Python
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
Src
.gitignore
CATALOGUE.tgz
README.txt

README.txt

RNAMoIP 1.1

	This software runs in command line and is written in python2.7
	with the GUROBI5.1 python API.

DEPENDANCIES:
	1) Gurobi (implemented with Gurobi 4.6 free academic licence)
		http://gurobi.com/
		To make sure that installation work, from a terminal,
		you should be able to type:
			gurobi.sh
		and enter in the Gurobi Interactive Shell

INSTALLATION:
    1) The RNAMoIP.py script is located in Src/RNAMoIP.py

	If you don't have a database of motifs in a ".desc" formatm, 
	as outputed bu RNA3DMotifs (http://rna3dmotif.lri.fr/) we 
	provided the one we used. Else jump to execution.

    2) Extract the database i.e.
            tar -xzf CATALOGUE.tgz
    3) The folder No_Redondance_DESC contains the description files,
		as .desc, of the motifs used by RNAMoIP
	   The fold No_Redondance_VIEW3D contains, for each description
		file, all motifs .pdb having the same sequence as 
		described in the .desc.


EXECUTION:

	RNAMoIP.py is only a script that need to be launch with gurobi.sh.
    RNAMoIP.py arguments are as follows:
      REQUIRED:
        -s The rna Sequence 
        -ss The rna Secondary Structure (no pseudoknots) OR
            path to file with list of secondary structures. In that
            case all optimal secondary stuctures will be outputed. 
        -d the path to the .Desc files
      OPTIONAL
        -r (default 0.3) 
           the percentage of basepairs that can be Removed 
        -c (default 4, can be 3)
            the max nb of Components in motifs 
        -m_sols (default 1)
            maximal number of optimal solutions to output
    e.g.

        gurobi.sh RNAMoIP.py -s 'GCCAGGGUGGCAGAGGGGCUUUGCGGCGGACUGCAGAUCCGCUUUACCCCGGUUCGAAUCCGGGCCCUGGC' -ss '(((((((..((((((...)))))).(((((.......))))).....(((((.......))))))))))))' -d 'No_Redondance_DESC' > my_output.txt

        NB: This is a suboptimal structure for the given sequence. It can be obtained with "RNAsubopt -e 3"

        gurobi.sh RNAMoIP.py -s 'GCCAGGGUGGCAGAGGGGCUUUGCGGCGGACUGCAGAUCCGCUUUACCCCGGUUCGAAUCCGGGCCCUGGC' -ss "/path/to/sec/struct/list.tt" -d 'No_Redondance_DESC' -r 0.4 -m_sols 5  > my_output.txt
 
	The file my_output.txt will contain all the usual output 
	of Gurobi. Followed by
	The values of the inserted motifs 
	and deleted base pairs:
    And the last line contains the value of the objective 
    function.
   
    Output exemple (omitting gurobi's) :

################################################################################
Solution for the secondary structure:
    (((((((..((((((...)))))).(((((.......))))).....(((((.......))))))))))))

Optimal solution nb:  1
Corrected secondary structure:
    ((((((...(((.........)))..((((.......))))......((((.........)))).))))))
    C-2DU6.D.2-12-22-1
    C-3CUL.D.6-51-61-1
    C-2DU3.D.3-30-38-1
    C-2DU5.D.1-6-10-1
    C-2DU5.D.1-24-27-2
    C-2DU5.D.1-41-48-3
    C-2DU5.D.1-64-66-4
    D-15-19
    D-14-20
    D-13-21
    D-26-42
    D-52-60
    D-7-65

The optimal solutions has as value:
    -663.0