Skip to content
Branch: master
Find file History
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Type Name Latest commit message Commit time
..
Failed to load latest commit information.
01_Basis_scheme_for_import_of_barcode_analysis.xml
02_Add_second_fwd_or_rev_trace.xml
GBOL_Rostpilze_barcodes_complemented_sample.txt
GBOL_Rostpilze_barcodes_complemented_sample.xls
Import der Barcodeanalysen für GBOL Rostpilze.pdf
README.md
SMNKpuccGBOLcoll_DNA_data_preview_01.png
SMNKpuccGBOLcoll_DNA_data_preview_02.png
SMNKpuccGBOLcoll_adding_by_IdentificationUnitID_01.png
SMNKpuccGBOLcoll_adding_by_IdentificationUnitID_02.png
SMNKpuccGBOLcoll_adding_by_IdentificationUnitID_03.png
Settings_GBOL_Rostpilze_adding_scheme.pdf
Settings_GBOL_Rostpilze_basis_scheme.pdf

README.md

These import schemas allow the import of DNA samples of parasite fungi (Pucciniales).

Precondition:

  • host plant and the parasite fungi is already imported in DiversityCollection (with one AccessionNumber)
  • parasite fungi is saved as second Organism on top of the host plant

The ![import table] (https://github.com/ZFMK/Labels-and-Imports-for-DiversityWorkbench/blob/master/ImportSchedules/GBOL/Barcodes_GBOL_Pucciniales/GBOL_Rostpilze_barcodes_complemented_sample.txt) includes the following information:

  • Identifiers (e.g. VoucherID)
  • Identification of host plant and parasite fungi
  • Parameters regarding the amplifying and sequencing (e.g. barcode-sequence, primers of pcr and sequencing, trace links, sequencing center)

This import schema (![basis scheme, xml] (https://github.com/ZFMK/Labels-and-Imports-for-DiversityWorkbench/blob/master/ImportSchedules/GBOL/Barcodes_GBOL_Pucciniales/01_Basis_scheme_for_import_of_barcode_analysis.xml)) was created based on the original organization of the data. For a further successful use of this schema, please keep in mind that interface settings e.g. CollectionID, ProjectID, AnalysisID, ParameterID should be adapted to your installation, as well as other settings like prefixes, postfixes, splitters or filters.

The data was partly imported as two records. In case of a second forward or reverse trace file, you need to import these files with the second schema (adding scheme, xml).

Furthermore you need to adapt the import scheme in case of a second or third parasite fungi on top of one host plant. Then you have to switch in the scheme the Attachment from AccessionNumber to IdentificationUnitID as shown below:

  • In the panel Attachment:

Preview

  • In the panel Specimen/Organism 2: Preview

  • In the panel Specimen/Organism 2: Preview

Preview of the DNA data:

Preview

Preview

  • Further explanations: pdf

  • Settings for the import of the DNA are described below (as pdf):

Pos.NameTableColumnExampleTransformed
0Beleg
CollectionSpecimen. AccessionNumberKR-M-0003370
1Gattung
IdentificationUnit_2. LastIdentificationCacheUromyces
2Art
+IdentificationUnit_2. LastIdentificationCachepisi˽pisi
Prefix:˽
3Wirtsgattung
IdentificationUnit_1. LastIdentificationCacheEuphorbia
4Wirtsart
+IdentificationUnit_1. LastIdentificationCachecyparissias˽cyparissias
Prefix:˽
5well
IdentificationUnitAnalysisMethodParameter_2_1_2_12. Valueh12
IdentificationUnitAnalysisMethodParameter_2_1_3_12. Valueh12
6pcr-for-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_2_2. ValueITS5u
IdentificationUnitAnalysisMethodParameter_2_1_3_2. ValueITS5u
7pcr-for-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_2_3. ValueCAAGGTTTCTGTAGGTG
IdentificationUnitAnalysisMethodParameter_2_1_3_3. ValueCAAGGTTTCTGTAGGTG
8pcr_rev-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_2_4. ValueITS4u
IdentificationUnitAnalysisMethodParameter_2_1_3_4. ValueITS4u
9pcr-rev-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_2_5. ValueGGCTTTTCCCTCTTCAT
IdentificationUnitAnalysisMethodParameter_2_1_3_5. ValueGGCTTTTCCCTCTTCAT
10seq-for-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_2_6. ValueITS5u
11seq-for-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_2_7. ValueCAAGGTTTCTGTAGGTG
12seq_rev-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_3_6. ValueITS4u
13seq-rev-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_3_7. ValueGGCTTTTCCCTCTTCAT
14Region
IdentificationUnitAnalysis_2_1. AnalysisNumberITS
IdentificationUnitAnalysisMethodParameter_2_1_1_1. ValueITS
15Sequencing-Lab
IdentificationUnitAnalysisMethodParameter_2_1_2_8. ParameterIDThines-Labor/Uni Tübingen M. Lutz
IdentificationUnitAnalysisMethodParameter_2_1_2_8. ValueThines-Labor/Uni Tübingen M. Lutz
IdentificationUnitAnalysisMethodParameter_2_1_3_8. ValueThines-Labor/Uni Tübingen M. Lutz
16Edited by
IdentificationUnitAnalysis_2_1. ResponsibleNameM. Lutz
17Annotations
IdentificationUnitAnalysis_2_1. Notes
18Problems
IdentificationUnitAnalysisMethodParameter_2_1_1_3. Value
Transformations:
Filter
Import fixed value: yes
If column 18 ≠
IdentificationUnitAnalysisMethodParameter_2_1_1_4. Value
19Barcode-Sequenz
IdentificationUnitAnalysis_2_1. AnalysisIDAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA
IdentificationUnitAnalysis_2_1. AnalysisResultAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA
IdentificationUnitAnalysisMethod_2_1_1. MethodIDAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA12
Transformations:
Filter
Import fixed value: 12
If column 19 ≠
IdentificationUnitAnalysisMethod_2_1_1. MethodMarkerAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA1
Transformations:
Filter
Import fixed value: 1
If column 19 ≠
IdentificationUnitAnalysisMethodParameter_2_1_1_5. ValueAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA
IdentificationUnitAnalysisMethod_2_1_2. MethodIDAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA16
Transformations:
Filter
Import fixed value: 16
If column 19 ≠
IdentificationUnitAnalysisMethod_2_1_2. MethodMarkerAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA2
Transformations:
Filter
Import fixed value: 2
If column 19 ≠
IdentificationUnitAnalysisMethodParameter_2_1_2_11. ValueAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTAP:\GFBio\GBOL_Rostpilze\3_Trace_Archived\Traces\
Transformations:
Filter
Import fixed value: P:\GFBio\GBOL_Rostpilze\3_Trace_Archived\Traces\
If column 19 ≠
IdentificationUnitAnalysisMethod_2_1_3. MethodIDAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA16
Transformations:
Filter
Import fixed value: 16
If column 19 ≠
IdentificationUnitAnalysisMethod_2_1_3. MethodMarkerAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA3
Transformations:
Filter
Import fixed value: 3
If column 19 ≠
20Rohdatenfile fwd 1
IdentificationUnitAnalysisMethodParameter_2_1_2_9. ValueAT_gbol4_c12_ITS5u_F_D11_1.ab1AB1
Transformations:
Split at Pos.Dir.
.
1
TranslateInto
ab1AB1
scfSCF
SCFSCF
IdentificationUnitAnalysisMethodParameter_2_1_2_10. ValueAT_gbol4_c12_ITS5u_F_D11_1.ab1
+IdentificationUnitAnalysisMethodParameter_2_1_2_11. ValueAT_gbol4_c12_ITS5u_F_D11_1.ab1
21Rohdatenfile fwd 2not imported
22Rohdatenfile rev 1
IdentificationUnitAnalysisMethodParameter_2_1_3_9. ValueAT_gbol4_c12_ITS4u_R_D11_1.ab1AB1
Transformations:
Split at Pos.Dir.
.
1
TranslateInto
ab1AB1
scfSCF
SCFSCF
IdentificationUnitAnalysisMethodParameter_2_1_3_10. ValueAT_gbol4_c12_ITS4u_R_D11_1.ab1
IdentificationUnitAnalysisMethodParameter_2_1_3_11. ValueAT_gbol4_c12_ITS4u_R_D11_1.ab1P:\GFBio\GBOL_Rostpilze\3_Archived\Traces
Transformations:
Filter
Import fixed value: P:\GFBio\GBOL_Rostpilze\3_Archived\Traces
If column 19 ≠
+IdentificationUnitAnalysisMethodParameter_2_1_3_11. ValueAT_gbol4_c12_ITS4u_R_D11_1.ab1
23Rohdatenfile rev 2not imported
24Withhold
CollectionSpecimen. DataWithholdingReason
25Interne Bemerkungnot imported
26Dateiname
Annotation_1. AnnotationML-barcodes_1_gelb.xlsP:\GFBio\GBOL_Rostpilze\1_Raw\
Transformations:
Filter
Import fixed value: P:\GFBio\GBOL_Rostpilze\1_Raw\
If column 19 ≠
+Annotation_1. AnnotationML-barcodes_1_gelb.xls
Transformations:
Filter
Import content of column in file
If column 19 ≠
27IdentificationUnitIDnot imported

Interface settings
TableTable aliasColumnValue
AnnotationAnnotation_1AnnotationTypeAnnotation
Annotation_1TitleOriginal file - barcode analysis
CollectionProjectCollectionProject_1ProjectID940
IdentificationUnitIdentificationUnit_1TaxonomicGroupplant
IdentificationUnit_2TaxonomicGroupfungus
IdentificationUnitAnalysisIdentificationUnitAnalysis_2_1AnalysisID161
IdentificationUnitAnalysisMethodParameterIdentificationUnitAnalysisMethodParameter_2_1_1_1ParameterID62
IdentificationUnitAnalysisMethodParameter_2_1_1_2ParameterID27
IdentificationUnitAnalysisMethodParameter_2_1_1_2ValueGBOL-Rostpilze
IdentificationUnitAnalysisMethodParameter_2_1_1_3ParameterID28
IdentificationUnitAnalysisMethodParameter_2_1_1_4ParameterID29
IdentificationUnitAnalysisMethodParameter_2_1_1_5ParameterID90
IdentificationUnitAnalysisMethodParameter_2_1_2_1ParameterID73
IdentificationUnitAnalysisMethodParameter_2_1_2_1Valueforward
IdentificationUnitAnalysisMethodParameter_2_1_2_2ParameterID63
IdentificationUnitAnalysisMethodParameter_2_1_2_3ParameterID64
IdentificationUnitAnalysisMethodParameter_2_1_2_4ParameterID65
IdentificationUnitAnalysisMethodParameter_2_1_2_5ParameterID66
IdentificationUnitAnalysisMethodParameter_2_1_2_6ParameterID91
IdentificationUnitAnalysisMethodParameter_2_1_2_7ParameterID92
IdentificationUnitAnalysisMethodParameter_2_1_2_8ParameterID72
IdentificationUnitAnalysisMethodParameter_2_1_2_9ParameterID81
IdentificationUnitAnalysisMethodParameter_2_1_2_10ParameterID74
IdentificationUnitAnalysisMethodParameter_2_1_2_11ParameterID75
IdentificationUnitAnalysisMethodParameter_2_1_2_12ParameterID85
IdentificationUnitAnalysisMethodParameter_2_1_3_1ParameterID73
IdentificationUnitAnalysisMethodParameter_2_1_3_1Valuereverse
IdentificationUnitAnalysisMethodParameter_2_1_3_2ParameterID63
IdentificationUnitAnalysisMethodParameter_2_1_3_3ParameterID64
IdentificationUnitAnalysisMethodParameter_2_1_3_4ParameterID65
IdentificationUnitAnalysisMethodParameter_2_1_3_5ParameterID66
IdentificationUnitAnalysisMethodParameter_2_1_3_6ParameterID91
IdentificationUnitAnalysisMethodParameter_2_1_3_7ParameterID92
IdentificationUnitAnalysisMethodParameter_2_1_3_8ParameterID72
IdentificationUnitAnalysisMethodParameter_2_1_3_9ParameterID81
IdentificationUnitAnalysisMethodParameter_2_1_3_10ParameterID74
IdentificationUnitAnalysisMethodParameter_2_1_3_11ParameterID75
IdentificationUnitAnalysisMethodParameter_2_1_3_12ParameterID85

  • Settings for the second scheme to import a second forward or reverse trace file (as pdf)
Pos.NameTableColumnExampleTransformed
0Beleg
CollectionSpecimen. AccessionNumberKR-M-0003370
1Gattung
IdentificationUnit_2. LastIdentificationCacheUromyces
2Art
+IdentificationUnit_2. LastIdentificationCachepisi˽pisi
Prefix:˽
3Wirtsgattung
IdentificationUnit_1. LastIdentificationCacheEuphorbia
4Wirtsart
+IdentificationUnit_1. LastIdentificationCachecyparissias˽cyparissias
Prefix:˽
5well
IdentificationUnitAnalysisMethodParameter_2_1_2_12. Valueh12
IdentificationUnitAnalysisMethodParameter_2_1_3_12. Valueh12
6pcr-for-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_2_2. ValueITS5u
IdentificationUnitAnalysisMethodParameter_2_1_3_2. ValueITS5u
7pcr-for-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_2_3. ValueCAAGGTTTCTGTAGGTG
IdentificationUnitAnalysisMethodParameter_2_1_3_3. ValueCAAGGTTTCTGTAGGTG
8pcr_rev-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_2_4. ValueITS4u
IdentificationUnitAnalysisMethodParameter_2_1_3_4. ValueITS4u
9pcr-rev-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_2_5. ValueGGCTTTTCCCTCTTCAT
IdentificationUnitAnalysisMethodParameter_2_1_3_5. ValueGGCTTTTCCCTCTTCAT
10seq-for-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_2_6. ValueITS5u
11seq-for-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_2_7. ValueCAAGGTTTCTGTAGGTG
12seq_rev-primer-name
IdentificationUnitAnalysisMethodParameter_2_1_3_6. ValueITS4u
13seq-rev-primer-seq
IdentificationUnitAnalysisMethodParameter_2_1_3_7. ValueGGCTTTTCCCTCTTCAT
14Region
IdentificationUnitAnalysis_2_1. AnalysisNumberITS
15Sequencing-Lab
IdentificationUnitAnalysisMethodParameter_2_1_2_8. ValueThines-Labor/Uni Tübingen M. Lutz
IdentificationUnitAnalysisMethodParameter_2_1_3_8. ValueThines-Labor/Uni Tübingen M. Lutz
16Edited bynot imported
17Annotationsnot imported
18Problemsnot imported
19Barcode-Sequenz
IdentificationUnitAnalysis_2_1. AnalysisIDAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA
IdentificationUnitAnalysisMethod_2_1_2. MethodIDAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA16
Transformations:
Filter
Import fixed value: 16
If column 19 ≠
And If column 21 ≠
IdentificationUnitAnalysisMethod_2_1_2. MethodMarkerAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA4
Transformations:
Filter
Import fixed value: 4
If column 19 ≠
And If column 21 ≠
IdentificationUnitAnalysisMethod_2_1_3. MethodIDAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA
Transformations:
Filter
Import fixed value: 16
If column 19 ≠
And If column 23 ≠
IdentificationUnitAnalysisMethod_2_1_3. MethodMarkerAGAAGGATCATTATTTAAAACCAATGAGTGCACTTTATTGTGGCTCAAACTCTTTTATCTCACCCCTTTTTTTTTTGTTTGTAACACAAGTTGAATTAAGAATGTAAAAAACCTTTTATTTTGAAAATAACTTTTAACAATGGATCTCTTGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACGCCTGTTTGAGTGTCATGAAAATCTCTCATCAAATTAATTTTTGGTGGATGTTGAGTGCTGCTGCTATCTAGCTCACTTTAAATATATAAGTTCTTCCTTTATGTTGTTGGATTGACTTGGTGTAATATTTAACTTTTTTTTCATCAAGGAAAGTAGAAATACTTGCCAACAATTTTTAAAATAAGGACTCCTAAAAATATTTATTTATAATCTTTTTTAAGACCTCAAATCAGGTGGGACTACCTGCTGAACTTAAGCATATCAATAAGCAGAGGAAAAGAAACTA
Transformations:
Filter
Import fixed value: 5
If column 19 ≠
And If column 23 ≠
20Rohdatenfile fwd 1not imported
21Rohdatenfile fwd 2
IdentificationUnitAnalysisMethodParameter_2_1_2_9. Value
Transformations:
Split at Pos.Dir.
.
1
TranslateInto
ab1AB1
scfSCF
SCFSCF
IdentificationUnitAnalysisMethodParameter_2_1_2_10. Value
IdentificationUnitAnalysisMethodParameter_2_1_2_11. ValueP:\GFBio\GBOL_Rostpilze\3_Archived\Traces
Transformations:
Filter
Import fixed value: P:\GFBio\GBOL_Rostpilze\3_Archived\Traces
If column 19 ≠
+IdentificationUnitAnalysisMethodParameter_2_1_2_11. Value
22Rohdatenfile rev 1not imported
23Rohdatenfile rev 2
IdentificationUnitAnalysisMethodParameter_2_1_3_9. Value
Transformations:
Split at Pos.Dir.
.
1
TranslateInto
ab1AB1
scfSCF
SCFSCF
IdentificationUnitAnalysisMethodParameter_2_1_3_10. Value
IdentificationUnitAnalysisMethodParameter_2_1_3_11. ValueP:\GFBio\GBOL_Rostpilze\3_Archived\Traces
Transformations:
Filter
Import fixed value: P:\GFBio\GBOL_Rostpilze\3_Archived\Traces
If column 19 ≠
+IdentificationUnitAnalysisMethodParameter_2_1_3_11. Value
24Withhold
CollectionSpecimen. DataWithholdingReason
25Interne Bemerkungnot imported
26Dateinamenot imported
27IdentificationUnitIDnot imported

Interface settings
TableTable aliasColumnValue
CollectionProjectCollectionProject_1ProjectID940
IdentificationUnitIdentificationUnit_1TaxonomicGroupplant
IdentificationUnit_2TaxonomicGroupfungus
IdentificationUnitAnalysisIdentificationUnitAnalysis_2_1AnalysisID161
IdentificationUnitAnalysisMethodParameterIdentificationUnitAnalysisMethodParameter_2_1_2_1ParameterID73
IdentificationUnitAnalysisMethodParameter_2_1_2_1Valueforward
IdentificationUnitAnalysisMethodParameter_2_1_2_2ParameterID63
IdentificationUnitAnalysisMethodParameter_2_1_2_3ParameterID64
IdentificationUnitAnalysisMethodParameter_2_1_2_4ParameterID65
IdentificationUnitAnalysisMethodParameter_2_1_2_5ParameterID66
IdentificationUnitAnalysisMethodParameter_2_1_2_6ParameterID91
IdentificationUnitAnalysisMethodParameter_2_1_2_7ParameterID92
IdentificationUnitAnalysisMethodParameter_2_1_2_8ParameterID72
IdentificationUnitAnalysisMethodParameter_2_1_2_9ParameterID81
IdentificationUnitAnalysisMethodParameter_2_1_2_10ParameterID74
IdentificationUnitAnalysisMethodParameter_2_1_2_11ParameterID75
IdentificationUnitAnalysisMethodParameter_2_1_2_12ParameterID85
IdentificationUnitAnalysisMethodParameter_2_1_3_1ParameterID73
IdentificationUnitAnalysisMethodParameter_2_1_3_1Valuereverse
IdentificationUnitAnalysisMethodParameter_2_1_3_2ParameterID63
IdentificationUnitAnalysisMethodParameter_2_1_3_3ParameterID64
IdentificationUnitAnalysisMethodParameter_2_1_3_4ParameterID65
IdentificationUnitAnalysisMethodParameter_2_1_3_5ParameterID66
IdentificationUnitAnalysisMethodParameter_2_1_3_6ParameterID91
IdentificationUnitAnalysisMethodParameter_2_1_3_7ParameterID92
IdentificationUnitAnalysisMethodParameter_2_1_3_8ParameterID72
IdentificationUnitAnalysisMethodParameter_2_1_3_9ParameterID81
IdentificationUnitAnalysisMethodParameter_2_1_3_10ParameterID74
IdentificationUnitAnalysisMethodParameter_2_1_3_11ParameterID75
IdentificationUnitAnalysisMethodParameter_2_1_3_12ParameterID85
You can’t perform that action at this time.