bio-polymarker

Tool to design KASP primers, making them as specific as possible.

---

Installation

Polymarker makes use of the following applications as such these need to be available on the system and in the users $PATH variable:

• MAFFT
• primer3
• exonerate
• blast

Fundamentally the steps for installation are:

• install required applications
• install polymarker dependencies
• gem install bio-polymarker

RHEL / AlmaLinux

A more detailed example of installing polymarker, and it's required tools on a fresh install of RHEL/AlmaLinux 9 can be found here.

---

Running

To run PolyMarker with the CSS wheat contigs, you need to unzip the reference file from ensembl.

polymarker.rb --contigs Triticum_aestivum.IWGSC2.25.dna.genome.fa --marker_list snp_list.csv --output output_folder

The snp_list file must follow the convention ID,Chromosome,SEQUENCE with the SNP inside the sequence in the format [A/T]. As a reference, look at test/data/short_primer_design_test.csv

If you want to use the web interface, visit the PolyMarker webservice at TGAC

The available command line arguments are:

Usage: polymarker.rb [options]
    -c, --contigs FILE               File with contigs to use as database
    -m, --marker_list FILE           File with the list of markers to search from
    -g, --genomes_count INT          Number of genomes (default 3, for hexaploid)
    -s, --snp_list FILE              File with the list of snps to search from, requires --reference to get the sequence using a position
    -t, --mutant_list FILE           File with the list of positions with mutation and the mutation line.
    requires --reference to get the sequence using a position
    -r, --reference FILE             Fasta file with the sequence for the markers (to complement --snp_list)
    -o, --output FOLDER              Output folder
    -e, --exonerate_model MODEL      Model to be used in exonerate to search for the contigs
    -i, --min_identity INT           Minimum identity to consider a hit (default 90)
    -a, --arm_selection arm_selection_embl|arm_selection_morex|arm_selection_first_two
                    Function to decide the chromome arm
    -p, --primer_3_preferences FILE  file with preferences to be sent to primer3
    -v, --variation_free_region INT  If present, avoid generating the common primer if there are homoeologous SNPs within the specified distance (not tested)
    -x, --extract_found_contigs      If present, save in a separate file the contigs with matches. Useful to debug.
    -P, --primers_to_order			 If present, saves a file named primers_to_order which contains the KASP tails

Input formats

The following formats are used to define the marker sequences:

Marker list

If the option --marker_list FILE is used, the SNP and the flanking sequence is included in the file. The format contains 3 columns (the order is important):

• snp_name The ID of the marker. Must be unique.
• target chromosome for the specific primers. Must be in line with the chromosome selection criteria.
• sequence The sequence flanking the SNP with the SNP highlighted on square brackets ([]) and the two alleles separated by a forward slash (/).

Example:

BS00068396_51,2A,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA

SNP list

If the flanking sequence is unknown, but the position on a reference is available, the option --snp_list can be used and the FASTA file with the reference sequence must be provided with the option --reference. This is to allow the use of a different assembly or set of contigs used for the discovery of the SNPs that are different to the reference given in the option --contigs. The format contains the following positional columns:

• scaffold The sacffold where the SNP is.
• reference allele The base in the reference (may or may not be the same as in the reference file).
• position SNP position. The first base in the scaffold is base 1.
• alternative allele The base in the alternative allele.
• target chromosome for the specific primers. Must be in line with the chromosome selection criteria.

Example

IWGSC_CSS_1AL_scaff_110,C,519,A,2A

This file format can be used with snp_positions_to_polymarker.rb to produce the input for the option --marker_list.

Custom reference sequences.

By default, the contigs and pseudo-molecules from ensembl are used. However, it is possible to use a custom reference. To define the chromosome where each contig belongs the argument arm_selection is used. The default uses ids like: IWGSC_CSS_1AL_scaff_110, where the third field, separated by underscores is used. A simple way to add custom references is to rename the fasta file to follow that convention. Another way is to use the option --arm_selection arm_selection_first_two, where only the first two characters in each contig is used as identifier, useful when pseudo-molecules are named after the chromosomes (ie: ">1A" in the fasta file).

If your contigs follow a different convention, in the file ChromosomeArm.rb it is possible to define new parsers, by adding at the beginning, with the rest of the parsers a new lambda like:

@@arm_selection_functions[:embl] = lambda do |contig_name|
  arr = contig_name.split('_')
  ret = "U"
  ret = arr[2][0, 2] if arr.size >= 3
  ret = "3B" if arr.size == 2 and arr[0] == "v443"
  ret = arr[0][0, 2] if arr.size == 1
  return ret
end

The function should return a 2 character string, when the first is the chromosome number and the second the chromosome group. The symbol in the hash is the name to be used in the argument --arm_selection. If you want your parser to be added to the distribution, feel free to fork and make a pull request.

##Using blast

To use blast instead of exonerate, use the following command:

./bin/polymarker.rb --contigs test/data/BS00068396_51_contigs.fa --marker_list test/data/BS00068396_51_for_polymarker.fa  --aligner blast  -a arm_selection_first_two