Odd adapter parsing

[GoogleCodeExporter]

What steps will reproduce the problem?
1. Use GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAG as adapter1
2. Use GATCGGAAGAGCTCGTCAGCAGGAATGCCGAGATCGGAAG as adapter2
3. Issue fastq-mcf -n <adapter>.fa <fastq>

What is the expected output? What do you see instead?
Should show that there are two adapters as input.  You will see that it read 
the first adapter and discarded the second adapter.

What version of the product are you using? On what operating system?
ea-utils.1.0.3-145.tar.gz on Fedora 14 / 2.6.35.13-92.fc14.x86_64

Please provide any additional information below.

Original issue reported on code.google.com by rdirect...@gmail.com on 16 Jun 2011 at 4:02

[GoogleCodeExporter]

Adapter input is "fasta" format.... so

>name
ad1
>name
ad2

Original comment by earone...@gmail.com on 20 Jun 2011 at 6:38

[GoogleCodeExporter]

Original comment by earone...@gmail.com on 20 Jun 2011 at 8:37

• Added labels: Priority-Low, Type-Other
• Removed labels: Priority-Medium, Type-Defect

[GoogleCodeExporter]

Original comment by earone...@gmail.com on 20 Jun 2011 at 8:38

• Changed state: Invalid
• Added labels: Priority-Medium, Type-Defect
• Removed labels: Priority-Low, Type-Other

[GoogleCodeExporter]

Also, it only reports the adapters found.   So if you pass 20 of them, it will 
only report the 3 or 4 it finds.

Original comment by earone...@gmail.com on 21 Jun 2011 at 1:57

[GoogleCodeExporter]

[deleted comment]

[GoogleCodeExporter]

In my opinion this issue should be re-open as "valid" and addressed.  One of 
the adapter in my example is actually a real illumina adapter and fastq-mcf had 
failed to recognize it.  The abitrariness of your "filtering" is worrisome.

Original comment by rdirect...@gmail.com on 21 Jun 2011 at 3:23

[GoogleCodeExporter]

If you can give me an example of where an adapter should be clipped, that would 
be OK.   I believe the adapter was "real"... it's filtered  if it's not found 
in the fastq file in significant numbers.

Original comment by earone...@gmail.com on 11 Jan 2012 at 5:39

[GoogleCodeExporter]

[deleted comment]

[GoogleCodeExporter]

I'm going to close this issue, only because it's old, and I can't reproduce it 
reliably.  I did greatly increase the sampling window to fix a number of issues 
people have seen where they were concerned with undetected adapters, however at 
some point, the benefits outweigh the risks of false-positive clipping.

Original comment by mooncost...@gmail.com on 10 May 2012 at 4:04

[GoogleCodeExporter]

Original comment by earone...@gmail.com on 31 May 2012 at 1:41

• Changed state: WontFix