Skip to content
master
Switch branches/tags
Code

Latest commit

 

Git stats

Files

Permalink
Failed to load latest commit information.
Type
Name
Latest commit message
Commit time
css
 
 
 
 
 
 
js
 
 
src
 
 
 
 
 
 
 
 

RNAplot

This package is deprecated and will not be updated!

However, development is continued here: https://github.com/ViennaRNA/fornac

Import the newest version of RNAplot from fornac like this:

var chart = fornac.rnaPlot()

Usage

For a live example, simply load the index.html file.

Otherwise, the following code will display an rna diagram of the structure ((..((....)).(((....))).)).

<!DOCTYPE html>
<meta charset="utf-8">
 <link rel='stylesheet' type='text/css' href='css/d3-rnaplot.css' />

This is an RNA container.
<div id='rna_ss'> </div>
This after the RNA container.

<script type='text/javascript' src='js/d3.js'></script>
<script type='text/javascript' src='js/d3-rnaplot.js'></script>
<script type='text/javascript'>

var svgWidth = 200;
var svgHeight = 200;

var rna1 = {'structure': '((..((....)).(((....))).))',
            'sequence': 'CGCUUCAUAUAAUCCUAAUGACCUAU'
};

var chart = rnaPlot()
.width(svgWidth)
.height(svgHeight)

var svg = d3.select('#rna_ss')
.append('svg')
.attr('width', svgWidth)
.attr('height', svgHeight)


svg.selectAll('.rna')
.data([rna1])
.enter()
.append('g')
.classed('rna', true)
.call(chart);
</script>

Like this:

Screenshot of a simple rna-plot

Adding nucleotide number labels

var chart = rnaPlot()
.width(svgWidth)
.height(svgHeight)
.labelInterval(10);

Showing nucleotide numbers

Change the starting nucleotide number

Specify the number of the first nucleotide so that the labelling is changed accordingly.

var chart = rnaPlot()
.width(svgWidth)
.height(svgHeight)
.startNucleotideNumber(7)
.labelInterval(5)

Changed starting nucleotide number

Create a treemap with embedded RNA structures

We can use the RNA layout and embed it in different places, such as a treemap. The code for this example can be found under examples/rna-treemap.html

Treemap with embedded RNAs

Stupid Compiling

cat src/*.js > js/d3-rnaplot.js

About

No description, website, or topics provided.

Resources

Releases

No releases published

Packages

No packages published