2 + 1).
3. Name of reference sequence where alignment occurs
4. 1-based offset into the forward reference strand where leftmost
character of the alignment occurs
5. Mapping quality
6. CIGAR string representation of alignment
7. Name of reference sequence where mate's alignment occurs. Set to `=` if the
mate's reference sequence is the same as this alignment's, or `*` if there is no
mate.
8. 1-based offset into the forward reference strand where leftmost character of
the mate's alignment occurs. Offset is 0 if there is no mate.
9. Inferred fragment length. Size is negative if the mate's alignment occurs
upstream of this alignment. Size is 0 if the mates did not align concordantly.
However, size is non-0 if the mates aligned discordantly to the same
chromosome.
10. Read sequence (reverse-complemented if aligned to the reverse strand)
11. ASCII-encoded read qualities (reverse-complemented if the read aligned to
the reverse strand). The encoded quality values are on the [Phred quality]
scale and the encoding is ASCII-offset by 33 (ASCII char `!`), similarly to a
[FASTQ] file.
12. Optional fields. Fields are tab-separated. `bowtie2` outputs zero or more
of these optional fields for each alignment, depending on the type of the
alignment:
AS:i:<N>
Alignment score. Can be negative. Can be greater than 0 in `--local`
mode (but not in `--end-to-end` mode). Only present if SAM record is for
an aligned read.
XS:i:<N>
Alignment score for the best-scoring alignment found other than the
alignment reported. Can be negative. Can be greater than 0 in `--local`
mode (but not in `--end-to-end` mode). Only present if the SAM record is
for an aligned read and more than one alignment was found for the read.
Note that, when the read is part of a concordantly-aligned pair, this score
could be greater than `AS:i`.
YS:i:<N>
Alignment score for opposite mate in the paired-end alignment. Only present
if the SAM record is for a read that aligned as part of a paired-end
alignment.
XN:i:<N>
The number of ambiguous bases in the reference covering this alignment.
Only present if SAM record is for an aligned read.
XM:i:<N>
The number of mismatches in the alignment. Only present if SAM record is
for an aligned read.
XO:i:<N>
The number of gap opens, for both read and reference gaps, in the alignment.
Only present if SAM record is for an aligned read.
XG:i:<N>
The number of gap extensions, for both read and reference gaps, in the
alignment. Only present if SAM record is for an aligned read.
NM:i:<N>
The edit distance; that is, the minimal number of one-nucleotide edits
(substitutions, insertions and deletions) needed to transform the read
string into the reference string. Only present if SAM record is for an
aligned read.
YF:Z:<S>
String indicating reason why the read was filtered out. See also:
[Filtering]. Only appears for reads that were filtered out.
YT:Z:<S>
Value of `UU` indicates the read was not part of a pair. Value of `CP`
indicates the read was part of a pair and the pair aligned concordantly.
Value of `DP` indicates the read was part of a pair and the pair aligned
discordantly. Value of `UP` indicates the read was part of a pair but the
pair failed to aligned either concordantly or discordantly.
MD:Z:<S>
A string representation of the mismatched reference bases in the alignment.
See [SAM] format specification for details. Only present if SAM record is
for an aligned read.
[SAM format specification]: http://samtools.sf.net/SAM1.pdf
[FASTQ]: http://en.wikipedia.org/wiki/FASTQ_format
The `bowtie2-build` indexer
===========================
`bowtie2-build` builds a Bowtie index from a set of DNA sequences.
`bowtie2-build` outputs a set of 6 files with suffixes `.1.bt2`, `.2.bt2`,
`.3.bt2`, `.4.bt2`, `.rev.1.bt2`, and `.rev.2.bt2`. In the case of a large
index these suffixes will have a `bt2l` termination. These files together
constitute the index: they are all that is needed to align reads to that
reference. The original sequence FASTA files are no longer used by Bowtie 2
once the index is built.
Bowtie 2's `.bt2` index format is different from Bowtie 1's `.ebwt` format, and
they are not compatible with each other.
Use of Karkkainen's [blockwise algorithm] allows `bowtie2-build` to trade off
between running time and memory usage. `bowtie2-build` has three options
governing how it makes this trade: `-p`/`--packed`, `--bmax`/`--bmaxdivn`,
and `--dcv`. By default, `bowtie2-build` will automatically search for the
settings that yield the best running time without exhausting memory. This
behavior can be disabled using the `-a`/`--noauto` option.
The indexer provides options pertaining to the "shape" of the index, e.g.
`--offrate` governs the fraction of [Burrows-Wheeler]
rows that are "marked" (i.e., the density of the suffix-array sample; see the
original [FM Index] paper for details). All of these options are potentially
profitable trade-offs depending on the application. They have been set to
defaults that are reasonable for most cases according to our experiments. See
[Performance tuning] for details.
`bowtie2-build` can generate either [small or large indexes]. The wrapper
will decide which based on the length of the input genome. If the reference
does not exceed 4 billion characters but a large index is preferred, the user
can specify `--large-index` to force `bowtie2-build` to build a large index
instead.
The Bowtie 2 index is based on the [FM Index] of Ferragina and Manzini, which in
turn is based on the [Burrows-Wheeler] transform. The algorithm used to build
the index is based on the [blockwise algorithm] of Karkkainen.
[Blockwise algorithm]: http://portal.acm.org/citation.cfm?id=1314852
[blockwise algorithm]: http://portal.acm.org/citation.cfm?id=1314852
[FM Index]: http://portal.acm.org/citation.cfm?id=796543
[Burrows-Wheeler]: http://en.wikipedia.org/wiki/Burrows-Wheeler_transform
Command Line
------------
Usage:
bowtie2-build [options]* <reference_in> <bt2_base>
### Main arguments
A comma-separated list of FASTA files containing the reference sequences to be
aligned to, or, if `-c` is specified, the sequences
themselves. E.g., `<reference_in>` might be `chr1.fa,chr2.fa,chrX.fa,chrY.fa`,
or, if `-c` is specified, this might be
`GGTCATCCT,ACGGGTCGT,CCGTTCTATGCGGCTTA`.
The basename of the index files to write. By default, `bowtie2-build` writes
files named `NAME.1.bt2`, `NAME.2.bt2`, `NAME.3.bt2`, `NAME.4.bt2`,
`NAME.rev.1.bt2`, and `NAME.rev.2.bt2`, where `NAME` is `<bt2_base>`.
### Options
-f
The reference input files (specified as `<reference_in>`) are FASTA files
(usually having extension `.fa`, `.mfa`, `.fna` or similar).
-c
The reference sequences are given on the command line. I.e. `<reference_in>` is
a comma-separated list of sequences rather than a list of FASTA files.
--large-index
Force `bowtie2-build` to build a [large index], even if the reference is less
than ~ 4 billion nucleotides inlong.
-a/--noauto
Disable the default behavior whereby `bowtie2-build` automatically selects
values for the `--bmax`, `--dcv` and `--packed` parameters according to
available memory. Instead, user may specify values for those parameters. If
memory is exhausted during indexing, an error message will be printed; it is up
to the user to try new parameters.
-p/--packed
Use a packed (2-bits-per-nucleotide) representation for DNA strings. This saves
memory but makes indexing 2-3 times slower. Default: off. This is configured
automatically by default; use `-a`/`--noauto` to configure manually.
--bmax <int>
The maximum number of suffixes allowed in a block. Allowing more suffixes per
block makes indexing faster, but increases peak memory usage. Setting this
option overrides any previous setting for `--bmax`, or `--bmaxdivn`.
Default (in terms of the `--bmaxdivn` parameter) is `--bmaxdivn` 4 * number of threads. This is
configured automatically by default; use `-a`/`--noauto` to configure manually.
--bmaxdivn <int>
The maximum number of suffixes allowed in a block, expressed as a fraction of
the length of the reference. Setting this option overrides any previous setting
for `--bmax`, or `--bmaxdivn`. Default: `--bmaxdivn` 4 * number of threads. This is
configured automatically by default; use `-a`/`--noauto` to configure manually.
--dcv <int>
Use `<int>` as the period for the difference-cover sample. A larger period
yields less memory overhead, but may make suffix sorting slower, especially if
repeats are present. Must be a power of 2 no greater than 4096. Default: 1024.
This is configured automatically by default; use `-a`/`--noauto` to configure
manually.
--nodc
Disable use of the difference-cover sample. Suffix sorting becomes
quadratic-time in the worst case (where the worst case is an extremely
repetitive reference). Default: off.
-r/--noref
Do not build the `NAME.3.bt2` and `NAME.4.bt2` portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.
-3/--justref
Build only the `NAME.3.bt2` and `NAME.4.bt2` portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.
-o/--offrate <int>
To map alignments back to positions on the reference sequences, it's necessary
to annotate ("mark") some or all of the [Burrows-Wheeler] rows with their
corresponding location on the genome.
`-o`/`--offrate` governs how many rows get marked:
the indexer will mark every 2^`<int>` rows. Marking more rows makes
reference-position lookups faster, but requires more memory to hold the
annotations at runtime. The default is 5 (every 32nd row is marked; for human
genome, annotations occupy about 340 megabytes).
-t/--ftabchars <int>
The ftab is the lookup table used to calculate an initial [Burrows-Wheeler]
range with respect to the first `<int>` characters of the query. A larger
`<int>` yields a larger lookup table but faster query times. The ftab has size
4^(`<int>`+1) bytes. The default setting is 10 (ftab is 4MB).
--seed <int>
Use `<int>` as the seed for pseudo-random number generator.
--cutoff <int>
Index only the first `<int>` bases of the reference sequences (cumulative across
sequences) and ignore the rest.
-q/--quiet
`bowtie2-build` is verbose by default. With this option `bowtie2-build` will
print only error messages.
--threads <int>
By default `bowtie2-build` is using only one thread. Increasing the number
of threads will speed up the index building considerably in most cases.
-h/--help
Print usage information and quit.
--version
Print version information and quit.
The `bowtie2-inspect` index inspector
=====================================
`bowtie2-inspect` extracts information from a Bowtie index about what kind of
index it is and what reference sequences were used to build it. When run without
any options, the tool will output a FASTA file containing the sequences of the
original references (with all non-`A`/`C`/`G`/`T` characters converted to `N`s).
It can also be used to extract just the reference sequence names using the
`-n`/`--names` option or a more verbose summary using the `-s`/`--summary`
option.
Command Line
------------
Usage:
bowtie2-inspect [options]* <bt2_base>
### Main arguments
The basename of the index to be inspected. The basename is name of any of the
index files but with the `.X.bt2` or `.rev.X.bt2` suffix omitted.
`bowtie2-inspect` first looks in the current directory for the index files, then
in the directory specified in the `BOWTIE2_INDEXES` environment variable.
### Options
-a/--across <int>
When printing FASTA output, output a newline character every `<int>` bases
(default: 60).
-n/--names
Print reference sequence names, one per line, and quit.
-s/--summary
Print a summary that includes information about index settings, as well as the
names and lengths of the input sequences. The summary has this format:
Colorspace <0 or 1>
SA-Sample 1 in <sample>
FTab-Chars <chars>
Sequence-1 <name> <len>
Sequence-2 <name> <len>
...
Sequence-N <name> <len>
Fields are separated by tabs. Colorspace is always set to 0 for Bowtie 2.
-v/--verbose
Print verbose output (for debugging).
--version
Print version information and quit.
-h/--help
Print usage information and quit.
Getting started with Bowtie 2: Lambda phage example
===================================================
Bowtie 2 comes with some example files to get you started. The example files
are not scientifically significant; we use the [Lambda phage] reference genome
simply because it's short, and the reads were generated by a computer program,
not a sequencer. However, these files will let you start running Bowtie 2 and
downstream tools right away.
First follow the manual instructions to [obtain Bowtie 2]. Set the `BT2_HOME`
environment variable to point to the new Bowtie 2 directory containing the
`bowtie2`, `bowtie2-build` and `bowtie2-inspect` binaries. This is important,
as the `BT2_HOME` variable is used in the commands below to refer to that
directory.
[Lambda phage]: http://en.wikipedia.org/wiki/Lambda_phage
Indexing a reference genome
---------------------------
To create an index for the [Lambda phage] reference genome included with Bowtie
2, create a new temporary directory (it doesn't matter where), change into that
directory, and run:
$BT2_HOME/bowtie2-build $BT2_HOME/example/reference/lambda_virus.fa lambda_virus
The command should print many lines of output then quit. When the command
completes, the current directory will contain four new files that all start with
`lambda_virus` and end with `.1.bt2`, `.2.bt2`, `.3.bt2`, `.4.bt2`,
`.rev.1.bt2`, and `.rev.2.bt2`. These files constitute the index - you're done!
You can use `bowtie2-build` to create an index for a set of FASTA files obtained
from any source, including sites such as [UCSC], [NCBI], and [Ensembl]. When
indexing multiple FASTA files, specify all the files using commas to separate
file names. For more details on how to create an index with `bowtie2-build`,
see the [manual section on index building]. You may also want to bypass this
process by obtaining a pre-built index. See [using a pre-built index] below
for an example.
[UCSC]: http://genome.ucsc.edu/cgi-bin/hgGateway
[NCBI]: http://www.ncbi.nlm.nih.gov/sites/genome
[Ensembl]: http://www.ensembl.org/
Aligning example reads
----------------------
Stay in the directory created in the previous step, which now contains the
`lambda_virus` index files. Next, run:
$BT2_HOME/bowtie2 -x lambda_virus -U $BT2_HOME/example/reads/reads_1.fq -S eg1.sam
This runs the Bowtie 2 aligner, which aligns a set of unpaired reads to the
[Lambda phage] reference genome using the index generated in the previous step.
The alignment results in SAM format are written to the file `eg1.sam`, and a
short alignment summary is written to the console. (Actually, the summary is
written to the "standard error" or "stderr" filehandle, which is typically
printed to the console.)
To see the first few lines of the SAM output, run:
head eg1.sam
You will see something like this:
@HD VN:1.0 SO:unsorted
@SQ SN:gi|9626243|ref|NC_001416.1| LN:48502
@PG ID:bowtie2 PN:bowtie2 VN:2.0.1
r1 0 gi|9626243|ref|NC_001416.1| 18401 42 122M * 0 0 TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG +"@6<:27(F&5)9)"B:%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C> AS:i:-5 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:59G13G21G26 YT:Z:UU
r2 0 gi|9626243|ref|NC_001416.1| 8886 42 275M * 0 0 NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC '%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+ AS:i:-14 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:0A0C0G0A108C23G9T81T46 YT:Z:UU
r3 16 gi|9626243|ref|NC_001416.1| 11599 42 338M * 0 0 GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT 7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04C<E,*AD%G0.%$+A:'H;?8<72:88?E6((CF)6DF#.)=>B>D-="C'B080E'5BH"77':"@70#4%A5=6.2/1>;9"&-H6)=$/0;5E:<8G!@::1?2DC7C*;@*#.1C0.D>H/20,!"C-#,6@%<+<D(AG-).?&#0.00'@)/F8?B!&"170,)>:?<A7#1(A@0E#&A.*DC.E")AH"+.,5,2>5"2?:G,F"D0B8D-6$65D<D!A/38860.*4;4B<*31?6 AS:i:-22 XN:i:0 XM:i:8 XO:i:0 XG:i:0 NM:i:8 MD:Z:80C4C16A52T23G30A8T76A41 YT:Z:UU
r4 0 gi|9626243|ref|NC_001416.1| 40075 42 184M * 0 0 GGGCCAATGCGCTTACTGATGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGAGAATTAACNGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTCATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGT(=8B)GD04*G%&4F,1'A>.C&7=F$,+#6!))43C,5/5+)?-/0>/D3=-,2/+.1?@->;)00!'3!7BH$G)HG+ADC'#-9F)7<7"$?&.>0)@5;4,!0-#C!15CF8&HB+B==H>7,/)C5)5*+(F5A%D,EA<(>G9E0>7&/E?4%;#'92)<5+@7:A.(BG@BG86@.G AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:77C106 YT:Z:UU
r5 0 gi|9626243|ref|NC_001416.1| 48010 42 138M * 0 0 GTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTT 9''%<D)A03E1-*7=),:F/0!6,D9:H,<9D%:0B(%'E,(8EFG$E89B$27G8F*2+4,-!,0D5()&=(FGG:5;3*@/.0F-G#5#3->('FDFEG?)5.!)"AGADB3?6(@H(:B<>6!>;>6>G,."?% AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:138 YT:Z:UU
r6 16 gi|9626243|ref|NC_001416.1| 41607 42 72M2D119M * 0 0 TCGATTTGCAAATACCGGAACATCTCGGTAACTGCATATTCTGCATTAAAAAATCAACGCAAAAAATCGGACGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATNCCATGTGCGTGACGGNCATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAATGTCGCT 1H#G;H"$E*E#&"*)2%66?=9/9'=;4)4/>@%+5#@#$4A*!<D=="8#1*A9BA=:(1+#C&.#(3#H=9E)AC*5,AC#E'536*2?)H14?>9'B=7(3H/B:+A:8%1-+#(E%&$$&14"76D?>7(&20H5%*&CF8!G5B+A4F$7(:"'?0$?G+$)B-?2<0<F=D!38BH,%=8&5@+ AS:i:-13 XN:i:0 XM:i:2 XO:i:1 XG:i:2 NM:i:4 MD:Z:72^TT55C15A47 YT:Z:UU
r7 16 gi|9626243|ref|NC_001416.1| 4692 42 143M * 0 0 TCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATCGCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACAGCATTCTGCTCGATATGGACANGCCCGGCGGGATGGTGGCGGGG -"/@*7A0)>2,AAH@&"%B)*5*23B/,)90.B@%=FE,E063C9?,:26$-0:,.,1849'4.;F>FA;76+5&$<C":$!A*,<B,<)@<'85D%C*:)30@85;?.B$05=@95DCDH<53!8G:F:B7/A.E':434> AS:i:-6 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:98G21C22 YT:Z:UU
The first few lines (beginning with `@`) are SAM header lines, and the rest of
the lines are SAM alignments, one line per read or mate. See the [Bowtie 2
manual section on SAM output] and the [SAM specification] for details about how
to interpret the SAM file format.
Paired-end example
------------------
To align paired-end reads included with Bowtie 2, stay in the same directory and
run:
$BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam
This aligns a set of paired-end reads to the reference genome, with results
written to the file `eg2.sam`.
Local alignment example
-----------------------
To use [local alignment] to align some longer reads included with Bowtie 2, stay
in the same directory and run:
$BT2_HOME/bowtie2 --local -x lambda_virus -U $BT2_HOME/example/reads/longreads.fq -S eg3.sam
This aligns the long reads to the reference genome using local alignment, with
results written to the file `eg3.sam`.
Using SAMtools/BCFtools downstream
----------------------------------
[SAMtools] is a collection of tools for manipulating and analyzing SAM and BAM
alignment files. [BCFtools] is a collection of tools for calling variants and
manipulating VCF and BCF files, and it is typically distributed with [SAMtools].
Using these tools together allows you to get from alignments in SAM format to
variant calls in VCF format. This example assumes that `samtools` and
`bcftools` are installed and that the directories containing these binaries are
in your [PATH environment variable].
Run the paired-end example:
$BT2_HOME/bowtie2 -x $BT2_HOME/example/index/lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam
Use `samtools view` to convert the SAM file into a BAM file. BAM is the
binary format corresponding to the SAM text format. Run:
samtools view -bS eg2.sam > eg2.bam
Use `samtools sort` to convert the BAM file to a sorted BAM file.
samtools sort eg2.bam -o eg2.sorted.bam
We now have a sorted BAM file called `eg2.sorted.bam`. Sorted BAM is a useful
format because the alignments are (a) compressed, which is convenient for
long-term storage, and (b) sorted, which is conveneint for variant discovery.
To generate variant calls in VCF format, run:
samtools mpileup -uf $BT2_HOME/example/reference/lambda_virus.fa eg2.sorted.bam | bcftools view -Ov - > eg2.raw.bcf
Then to view the variants, run:
bcftools view eg2.raw.bcf
See the official SAMtools guide to [Calling SNPs/INDELs with SAMtools/BCFtools]
for more details and variations on this process.
[SAMtools]: http://samtools.sourceforge.net/
[BCFtools]: http://samtools.sourceforge.net/mpileup.shtml
[PATH environment variable]: http://en.wikipedia.org/wiki/PATH_(variable)
[Calling SNPs/INDELs with SAMtools/BCFtools]: http://samtools.sourceforge.net/mpileup.shtml