# -*- mode: Yaml; -*-
# Default options.
# Can also be specific for a set of samples, libraries, and lanes,
# by including the "Options" hierarchy at the same level as those
# samples, libraries, or lanes below.
Options:
  # Sequencing platform, see SAM/BAM reference for valid values
  Platform: Illumina
  # Quality offset for Phred scores, either 33 (Sanger/Illumina 1.8+)
  # or 64 (Illumina 1.3+ / 1.5+). For Bowtie2 it is also possible to
  # specify 'Solexa', to handle reads on the Solexa scale. This is
  # used during adapter-trimming and sequence alignment
  QualityOffset: 33
  

  # Settings for trimming of reads, see AdapterRemoval man-page
  AdapterRemoval:
     # Set and uncomment to override defaults adapter sequences
#     --adapter1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
#     --adapter2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
     # Some BAM pipeline defaults differ from AR defaults;
     # To override, change these value(s):
     --mm: 3
     --minlength: 30
     # Extra features enabled by default; change 'yes' to 'no' to disable
     --collapse: yes
     --trimns: yes
     --trimqualities: yes

  # Settings for aligners supported by the pipeline
  Aligners:
    # Choice of aligner software to use, either "BWA" or "Bowtie2"
    Program: BWA

    # Settings for mappings performed using BWA
    BWA:
      # One of "backtrack", "bwasw", or "mem"; see the BWA documentation
      # for a description of each algorithm (defaults to 'backtrack')
      Algorithm: backtrack
      # Filter aligned reads with a mapping quality (Phred) below this value
      MinQuality: 30
      # Filter reads that did not map to the reference sequence
      FilterUnmappedReads: yes
      # May be disabled ("no") for aDNA alignments with the 'aln' algorithm.
      # Post-mortem damage localizes to the seed region, which BWA expects to
      # have few errors (sets "-l"). See http://pmid.us/22574660
      UseSeed: no
      # Additional command-line options may be specified below. For 'backtrack' these
      # are applied to the "bwa aln". See Bowtie2 for more examples.
      -n: 0.01
      -o: 2

    # Settings for mappings performed using Bowtie2
    Bowtie2:
      # Filter aligned reads with a mapping quality (Phred) below this value
      MinQuality: 0
      # Filter reads that did not map to the reference sequence
      FilterUnmappedReads: yes
      # Examples of how to add additional command-line options
#      --trim5: 5
#      --trim3: 5
      # Note that the colon is required, even if no value is specified
      --very-sensitive:
      # Example of how to specify multiple values for an option
#      --rg:
#        - CN:SequencingCenterNameHere
#        - DS:DescriptionOfReadGroup

  # Command-line options for mapDamage; use long-form options(--length not -l):
  mapDamage:
    # By default, the pipeline will downsample the input to 100k hits
    # when running mapDamage; remove to use all hits
    #--downsample: 100000

  # Set to 'yes' exclude a type of trimmed reads from alignment / analysis;
  # possible read-types reflect the output of AdapterRemoval
  ExcludeReads:
    # Exclude single-end reads (yes / no)?
    Single: no
    # Exclude non-collapsed paired-end reads (yes / no)?
    Paired: yes
    # Exclude paired-end reads for which the mate was discarded (yes / no)?
    Singleton: yes
    # Exclude overlapping paired-ended reads collapsed into a single sequence
    # by AdapterRemoval (yes / no)?
    Collapsed: no
    # Like 'Collapsed', but only for collapsed reads truncated due to the
    # presence of ambiguous or low quality bases at read termini (yes / no).
    CollapsedTruncated: no

  # Optional steps to perform during processing.
  Features:
    # If set to 'filter', PCR duplicates are removed from the output files; if set to
    # 'mark', PCR duplicates are flagged with bit 0x400, and not removed from the
    # output files; if set to 'no', the reads are assumed to not have been amplified.
    PCRDuplicates: filter
    # Set to 'no' to disable mapDamage; set to 'plots' to build basic mapDamage plots;
    # set to 'model' to build plots and post-mortem damage models; and set to 'rescale'
    # to build plots, models, and BAMs with rescaled quality scores. All analyses are
    # carried out per library.
    mapDamage: plot
    # Generate coverage information for the final BAM and for each 'RegionsOfInterest'
    # specified in 'Prefixes' (yes / no).
    Coverage: yes
    # Generate histograms of number of sites with a given read-depth, from 0 to 200,
    # for each BAM and for each 'RegionsOfInterest' specified in 'Prefixes' (yes / no).
    Depths: yes
    # Generate summary table for each target (yes / no)
    Summary: yes


# Map of prefixes by name, each having a Path, which specifies the location of the
# BWA/Bowtie2 index, and optional regions for which additional statistics are produced.
Prefixes:
  # Replace 'NAME_OF_PREFIX' with name of the prefix; this name is used in summary
  # statistics and as part of output filenames.
  # Reference 1:
  CapeGrysbok-Human:
    # Replace 'PATH_TO_PREFIX' with the path to .fasta file containing the references
    # against which reads are to be mapped. Using the same name as filename is strongly
    # recommended (e.g. /path/to/Human_g1k_v37.fasta should be named 'Human_g1k_v37').
    Path: /projects/mjolnir1/people/pzx702/palaeobovids/refgenomes/mitochondrial/CapeGrysbok_Human_mitogenomes.fasta

    # (Optional) Uncomment and replace 'PATH_TO_BEDFILE' with the path to a .bed file
    # listing extra regions for which coverage / depth statistics should be calculated;
    # if no names are specified for the BED records, results are named after the
    # chromosome / contig. Replace 'NAME' with the desired name for these regions.
    RegionsOfInterest:
      Grysbok-Human: /projects/mjolnir1/people/pzx702/palaeobovids/refgenomes/mitochondrial/CapeGrysbok_Human_mitogenomes.bed


# Mapping targets are specified using the following structure. Replace 'NAME_OF_TARGET'
# with the desired prefix for filenames.
#NAME_OF_TARGET:
  # Replace 'NAME_OF_SAMPLE' with the name of this sample.
#  NAME_OF_SAMPLE:
    # Replace 'NAME_OF_LIBRARY' with the name of this sample.
#    NAME_OF_LIBRARY:
       # Replace 'NAME_OF_LANE' with the lane name (e.g. the barcode) and replace
       # 'PATH_WITH_WILDCARDS' with the path to the FASTQ files to be trimmed and mapped
       # for this lane (may include wildcards).
#      NAME_OF_LANE: PATH_WITH_WILDCARDS

SCR_086:
  SCR_086:
    SCR_086:
      Lane_4: /projects/mjolnir1/people/pzx702/palaeobovids/poolscreen06/raw_data/SCR_086/SCR_086_EKDL220009837-1A_H33VMDSX5_L4_{Pair}.fq.gz