Skip to content
Teselagen's Open Source Vector/Plasmid Editor Component
Branch: master
Clone or download
Latest commit e26e296 Mar 22, 2019
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
.circleci
.vscode
cypress updating merged reducers to hang onto their state unless explicitly o… Mar 22, 2019
demo
docs adding issue template Oct 8, 2018
src updating merged reducers to hang onto their state unless explicitly o… Mar 22, 2019
static_resources
.DS_Store working on adding protein editing Feb 11, 2019
.deprc
.eslintrc
.flowconfig circular view drawing improvements Nov 2, 2015
.fontello wip Oct 8, 2017
.github-webhook
.gitignore updating demo page to add more info helpers, adding in webpack-link m… Mar 21, 2019
.jsbeautifyrc
.npmignore
.release.json
LICENSE wip Oct 8, 2017
Makefile
README.md
UPGRADE_INSTRUCTIONS.md
cypress.json adding SimpleCircularOrLinearView component; updating to use tgToggle… Jan 9, 2019
docker-compose.yml wip Oct 8, 2017
ecosystem.json
editorStateExample.js
entrypoint.sh
index_OLD.html
jest.config.js publishing minor Oct 16, 2017
jestFileMock.js publishing minor Oct 16, 2017
nwb.config.js
package.json fixing tests Mar 22, 2019
update.sh
yarn-error.log
yarn.lock

README.md

Congrats, you've made it to the repo for Teselagen's Open Source Vector Editor Component

  • Built With React & Redux
  • Built for easy extensibility + embed-ibility
  • Customize the views to suit your needs

Issue Tracking Board: https://waffle.io/TeselaGen/openVectorEditor

Demo: http://teselagen.github.io/openVectorEditor/

Cypress Tests Dashboard: https://dashboard.cypress.io/#/projects/1zj5vc/runs (you'll need to make a login with cypress)

OVE out in the wild:

Table of Contents

Upgrade Instructions for Major and Minor Versions

This repo follows semantic versioning (major/minor/patche)

The commit log can be seen here: https://github.com/TeselaGen/openVectorEditor/commits/master

Upgrade instructions for any major or minor change can be found here: Upgrade instructions

Using this module in React

Installation (react)

yarn add install-peerdeps open-vector-editor

Add peer-dependencies:

install-peerdeps open-vector-editor --dev --only-peers

Code (react)

Require the following components like:

import {Editor, RowView} from "open-vector-editor

Editor

The <Editor {...editorProps}/> component gives you a full blown editor. It takes in a list of editorProps as detailed below.

CircularView/CircularViewUnconnected

This gives you just the circular/plasmid map view. Either redux connected or unconnected (non-interactive)

LinearView/LinearViewUnconnected

This gives you just the linear map view. Either redux connected or unconnected (non-interactive)

RowView/RowViewUnconnected

This gives you just the detailed view of the sequence rows. Either redux connected or unconnected (non-interactive)

EnzymeViewer

A component used for viewing enzymes

Using this module outside of react apps (Universal):

The universal build can be used in any app with or without react. It corresponds to using the component in the React version. You will be able to customize the Editor just like in the react build, but you will not be able to use the individual components like or . For that you'll need to use React.

Installation (Universal)

via npm:

npm install open-vector-editor

then add the links

<link rel="stylesheet" type="text/css" href="your-path-to-node-modules/open-vector-editor/umd/main.css">
<script type="text/javascript" src="your-path-to-node-modules/open-vector-editor/umd/open-vector-editor.js"></script>

Or via CDN:

<link rel="stylesheet" type="text/css" href="https://unpkg.com/open-vector-editor/umd/main.css"> 
<script type="text/javascript" src="https://unpkg.com/open-vector-editor/umd/open-vector-editor.js"></script>

Code (Universal)

<script>
const editor = window.createVectorEditor(yourDomNodeHere || "createDomNodeForMe", editorProps); /* createDomNodeForMe will make a dom node for you and append it to the document.body*/
editor.updateEditor(editorState);	
</script>

Accessing the editor state:

const currentEditorState = editor.getState()
//you can view various properties of the alignment such as the selection layer using alignment.getState()
console.info(currentEditorState.selectionLayer)

Demo (Universal): http://teselagen.github.io/openVectorEditor/

editorProps

These props consist of hooks and editor config options that can be passed like so: <Editor {...editorProps}/> or as seen above like window.createVectorEditor(yourDomNodeHere, editorProps);

{
	shouldAutosave: true, //by default the editor does not autosave, setting this to true will trigger the onSave callback after any change to the sequenceData
	//supplying this function WILL make the editor FULLSCREEN BY DEFAULT
	handleFullscreenClose: () => { 
		//do whatever you want here
		//UMD only:
		editor.close() //this calls reactDom.unmountComponent at the node you passed as the first arg
	},
	showReadOnly: false, //default true
  disableSetReadOnly: true, //default false
	onSave: function(event, sequenceDataToSave, editorState, onSuccessCallback) {
		console.info("event:", event);
		console.info("sequenceData:", sequenceDataToSave);
		console.info("editorState:", editorState);
		// To disable the save button after successful saving
		// either call the onSuccessCallback or return a successful promise :)
		onSuccessCallback()
		//or 
		// return myPromiseBasedApiCall()
	},
	onCopy: function(event, copiedSequenceData, editorState) {
		//the copiedSequenceData is the subset of the sequence that has been copied in the teselagen sequence format
		console.info("event:", event);
		console.info("sequenceData:", copiedSequenceData);
		console.info("editorState:", editorState);
		const clipboardData = event.clipboardData;
		clipboardData.setData("text/plain", copiedSequenceData.sequence);
		clipboardData.setData(
			"application/json",
			JSON.stringify(copiedSequenceData)
		);
		event.preventDefault();
		//in onPaste in your app you can do:
		// e.clipboardData.getData('application/json')
	},
	onPaste: function(event, editorState) {
		//the onPaste here must return sequenceData in the teselagen data format
		const clipboardData = event.clipboardData;
		let jsonData = clipboardData.getData("application/json")
		if (jsonData) {
			jsonData = JSON.parse(jsonData)
			if (jsonData.isJbeiSeq) {
				jsonData = convertJbeiToTeselagen(jsonData)
			}
		}
		const sequenceData = jsonData || {sequence: clipboardData.getData("text/plain")}
		return sequenceData
	},
	//regular click overrides, eg: 
	featureClicked: ({annotation, event}) => {
		//do something here :)
	}
	// orf/primer/translation/cutsite/translationDouble/deletionLayer/replacementLayer/feature/part/searchLayer xxxxClicked can also be overridden

	rightClickOverrides: { //override what happens when a given feature/part/primer/translation/orf/cutsite/selectionLayer/lineageLine gets right clicked
		//the general format is xxxxRightClicked eg:
		selectionLayerRightClicked: (items, {annotation}, props) => {
			return [...items, { 
				//props here get passed directly to blueprintjs MenuItems
				text: "Create Part",
				onClick: () => console.info('hey!≈')
			}]
		}
	},
	PropertiesProps: { 
		// the list of tabs shown in the Properties panel
		propertiesList: [
			"general",
			"features",
			"parts",
			"primers",
			"translations",
			"cutsites",
			"orfs",
			"genbank"
		]
	},
	ToolBarProps: {
			toolList: [
				"saveTool",
				//you can override a tool like so:
				{name: "downloadTool", Dropdown: () => { 
					return "Hey!"
				}},
				"importTool",
				"undoTool",
				"redoTool",
				"cutsiteTool",
				"featureTool",
				"alignmentTool",
				// "oligoTool",
				"orfTool",
				// "viewTool",
				"editTool",
				"findTool",
				"visibilityTool"
				// "propertiesTool"
			]
		}
		StatusBarProps: {
			//these are the defaults:
			showCircularity: true,
  		showReadOnly: true,
			showAvailability: false
		},
		onDigestSave: () => {} //tnr: NOT YET IMPLEMENTED
}

editorState

These are the options to the updateEditor() action (the most generic redux action we have)) and will cause the editor state stored in redux to be updated. Only the subset of options that are passed will be updated.

{

	//note, sequence data passed here will be coerced to fit the Teselagen data model
	sequenceData: { Open Vector Editor data model
		sequence: "atagatagagaggcccg",
		features: [
			{
				color: "#b3b3b3", //you can override the default color for each individual feature if you want
				type: "misc_feature",
				start: 0, //start and end are 0-based inclusive for all annotations
				end: 10,
				id: 'yourUniqueID',
				forward: true //ie true=positive strand     false=negative strange 
			}
		],
		parts: []
	},
	sequenceDataHistory: {}, //clear the sequenceDataHistory if there is any left over from a previous sequence
	sequenceDataHistory: {}, //clear the sequenceDataHistory if there is any left over from a previous sequence
	annotationVisibility: {
		features: false
	},
	panelsShown: [
		[
			{
				id: "sequence",
				name: "Sequence Map",
				active: true
			}
		],
		[
			{
				id: "circular",
				name: "Circular Map",
				active: true
			},
			{
				id: "rail",
				name: "Linear Map",
				active: false
			},
			{
				id: "properties",
				name: "Properties",
				active: false
			}
		]
	],
	caretPosition: 10,
	...additional editor props can be passed here [Example Editor State](./editorStateExample.js)
}

Data Model

The data model can be interactively inspected by installing the redux devtools for your browser: devtools Here is the top level editor state: Example Editor State

Alignments

Integrating your own alignment data (only necessary if not using the built in alignment creation tool)

Add a panel to the panelsShown prop like so:

const alignment = window.createAlignmentView(this.node, {
	id: "jbeiAlignment1", //give your alignment a unique id
	////optional! Use if you want a pairwise alignment:
	pairwiseAlignments: [  // this is an array of [referenceSequence, alignedSequence]
		[
			{ //reference sequence must come first!
				sequenceData: {
					id: "FWER1231", //every sequenceData and alignmentData should have a unique id
					name: "GFPuv58",
					sequence:	"ttgagggg",
					features: [{id: "feat1", start: 2, end:4, name: "GFP CDS"}]
				},
				alignmentData: {
					sequence:	"ttgag--ggg--" //this length should be the same as the below alignmentData length!
				}
			},{ //aligned sequence must come second!
				sequenceData: {
					name: "GFPuv58",
					sequence:	"gagccgggtt"
				},
				alignmentData: {
					sequence:	"--gagccgggtt" //this length should be the same as the above alignmentData length!
				}
			}
		]
		[
			{Alignment Track Data Here}, //reference sequence track (see Data Model below for specs)
			{Alignment Track Data Here}, //aligned sequence track (see Data Model below for specs)
		],
		[
			{Alignment Track Data Here}, //see Data Model below for specs
			{Alignment Track Data Here}, 
		],
	]
	////optional! Use if you want a multi-seq alignment:
	alignmentTracks: [ 
		{Alignment Track Data Here}, //see Data Model below for specs
		{Alignment Track Data Here},
		{Alignment Track Data Here},
	],
	//additional view options: 

	"alignmentAnnotationVisibility": {
        "features": true,
        "translations": false,
        "parts": true,
        "orfs": true,
        "orfTranslations": false,
        "axis": true,
        "cutsites": false,
        "primers": true,
        "reverseSequence": false,
        "lineageLines": true,
        "axisNumbers": true
    },
    "alignmentAnnotationLabelVisibility": {
        "features": true,
        "parts": true,
        "cutsites": false
    },
});

Accessing the alignment state:

const currentAlignmentState = alignment.getState()
//you can view various properties of the alignment such as the selection layer using alignment.getState()
console.info(currentAlignmentState.selectionLayer)

Alignment Track Data Model

Note: alignmentData.sequence is assumed to be the same length for EVERY track within an alignment run or a pairwise alignment sub-alignment!

alignmentData can contain "-" characters, whereas sequenceData should not. Sequence Data is the "raw" data of the sequence being aligned with features/parts/etc.

{
	//JBEI sequence 'GFPuv58'
	// chromatogramData: ab1ParsedGFPuv58,
	sequenceData: {
		id: "2",
		name: "GFPuv58",
		sequence:
			"GTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTT"
	},
	alignmentData: {
		id: "2",
		sequence:
			"GTTCAA--TGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACA---GGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATAC--CCTTGTTAATCGTATCGAGTT--"
	}
}

Chromatogram Data

"chromatogramData": { //only if parsing in an ab1 file
      "aTrace": [], //same as cTrace but for a
      "tTrace": [], //same as cTrace but for t
      "gTrace": [], //same as cTrace but for g
      "cTrace": [0,0,0,1,3,5,11,24,56,68,54,30,21,3,1,4,1,0,0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
      "basePos": [33, 46, 55,], //x position of the bases (can be unevenly spaced)
      "baseCalls": ["A","T", ...etc],
      "qualNums": [],
    },

VersionHistoryView

Flavors of use (aka Embedded in the Editor vs Standalone and UMD vs React):

Can be used on its own (must pass additional props):

<VersionHistoryView {...{getSequenceAtVersion, getVersionList, onSave, exitVersionHistoryView, getCurrentSequenceData}}/>
//or as a UMD module:
window.createVersionHistoryView({getSequenceAtVersion, getVersionList, onSave, exitVersionHistoryView, getCurrentSequenceData})

or as part of the Editor/createVectorEditor

<Editor {...{getSequenceAtVersion, getVersionList, onSave, ToolBarProps: {toolList: ["versionHistoryTool", ...otherTools]}}}/> 
//or as a UMD module:
window.createVectorEditor({getSequenceAtVersion, getVersionList, onSave, ToolBarProps: {toolList: ["versionHistoryTool", ...otherTools]}})

API:

getSequenceAtVersion

(versionId) => teselagenSequenceData

getVersionList

() => [{ versionId: "51241", dateChanged: "12/30/1990", editedBy: "Hector Plahar", revisionType: "Feature Add"}]

onSave [optional] (not necessary unless using the standalone VersionHistoryView)

(event, sequenceDataToSave, editorState, onSuccessCallback) => { same onSave handler as normal }

exitVersionHistoryView [optional] (not necessary unless using the standalone VersionHistoryView)

() => {}

getCurrentSequenceData [optional] (not necessary unless using the standalone VersionHistoryView)

() => teselagenSequenceData //called upon initialization

Implementing Autosave functionality

Development:

Prerequisites

Node.js >= v4 must be installed.

Linking to a project and develop with build-watch

//link everything up:
cd lims/node_modules/react
yarn link 
cd openVectorEditor
yarn link
yarn link react
cd lims
yarn link openVectorEditor

//start the auto rebuild:
cd openVectorEditor
yarn build-watch

You can’t perform that action at this time.