Skip to content
No description, website, or topics provided.
C++ C Objective-C Makefile M4 Perl
Branch: master
Clone or download
jpsglouzon Update README.md
Clarification of abstract
Latest commit 8c52429 Mar 12, 2018
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
Eigen First version Feb 1, 2018
ViennaRNA First version Feb 1, 2018
bin/Release First version Feb 1, 2018
boost First version Feb 1, 2018
README.html First version Feb 1, 2018
README.md Update README.md Mar 12, 2018
RepMotif.cpp First version Feb 1, 2018
RepMotif.h First version Feb 1, 2018
RepWeightedMotif.cpp First version Feb 1, 2018
RepWeightedMotif.h First version Feb 1, 2018
main.cpp First version Feb 1, 2018
makefile Add files via upload Mar 12, 2018

README.md

aliFreeFold Program

Predicting the conserved secondary structures of homologous ribonucleic acid (RNA) sequences is crucial for understanding RNA functions. However, fast and accurate RNA structure prediction is challenging, especially when the number and the divergence of homologuous RNA increases. To address this challenge, we propose aliFreeFold, an alignment-free approach which computes a representative structure from a set of homologuous RNA sequences using suboptimal secondary structures generated for each sequence. It is based on a vector representation of suboptimal structures capturing structure conservation signals by weigthing structural motifs according to their conservation accross the suboptimal structures.

How to compile aliFreeFold ?

  • Download the source code here and unzip.

  • Open the terminal, cd path_to_alifreefold_program to access the super-n-motifs program folder then compile it by running the command make.

  • The executable file named 'alifreefold' can be found in path_to_alifreefold_program/bin/Release.

How to use it?

  • Predict consensus secondary structures by calling:
/path_to_alifreefold_program/alifreefold -i path_to_fileInDb -o path_to_folderOfResults
  • The aliFreeFold program takes as input a file of homologous sequences of rna in fasta format (-i parameter):
>Y08502.1-137669_137741
ACCUACUUGACUCAGCGGUUAGAGUAUCGCUUUCAUACGGCGAGAGUCAUUGGUUCAAAUCCAAUAGUAGGUA
>AF070678.1-91_163
GGGGCCUUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCAGCGGUUCGAUCCCGCUAGGCUCCA
>AJ271079.2-114727_114656
UCCUCAGUAGCUCAGUGGUAGAGCGGUCGGCUGUUAACCGAUUGGUCGUAGGUUCGAAUCCUACUUGGGGAG
>X61698.1-1470_1542
ACCUACUUAACUCAGUGGUUAGAGUACUGCUUUCAUACGGCGGGAGGCAUUGGUUCAAAUCCAAUAGUAGGUA
>V00654.1-12038_12108
ACUUUUAAAGGAUAGUAGUUUAUCCGUUGGUCUUAGGAACCAAAAAAUUGGUGCAACUCCAAAUAAAAGUA

It ouputs a representative structure by default (-o parameter). For further options run: /path_to_alifreefold_program/alifreefold -h

Licence

The aliFreeFold program is released under the terms of the GNU GPL licence. For further informations, please see the LICENCE file of the repository.

You can’t perform that action at this time.