LinearFold: Linear-Time Prediction for RNA Secondary Structures
This repository contains the C++ source code for the LinearFold project, the first linear-time prediction algorithm/software for RNA secondary structures.
Preprint: LinearFold: Linear-Time Prediction of RNA Secondary Structures
Dezhong Deng, Kai Zhao, David Hendrix, David Mathews, and Liang Huang*
*corresponding author
doi: https://doi.org/10.1101/263509
Web server: http://linearfold.eecs.oregonstate.edu
To Compile
LinearFold can be compiled with cmake
with following commands:
mkdir build
cd build
cmake ..
make linearfold
Note that there are two external libraries stated in CMakeLists.txt
file:
-lprofiler
is from Google Performance Tools, and is used to profile the parser, which is turned off by default.-ltcmalloc
is also from Google Performance Tools, which replaces the defaultmalloc
fromglibc
and can bring ~5% speedup.
A minimum gcc version of 4.9.0 is required.
To Run
The LinearFold parser can be run with:
echo "SEQUENCE" | linearfold [OPTIONS]
OR
cat SEQ_OR_FASTA_FILE | linearfold [OPTIONS]
Both FASTA format and pure-sequence format are supported for input.
OPTIONS:
-b --beam_size
The beam size (default 100). Use 0 for infinite beam.
-V --Vienna
Switches LinearFold-C (by default) to LinearFold-V.
-v --verbose
Prints out energy of each loop in the structure. (default False)
-m --multiline
Output in the CONTRAfold multiline format. (default False)
For example:
Example Run
cat ../testseq | ./linearfold
echo "GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGAGGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA" | ./linearfold -b 20 -Vvm