Permalink
Switch branches/tags
Nothing to show
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
34 lines (29 sloc) 1.12 KB
class Bioawk < Formula
desc "AWK modified for biological data"
homepage "https://github.com/lh3/bioawk"
url "https://github.com/lh3/bioawk/archive/v1.0.tar.gz"
sha256 "5cbef3f39b085daba45510ff450afcf943cfdfdd483a546c8a509d3075ff51b5"
bottle do
cellar :any_skip_relocation
sha256 "7082d4073e07ba3dfa849f95eb126d966a45f9fceb1d197595119a216e465727" => :mojave
sha256 "023f5cafaa31404e68b8fc6bcfbeee27e63eb5fbcab897d2f406fceda90ec9ff" => :high_sierra
sha256 "154d44dd9ea56db8170127711e991950d487e379ae12df76332e4b7512f79fe8" => :sierra
sha256 "df0810bc087f924cdddcdb73f00faf9772de9475e0e698c7af8a7d036b3a4c91" => :el_capitan
end
def install
# Fix make: *** No rule to make target `ytab.h', needed by `b.o'.
ENV.deparallelize
system "make"
bin.install "bioawk"
man1.install "awk.1" => "bioawk.1"
end
test do
(testpath/"test.fasta").write <<~EOS
>U00096.2:1-70
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCT
CTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
EOS
cmd = "#{bin}/bioawk -cfastx '{print length($seq)}' test.fasta"
assert_equal "70", shell_output(cmd).chomp
end
end