p-TAREF: A fast and accurate tool to Refine plant microRNA Target Prediction
1.System Requirement 2.Installation 3.p-TAREF execution 4.File formats
1.System requirement:
- Linux O.S. (recommending Ubuntu)
- Vienna RNA package (#Download from here: https://www.tbi.univie.ac.at/RNA/download/sourcecode/2_5_x/ViennaRNA-2.5.0.tar.gz)
- EMBOSS (# sudo apt-get install emboss -y for Ubuntu users)
- RNAhybrid (# sudo apt-get install rnahybrid -y for Ubuntu users)
- libSVM (# sudo apt-get install libsvm* -y for Ubuntu users)
- Java
- python2 (recommended)
2.Installing:
Extract p-TAREF on your local system and migrate to extracted directory.
3.p-TAREF execution:
To run p-TAREF from command line: Please refer to the "run_script" file for better understanding of parameters as well as for the execution of program.
sh run.sh #to execute the program mRNA sequence(s) in FASTA format. minimum free energy of miRNA-target duplex maximum mismatch allowed Choose between three kernels (most stringent polynomial, moderate stringent gaussian and least stringent linear) specify the result folder. defaul folder is same folder which contains input file or scan predicted miRNA with all encoded patterns/scan predicted miRNA with same miRNA encoded patterns Number of processors on which you want to execute p-TAREF
4.File formats:
Note: Sequence should be in fasta format followed by TAIR ID. Sequences can be in multiple line or in single line.
AT1G02860.1 ATGTTCCCAAAACAAACGTTTTGACTTTTTTTTTGTTTTCTCATATTCTTTTATTTCACAACTTGTTATTTCCGCCGACTTCACCAGTCACCACCACCTT CATTTATTCATAAATACGTCTCTGTTCTGTTTTTGTTTCTGTTTCATTTTCATACATAATTAAGCCAACACGAGACGCAAGAGAGAGATAGGGAAAGAGA
Use >ATXXXXXX format for any query
Please put "AT" followed by some accession number to create imaginary ID to fit the format requirement: for example if the accession id is ">Os01g04550" change it to something like ">AT01g04550" OR you can create any imaginery ID with >ATXXX format to meet the input requirement.
For query, bugs or information please contact ravish@ihbt.res.in or sg927357@gmail.com or log on to scbb.ihbt.res.in
Citation: Jha, A., Shankar, R. Employing machine learning for reliable miRNA target identification in plants. BMC Genomics 12, 636 (2011). https://doi.org/10.1186/1471-2164-12-636