No description, website, or topics provided.
Java Shell
Switch branches/tags
Nothing to show
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
arch-pkgbuild
src/main
LICENSE
README.md
build.gradle

README.md

MADAM - iMproving Ancient Dna AsseMbly

Dependencies

The following software has to be installed in order for the software to run:

Note: Clip&Merge is actually a java program. For correct usage, the program has to be wrapped in a starter script that can be set in the MADAM script. This starter script should contain the following line:

java -jar ClipAndMerge $*

generating the jar file

This program can be built with gradle (https://gradle.org). for that just type

gradle build

The jar-files are then contained in the build/libs folder

Tools

The following tools are available:

assembly

perform an assembly on input data

Parameters:

  • SOAP: Run the assembly using SOAPdenovo2
  • -i, --input <INPUT>: the input File(s)
  • -k, --kmer <KMER>: the Kmers to use
  • -o, --output <OUTPUT>: the output Directory
  • -p, --prefix <arg>: the prefix for the output files [genome]
  • -s, --insertSize <arg>: the insert size of the input[20]
  • -t, --threads <arg>: number of threads to use [1]
  • MEGAHIT: Run the assembly using MEGAHIT
  • -i, --input <INPUT>: the input File(s)
  • -k, --kmer <KMER>: the Kmers to use
  • -o, --output <OUTPUT>: the output Directory
  • -t, --threads <arg>: number of threads to use [1]

cm

run Clip And Merge on FastQ Files

Parameters:

  • -f, --forward <arg>: the forward adapter [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC]
  • -h, --help: show this help page
  • -in1, --input1 <INPUT1>: Forward reads input file(s) in fastq(.gz) file format
  • -in2, --input2 <INPUT2>: Reverse reads input file(s) in fastq(.gz) file format
  • -l, --log <arg>: File for Log output [stdout]
  • -n, --nomerge: don't merge, just clip and trim
  • -o, --output <OUTPUT>: the output Directory
  • -q, --quality <arg>: Minimum base quality for quality trimming [20]
  • -r, --reverse <arg>: the reverse adapter [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA]
  • -s, --single: don't merge and combine for single end assembly (implies -n)

filter

Filter contigs based on length and/or read concurrency

Parameters:

  • -f, --filter <arg>: the name of the filtered contigs [contigs_filtered.fasta]
  • -h, --help: show this help page
  • -i, --input <INPUT>: the input contig File to filter
  • -l, --length <arg>: the minimum length of a contig to keep [NULL]
  • -m, --minFilter <arg>: the minimum number of reads that have to map against a contig to keep [1]
  • -o, --output <OUTPUT>: the output Directory
  • -p, --prefix <arg>: the prefix for the mapping files [mapped]
  • -q, --fastq <FASTQ>: the input fastQ File(s) to filter
  • -t, --threads <arg>: number of threads to use [1]

Note: Keep in mind that either -l or -q has to be given

merge

Merge different Contig Files into one file using SGA

Parameters:

  • -f, --file <arg>: name of the merged output file [merged.fasta]
  • -h, --help: show this help page
  • -i, --input <INPUT>: the input File(s)
  • -o, --output <OUTPUT>: the output Directory
  • -t, --threads <arg>: number of threads to use [1]

pipeline

Run the pipeline as described in the paper "Improving ancient DNA genome assembly"

Parameters:

  • -a, --assembly <ASSEMBLY>: The assembly algorithm of the first Layer: SOAP, MEGAHIT [SOAP]
  • -f, --forward <arg>: the forward adapter [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC]
  • -h, --help: show this help page
  • -in1, --input1 <INPUT1>: the forward and reverse fastq files
  • -in2, --input2 <INPUT2>: the forward and reverse fastq files
  • -k, --kmer <KMER>: the Kmers to use [37,47,...,127]
  • -l, --filterlength <arg>: the minimum length of a contig to keep [1000]
  • -m, --minFilter <arg>: the minimum number of reads that have to map against a contig to keep [1]
  • -n, --no_merge: Do not merge the reads
  • -o, --output <OUTPUT>: the output Directory
  • -q, --quality <arg>: Minimum base quality for quality trimming [20]
  • -r, --reverse <arg>: the reverse adapter [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA]
  • -R, --reference <REFERENCE>: the reference genome file
  • -s, --insertSize <arg>: the insert size of the input[20]
  • -S, --single: don't merge and combine for single end assembly (implies -n)
  • -t, --threads <arg>: number of threads to use [1]

statistics

Calculate statistical values on contig files

Parameters:

  • -h,--help: show this help page
  • -i,--input <INPUT>: the list of input Files
  • -l,--length <arg>: length of reference
  • -n,--names <NAMES>: The names of the samples
  • -o,--output <arg>: the output file [stdout]
  • -t,--threads <arg>: number of threads to use [1]

mapping

Map the contigs against a reference, run qualimap on the mapping and extract the contigs that could be mapped against the reference

Parameters:

  • -h,--help: show this help page
  • -i,--input <INPUT>: the input contig File to filter
  • -o,--output <OUTPUT>: the output Directory
  • -p,--prefix <arg>: the prefix of the bam file [mapped]
  • -R,--reference <REFERENCE>: the reference genome file
  • -t,--threads <arg>: number of threads to use [1]