Updated twobitsupport #759

Merged
merged 20 commits into from Mar 22, 2017

Conversation

Projects
None yet
5 participants
@cmdcolin
Contributor

cmdcolin commented Jun 7, 2016

This is an updated PR from #309 to allow 2bit files to be loaded

This adds support to load it via the web browser or in the electron app.

This makes it quite easy to load common genomes and doesn't require an extra FASTA index, since 2bit is already indexed.

@cmdcolin cmdcolin removed the in progress label Jun 7, 2016

@cmdcolin cmdcolin referenced this pull request Jun 9, 2016

Closed

Twobitsupport #309

@cmdcolin

This comment has been minimized.

Show comment
Hide comment
@cmdcolin

cmdcolin Jul 7, 2016

Contributor

Would propose merging too! Fairly modular data loader :)

Contributor

cmdcolin commented Jul 7, 2016

Would propose merging too! Fairly modular data loader :)

@cmdcolin

This comment has been minimized.

Show comment
Hide comment
@cmdcolin

cmdcolin Jul 25, 2016

Contributor

This appears to actually have some oddities when it is displayed as a sequence track.

x1

Here is the actual volvox.fa

>ctgA
cattgttgcggagttgaacaACGGCATTAGGAACACTTCCGTCTCtcacttttatacgat
tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
aattgagaactcgagcgggggctaggcaaattctgattcagcctgacttctcttggaacc
ctgcccataaatcaaagggttagtgcggccaaaacgttggacaacggtattagaagacca
acctgaccaccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctag
atagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatac
gagactagctgtcaccagatgctgttcatctgttggctccttggtcgctccgttgtaccc
aggctactttgaaagagcgcagaatacttagacggtatcgatcatggtagcatagcattc
tgataacatgtatggagttcgaacatccgtctggggccggacggtccgtttgaggttggt
tgatctgggtgatagtcagcaagatagacgttagataacaaattaaaggattttacctta
gattgcgactagtacaacggtacatcggtgattcgcgctctactagatcacgctatgggt
accataaacaaacggtggaccttctcaagctggttgacgcctcagcaacataggcttcct
cctccacgcatctcagcataaaaggcttataaactgcttctttgtgccagagcaactcaa

Here are the displayed letters from sequence track

First block ttgttgcggagttgaacaACGGCA

Second block CATTAGGAACACTTCCGTCTCtcac

Third block ttttatacgattatgattggttctt

The fact that the first block starts at 0 and then has the blank white block shows it's not really loadeing the data right either (should start at 1 and not have the blank white square)

Contributor

cmdcolin commented Jul 25, 2016

This appears to actually have some oddities when it is displayed as a sequence track.

x1

Here is the actual volvox.fa

>ctgA
cattgttgcggagttgaacaACGGCATTAGGAACACTTCCGTCTCtcacttttatacgat
tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
aattgagaactcgagcgggggctaggcaaattctgattcagcctgacttctcttggaacc
ctgcccataaatcaaagggttagtgcggccaaaacgttggacaacggtattagaagacca
acctgaccaccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctag
atagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatac
gagactagctgtcaccagatgctgttcatctgttggctccttggtcgctccgttgtaccc
aggctactttgaaagagcgcagaatacttagacggtatcgatcatggtagcatagcattc
tgataacatgtatggagttcgaacatccgtctggggccggacggtccgtttgaggttggt
tgatctgggtgatagtcagcaagatagacgttagataacaaattaaaggattttacctta
gattgcgactagtacaacggtacatcggtgattcgcgctctactagatcacgctatgggt
accataaacaaacggtggaccttctcaagctggttgacgcctcagcaacataggcttcct
cctccacgcatctcagcataaaaggcttataaactgcttctttgtgccagagcaactcaa

Here are the displayed letters from sequence track

First block ttgttgcggagttgaacaACGGCA

Second block CATTAGGAACACTTCCGTCTCtcac

Third block ttttatacgattatgattggttctt

The fact that the first block starts at 0 and then has the blank white block shows it's not really loadeing the data right either (should start at 1 and not have the blank white square)

@cmdcolin

This comment has been minimized.

Show comment
Hide comment
@cmdcolin

cmdcolin Jul 30, 2016

Contributor

The error with the sequences is fixed now. It was due to requesting negative coordinates at the start of the chromosome, which was similarly an issue when we did the fasta code and easily fixed by sitting it to 0 if it's negative.

Should be ready now

Contributor

cmdcolin commented Jul 30, 2016

The error with the sequences is fixed now. It was due to requesting negative coordinates at the start of the chromosome, which was similarly an issue when we did the fasta code and easily fixed by sitting it to 0 if it's negative.

Should be ready now

@keiranmraine

This comment has been minimized.

Show comment
Hide comment
@keiranmraine

keiranmraine Aug 19, 2016

Contributor

@cmdcolin , are there any docs for how to configure for 2bit, I can't see an modifications to prepare-refseqs.pl indicating how to configure it. Also do you know if this would be going into the next release?

Contributor

keiranmraine commented Aug 19, 2016

@cmdcolin , are there any docs for how to configure for 2bit, I can't see an modifications to prepare-refseqs.pl indicating how to configure it. Also do you know if this would be going into the next release?

@cmdcolin

This comment has been minimized.

Show comment
Hide comment
@cmdcolin

cmdcolin Aug 19, 2016

Contributor

Actually that's a good point. I pushed some changes to allow using --twobit with prepare-refseqs.pl

Contributor

cmdcolin commented Aug 19, 2016

Actually that's a good point. I pushed some changes to allow using --twobit with prepare-refseqs.pl

@bslaff

This comment has been minimized.

Show comment
Hide comment
@bslaff

bslaff Jan 12, 2017

Will the --twobit option for prepare-refseqs.pl be added to the master branch?

bslaff commented Jan 12, 2017

Will the --twobit option for prepare-refseqs.pl be added to the master branch?

@cmdcolin

This comment has been minimized.

Show comment
Hide comment
@cmdcolin

cmdcolin Mar 22, 2017

Contributor

I can get this merged and a couple of other ones that were discussed if there's interest

Contributor

cmdcolin commented Mar 22, 2017

I can get this merged and a couple of other ones that were discussed if there's interest

@nathandunn

This comment has been minimized.

Show comment
Hide comment
@nathandunn

nathandunn Mar 22, 2017

Contributor

Yes, I think that is the plan. Thanks.

Contributor

nathandunn commented Mar 22, 2017

Yes, I think that is the plan. Thanks.

@cmdcolin

This comment has been minimized.

Show comment
Hide comment
@cmdcolin

cmdcolin Mar 22, 2017

Contributor

Alright, just gonna press the big green button here!

Contributor

cmdcolin commented Mar 22, 2017

Alright, just gonna press the big green button here!

@cmdcolin cmdcolin merged commit bd92ef9 into master Mar 22, 2017

2 checks passed

continuous-integration/travis-ci/pr The Travis CI build passed
Details
continuous-integration/travis-ci/push The Travis CI build passed
Details

@cmdcolin cmdcolin referenced this pull request Mar 22, 2017

Closed

2bit data backend #282

@cmdcolin cmdcolin deleted the updated_twobitsupport branch Mar 22, 2017

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment