N E X T F L O W ~ version 23.04.1 Launching `cfia-ncfad-nf-flu-3.3.2/workflow/main.nf` [jolly_swirles] DSL2 - revision: 91a5d05f86 Core Nextflow options runName : jolly_swirles containerEngine : singularity launchDir : IRVC20230720IHN1_analysis/IRVC20230720IHN1_Complete_Run workDir : IRVC20230720IHN1_analysis/IRVC20230720IHN1_Complete_Run/IRVC20230720IH1_Part1_Complete_AF25_RV00831_nf-flu_results/work projectDir : cfia-ncfad-nf-flu-3.3.2/workflow userName : cbuchanan profile : singularity,slurm configFiles : cfia-ncfad-nf-flu-3.3.2/workflow/nextflow.config Input/output options input : IRVC20230720IH1_Part1_Complete_AF25_RV00831.csv platform : nanopore outdir : IRVC20230720IH1_Part1_Complete_AF25_RV00831_nf-flu_results Variant calling options major_allele_fraction : 0.25 IRMA assembly options keep_ref_deletions : true skip_irma_subtyping_report: true Max job request options max_memory : 32 GB [Only displaying parameters that differ from pipeline default] ------------------------------------------------------ ------------------------------------------------------ [- ] process > NF_FLU:NANOPORE:CHECK_SAMPL... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:CHECK_SAMPL... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:BLAST_MAKEB... - [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - [- ] process > NF_FLU:NANOPORE:CHECK_SAMPL... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:BLAST_MAKEB... - [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:BLAST_MAKEB... - [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:ZSTD_DECOMP... - [- ] process > NF_FLU:NANOPORE:BLAST_MAKEB... - [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (2) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [ 0%] 0 of 1 [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [- ] process > NF_FLU:NANOPORE:BLAST_MAKEB... - [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (2) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [ 0%] 0 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [- ] process > NF_FLU:NANOPORE:BLAST_MAKEB... - [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (3) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (3) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (3) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:CAT_NANOPOR... - [- ] process > NF_FLU:NANOPORE:IRMA - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (3), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [ 0%] 0 of 1 [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (4), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (4), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (4), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:PULL_TOP_RE... - [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (5), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (5), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:SEQTK_SEQ - [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (7), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [39/822217] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (12), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [6a/18817d] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (13), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (13), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MINIMAP2 - [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (16), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (21), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (21), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (21), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 0%] 0 of 8 [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (21), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [05/51cd02] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 12%] 1 of 8 [- ] process > NF_FLU:NANOPORE:MOSDEPTH_GE... - [- ] process > NF_FLU:NANOPORE:CLAIR3 - [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (22), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [45/9cfb66] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 50%] 4 of 8 [df/8b8cd7] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 0%] 0 of 4 [- ] process > NF_FLU:NANOPORE:CLAIR3 [ 0%] 0 of 4 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (23), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [90/5d9f6b] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 62%] 5 of 8 [df/8b8cd7] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 0%] 0 of 5 [95/1aa959] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 5 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (23), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 75%] 6 of 8 [df/8b8cd7] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 0%] 0 of 6 [95/1aa959] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (24), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 75%] 6 of 8 [df/8b8cd7] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 0%] 0 of 6 [26/48ebe7] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (25), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 75%] 6 of 8 [b0/3ec2f1] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 0%] 0 of 6 [26/48ebe7] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (27), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 75%] 6 of 8 [2f/159c4a] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 0%] 0 of 6 [49/48b390] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (32), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 75%] 6 of 8 [c4/3083c2] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 16%] 1 of 6 [a9/d9124d] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (33), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 75%] 6 of 8 [c4/3083c2] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 16%] 1 of 6 [1c/751bbd] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (33), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [5d/124df4] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 75%] 6 of 8 [c4/3083c2] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 50%] 3 of 6 [1c/751bbd] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (34), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [57/5e1b27] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 87%] 7 of 8 [9c/ec0938] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 42%] 3 of 7 [49/48b390] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 14%] 1 of 7 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (35), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [57/5e1b27] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 87%] 7 of 8 [7e/0c9177] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 71%] 5 of 7 [47/7ba20a] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 14%] 1 of 7 [- ] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (36), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [57/5e1b27] process > NF_FLU:NANOPORE:MINIMAP2 (R... [ 87%] 7 of 8 [7e/0c9177] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 71%] 5 of 7 [47/7ba20a] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 14%] 1 of 7 [1d/5dfb5f] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (36), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [7e/0c9177] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 62%] 5 of 8 [95/1aa959] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 25%] 2 of 8 [1d/5dfb5f] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 0%] 0 of 2 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (37), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 75%] 6 of 8 [1c/751bbd] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [1d/5dfb5f] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 0%] 0 of 6 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... - [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (38), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [9c/ec0938] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 87%] 7 of 8 [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [1d/5dfb5f] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 16%] 1 of 6 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (39), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [9c/ec0938] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 87%] 7 of 8 [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [0f/23ece4] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 16%] 1 of 6 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (41), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [9c/ec0938] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 87%] 7 of 8 [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [61/7ba474] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 16%] 1 of 6 [- ] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (44), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [9c/ec0938] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [ 87%] 7 of 8 [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 16%] 1 of 6 [98/65fd32] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (44), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 16%] 1 of 6 [98/65fd32] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS - [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT - [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS - [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (48), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [1b/60446d] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 16%] 1 of 6 [- ] process > NF_FLU:NANOPORE:BCFTOOLS_STATS [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:COVERAGE_PLOT [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:BCF_CONSENSUS [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (52), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 16%] 1 of 6 [1e/18c43c] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [ 0%] 0 of 1 [ec/db5945] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 1 [8b/ea57ee] process > NF_FLU:NANOPORE:BCF_CONSENS... [ 0%] 0 of 1 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (52), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [07/851485] process > NF_FLU:NANOPORE:VCF_FILTER_... [ 50%] 3 of 6 [1e/18c43c] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [ 0%] 0 of 3 [ec/db5945] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 3 [8b/ea57ee] process > NF_FLU:NANOPORE:BCF_CONSENS... [ 0%] 0 of 3 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (57), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [32/a9b2cf] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [ 16%] 1 of 6 [0c/eb9926] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 6 [8b/ea57ee] process > NF_FLU:NANOPORE:BCF_CONSENS... [ 16%] 1 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (62), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [e9/4ed7da] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [ 16%] 1 of 6 [91/58134e] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 6 [4f/3ca792] process > NF_FLU:NANOPORE:BCF_CONSENS... [ 16%] 1 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (67), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [82/8df322] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [ 16%] 1 of 6 [e3/5d59e8] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 6 [24/50a2f8] process > NF_FLU:NANOPORE:BCF_CONSENS... [ 16%] 1 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (67), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [9b/9f7ae7] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [ 33%] 2 of 6 [e3/5d59e8] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 6 [2f/431c99] process > NF_FLU:NANOPORE:BCF_CONSENS... [ 33%] 2 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (67), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 75%] 6 of 8 [db/2c3eb1] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 6 of 6 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [82/8df322] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [100%] 6 of 6 [e3/5d59e8] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 6 [24/50a2f8] process > NF_FLU:NANOPORE:BCF_CONSENS... [100%] 6 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (68), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [47/7ba20a] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [ 87%] 7 of 8 [6e/d4a3b2] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 85%] 6 of 7 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [82/8df322] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [100%] 6 of 6 [e3/5d59e8] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 6 [24/50a2f8] process > NF_FLU:NANOPORE:BCF_CONSENS... [100%] 6 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - executor > slurm (68), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [100%] 8 of 8 ✔ [6e/d4a3b2] process > NF_FLU:NANOPORE:BCF_FILTER_... [ 75%] 6 of 8 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [82/8df322] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [100%] 6 of 6 [e3/5d59e8] process > NF_FLU:NANOPORE:COVERAGE_PL... [ 0%] 0 of 6 [24/50a2f8] process > NF_FLU:NANOPORE:BCF_CONSENS... [100%] 6 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - ERROR ~ Error executing process > 'NF_FLU:NANOPORE:BCF_FILTER_CLAIR3 (RV00831-22-IAV|3_PA|OQ234674.1)' Caused by: Process `NF_FLU:NANOPORE:BCF_FILTER_CLAIR3 (RV00831-22-IAV|3_PA|OQ234674.1)` terminated with an error exit status (255) Command executed: bcftools norm \ -Ov \ -m- \ -f RV00831-22-IAV.Segment_3_PA.OQ234674.1.reference.fasta \ RV00831-22-IAV.Segment_3_PA.OQ234674.1.clair3.vcf.gz \ > norm.vcf # filter for major alleles bcftools filter \ -e "%FILTER='RefCall' | AF < 0.25" \ norm.vcf \ -Ov \ -o RV00831-22-IAV.Segment_3_PA.OQ234674.1.bcftools_filt.vcf cat <<-END_VERSIONS > versions.yml "NF_FLU:NANOPORE:BCF_FILTER_CLAIR3": bcftools: $(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*$//') END_VERSIONS Command exit status: 255 Command output: (empty) Command error: Non-ACGTN reference allele at OQ234674.1:1946 .. REF_SEQ:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGANTTTCAGCAGAGTC' vs VCF:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGAYTTTCAGCAGAGTC' Work dir: IRVC20230720IHN1_analysis/IRVC20230720IHN1_Complete_Run/IRVC20230720IH1_Part1_Complete_AF25_RV00831_nf-flu_results/work/6e/d4a3b24dfb32920d6d6bc9220ea517 Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line -- Check '.nextflow.log' file for details Pipeline execution summary --------------------------- Completed at : 2023-08-15T15:55:53.187775554-05:00 Duration : 5m 54s Success : false Results Dir : IRVC20230720IHN1_analysis/IRVC20230720IHN1_Complete_Run/IRVC20230720IH1_Part1_Complete_AF25_RV00831_nf-flu_results Work Dir : IRVC20230720IHN1_analysis/IRVC20230720IHN1_Complete_Run/IRVC20230720IH1_Part1_Complete_AF25_RV00831_nf-flu_results/work Exit status : 255 Error report : Error executing process > 'NF_FLU:NANOPORE:BCF_FILTER_CLAIR3 (RV00831-22-IAV|3_PA|OQ234674.1)' Caused by: Process `NF_FLU:NANOPORE:BCF_FILTER_CLAIR3 (RV00831-22-IAV|3_PA|OQ234674.1)` terminated with an error exit status (255) Command executed: bcftools norm \ -Ov \ -m- \ -f RV00831-22-IAV.Segment_3_PA.OQ234674.1.reference.fasta \ RV00831-22-IAV.Segment_3_PA.OQ234674.1.clair3.vcf.gz \ > norm.vcf # filter for major alleles bcftools filter \ -e "%FILTER='RefCall' | AF < 0.25" \ norm.vcf \ -Ov \ -o RV00831-22-IAV.Segment_3_PA.OQ234674.1.bcftools_filt.vcf cat <<-END_VERSIONS > versions.yml "NF_FLU:NANOPORE:BCF_FILTER_CLAIR3": bcftools: $(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*$//') END_VERSIONS Command exit status: 255 Command output: (empty) Command error: Non-ACGTN reference allele at OQ234674.1:1946 .. REF_SEQ:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGANTTTCAGCAGAGTC' vs VCF:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGAYTTTCAGCAGAGTC' Work dir: IRVC20230720IHN1_analysis/IRVC20230720IHN1_Complete_Run/IRVC20230720IH1_Part1_Complete_AF25_RV00831_nf-flu_results/work/6e/d4a3b24dfb32920d6d6bc9220ea517 Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line WARN: Killing running tasks (7) executor > slurm (69), local (1) [5a/34b465] process > NF_FLU:NANOPORE:CHECK_SAMPL... [100%] 1 of 1 ✔ [- ] process > NF_FLU:NANOPORE:READ_COUNT_... - [c3/f8dca8] process > NF_FLU:NANOPORE:READ_COUNT_... [100%] 1 of 1 ✔ [5f/690088] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1 ✔ [b7/4079ec] process > NF_FLU:NANOPORE:ZSTD_DECOMP... [100%] 1 of 1, cached: 1 ✔ [3b/25417f] process > NF_FLU:NANOPORE:BLAST_MAKEB... [100%] 1 of 1 ✔ [b1/f92f41] process > NF_FLU:NANOPORE:CAT_NANOPOR... [100%] 1 of 1, cached: 1 ✔ [d3/31dc3d] process > NF_FLU:NANOPORE:IRMA (RV008... [100%] 1 of 1, cached: 1 ✔ [50/b7d53b] process > NF_FLU:NANOPORE:BLAST_BLAST... [100%] 1 of 1 ✔ [7a/ddeda9] process > NF_FLU:NANOPORE:PULL_TOP_RE... [100%] 1 of 1 ✔ [1d/320817] process > NF_FLU:NANOPORE:SEQTK_SEQ (... [100%] 8 of 8 ✔ [9e/64acb2] process > NF_FLU:NANOPORE:MINIMAP2 (R... [100%] 8 of 8 ✔ [51/741e19] process > NF_FLU:NANOPORE:MOSDEPTH_GE... [100%] 8 of 8 ✔ [6f/76d371] process > NF_FLU:NANOPORE:CLAIR3 (RV0... [100%] 8 of 8 ✔ [a4/671726] process > NF_FLU:NANOPORE:BCF_FILTER_... [100%] 7 of 7, failed: 1 [00/c87959] process > NF_FLU:NANOPORE:VCF_FILTER_... [100%] 6 of 6 [82/8df322] process > NF_FLU:NANOPORE:BCFTOOLS_ST... [100%] 6 of 6 [- ] process > NF_FLU:NANOPORE:COVERAGE_PL... - [24/50a2f8] process > NF_FLU:NANOPORE:BCF_CONSENS... [100%] 6 of 6 [- ] process > NF_FLU:NANOPORE:CAT_CONSENSUS - [- ] process > NF_FLU:NANOPORE:BLAST_BLAST... - [- ] process > NF_FLU:NANOPORE:SUBTYPING_R... - [- ] process > NF_FLU:NANOPORE:SOFTWARE_VE... - [- ] process > NF_FLU:NANOPORE:MULTIQC - Oops... Pipeline execution stopped with the following message: Non-ACGTN reference allele at OQ234674.1:1946 .. REF_SEQ:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGANTTTCAGCAGAGTC' vs VCF:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGAYTTTCAGCAGAGTC' ERROR ~ Error executing process > 'NF_FLU:NANOPORE:BCF_FILTER_CLAIR3 (RV00831-22-IAV|3_PA|OQ234674.1)' Caused by: Process `NF_FLU:NANOPORE:BCF_FILTER_CLAIR3 (RV00831-22-IAV|3_PA|OQ234674.1)` terminated with an error exit status (255) Command executed: bcftools norm \ -Ov \ -m- \ -f RV00831-22-IAV.Segment_3_PA.OQ234674.1.reference.fasta \ RV00831-22-IAV.Segment_3_PA.OQ234674.1.clair3.vcf.gz \ > norm.vcf # filter for major alleles bcftools filter \ -e "%FILTER='RefCall' | AF < 0.25" \ norm.vcf \ -Ov \ -o RV00831-22-IAV.Segment_3_PA.OQ234674.1.bcftools_filt.vcf cat <<-END_VERSIONS > versions.yml "NF_FLU:NANOPORE:BCF_FILTER_CLAIR3": bcftools: $(bcftools --version 2>&1 | head -n1 | sed 's/^.*bcftools //; s/ .*$//') END_VERSIONS Command exit status: 255 Command output: (empty) Command error: Non-ACGTN reference allele at OQ234674.1:1946 .. REF_SEQ:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGANTTTCAGCAGAGTC' vs VCF:'TATTCAATAGCCTATATGCATCACCACAATTGGAAGGAYTTTCAGCAGAGTC' Work dir: IRVC20230720IHN1_analysis/IRVC20230720IHN1_Complete_Run/IRVC20230720IH1_Part1_Complete_AF25_RV00831_nf-flu_results/work/6e/d4a3b24dfb32920d6d6bc9220ea517 Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line -- Check '.nextflow.log' file for details