Permalink
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
84 lines (83 sloc) 14.2 KB
We can make this file beautiful and searchable if this error is corrected: Illegal quoting in line 4.
MiAIRR data set / subset MiAIRR field designation Data type Content format MiAIRR content definition Field value example AIRR Formats WG field name
1 / study Study string Free text Unique ID assigned by study registry PRJNA001 study_id
1 / study Study title string Free text Descriptive study title Effects of sun light exposure of the Treg repertoire study_title
1 / study Study type string {"ontology": "NCIT", "top_node": "Study Design", "draft": true} Generic study design Case-Control Study study_description
1 / study Study inclusion/exclusion criteria string Free text List of criteria for inclusion/exclusion for the study Include: Clinical P. falciparum infection; Exclude: Seropositive for HIV inclusion_exclusion_criteria
1 / study Grant funding agency string Free text Funding agencies and grant numbers NIH, award number R01GM987654 grants
1 / study Contact information (data collection) string Free text Full contact information of the data collector, i.e. the person who is legally responsible for data collection and release. This should include an e-mail address. Dr. P. Stibbons, p.stibbons@unseenu.edu collected_by
1 / study Lab name string Free text Department of data collector Department for Planar Immunology lab_name
1 / study Lab address string Free text Institution and institutional address of data collector School of Medicine, Unseen University, Ankh-Morpork, Disk World lab_address
1 / study Contact information (data deposition) string Free text Full contact information of the data depositor, i.e. the person submitting the data to a repository. This is supposed to be a short-lived and technical role until the submission is relased. Adrian Turnipseed, a.turnipseed@unseenu.edu submitted_by
1 / study Relevant publications string Valid PubMed ID Publications describing the rationale and/or outcome of the study PMID85642 pub_ids
1 / subject Subject ID string Free text Subject ID assigned by submitter, unique within study SUB856413 subject_id
1 / subject Synthetic library boolean TRUE/FALSE TRUE for libraries in which the diversity has been synthetically generated (e.g. phage display) FALSE synthetic
1 / subject Organism string {"ontology": "NCBITAXON", "top_node": "Gnathostomata", "draft": false} Species of subject (using binomial nomenclature) Homo sapiens organism
1 / subject Sex string {"controlled_vocabulary": ["male", "female", "pooled", "hermaphrodite", "intersex", "not collected", "not applicable"]} Biological sex of subject female sex
1 / subject Age string Time duration and unit Absolute age of subject at time point `Age event` 65 a age
1 / subject Age event string Free text Event in the study schedule to which `Age` refers. For NCBI BioSample this MUST be `sampling`. For other implementations submitters need to be aware that there is currently no mechanism to encode to potential delta between `Age event` and `Sample collection time`, hence the chosen events should be in temporal proximity. enrollment age_event
1 / subject Ancestry population string Free text Broad geographic origin of ancestry (continent) list of continents, mixed or unknown ancestry_population
1 / subject Ethnicity string Free text Ethnic group of subject (defined as cultural/language-based membership) English, Kurds, Manchu, Yakuts (and other fields from Wikipedia) ethnicity
1 / subject Race string Free text Racial group of subject (as defined by NIH) White, American Indian or Alaska Native, Black, Asian, Native Hawaiian or Other Pacific Islander, Other race
1 / subject Strain name string Free text Non-human: designation of the strain or breed of animal used C57BL/6J strain_name
1 / subject Relation to other subjects string Free text Subject ID to which `Relation type` refers SUB1355648 linked_subjects
1 / subject Relation type string Free text Relation between subject and `linked_subjects`, can be genetic or environmental (e.g.exposure) father, daughter, household link_type
1 / diag. & intervent. Study group description string Free text Designation of study arm to which the subject is assigned to control study_group_description
1 / diag. & intervent. Diagnosis string Free text Diagnosis of subject Multiple myeloma disease_diagnosis
1 / diag. & intervent. Length of disease string Time duration and unit Time duration between initial diagnosis and current intervention 23 months disease_length
1 / diag. & intervent. Disease stage string Free text Stage of disease at current intervention Stage II disease_stage
1 / diag. & intervent. Prior therapies for primary disease under study string Free text List of all relevant previous therapies applied to subject for treatment of `Diagnosis` melphalan/prednisone prior_therapies
1 / diag. & intervent. Immunogen/agent string Free text Antigen, vaccine or drug applied to subject at this intervention bortezomib immunogen
1 / diag. & intervent. Intervention definition string Free text Description of intervention systemic chemotherapy, 6 cycles, 1.25 mg/m2 intervention
1 / diag. & intervent. Other relevant medical history string Free text Medical history of subject that is relevant to assess the course of disease and/or treatment MGUS, first diagnosed 5 years prior medical_history
2 / sample Biological sample ID string Free text Sample ID assigned by submitter, unique within study SUP52415 sample_id
2 / sample Sample type string Free text The way the sample was obtained, e.g. fine-needle aspirate, organ harvest, peripheral venous puncture Biopsy sample_type
2 / sample Tissue string Free text The actual tissue sampled, e.g. lymph node, liver, peripheral blood Bone marrow tissue
2 / sample Anatomic site string Free text The anatomic location of the tissue, e.g. Inguinal, femur Iliac crest anatomic_site
2 / sample Disease state of sample string Free text Histopathologic evaluation of the sample Tumor infiltration disease_state_sample
2 / sample Sample collection time string Free text Time point at which sample was taken, relative to `Collection time event` 14 d collection_time_point_relative
2 / sample Collection time event string Free text Event in the study schedule to which `Sample collection time` relates to Primary vaccination collection_time_point_reference
2 / sample Biomaterial provider string Free text Name and address of the entity providing the sample Tissues-R-Us, Tampa, FL, USA biomaterial_provider
3 / process (cell) Tissue processing string Free text Enzymatic digestion and/or physical methods used to isolate cells from sample Collagenase A/Dnase I digested, followed by Percoll gradient tissue_processing
3 / process (cell) Cell subset string {"ontology": "CL", "top_node": "lymphocyte", "draft": true} Commonly-used designation of isolated cell population class switched memory B cell cell_subset
3 / process (cell) Cell subset phenotype string Free text List of cellular markers and their expression levels used to isolate the cell population CD19+ CD38+ CD27+ IgM- IgD- cell_phenotype
3 / process (cell) Single-cell sort boolean TRUE/FALSE TRUE if single cells were isolated into separate compartments FALSE single_cell
3 / process (cell) Number of cells in experiment integer Number Total number of cells that went into the experiment 1000000 cell_number
3 / process (cell) Number of cells per sequencing reaction integer Number Number of cells for each biological replicate 50000 cells_per_reaction
3 / process (cell) Cell storage boolean TRUE/FALSE TRUE if cells were cryo-preserved between isolation and further processing TRUE cell_storage
3 / process (cell) Cell quality string Free text Relative amount of viable cells after preparation and (if applicable) thawing 90% viability as determined by 7-AAD cell_quality
3 / process (cell) Cell isolation / enrichment procedure string Free text Description of the procedure used for marker-based isolation or enrich cells Cells were stained with fluorochrome labeled antibodies and then sorted on a FlowMerlin (CE) cytometer cell_isolation
3 / process (cell) Processing protocol string Free text Description of the methods applied to the sample including cell preparation/ isolation/enrichment and nucleic acid extraction. This should closely mirror the Materials and methods section in the manuscript Stimulated wih anti-CD3/anti-CD28 cell_processing_protocol
3 / process (nucl. acid) Target substrate string {"controlled_vocabulary": ["DNA", "RNA"]} The class of nucleic acid that was used as primary starting material for the following procedures RNA template_class
3 / process (nucl. acid) Target substrate quality string Free text Description and results of the quality control performed on the template material RIN 9.2 template_quality
3 / process (nucl. acid) Template amount string Free text Amount of template that went into the process 1000 ng template_amount
3 / process (nucl. acid) Library generation method string {"controlled_vocabulary": ["PCR", "RT(RHP)+PCR", "RT(oligo-dT)+PCR", "RT(oligo-dT)+TS+PCR", "RT(oligo-dT)+TS(UMI)+PCR", "RT(specific)+PCR", "RT(specific)+TS+PCR", "RT(specific)+TS(UMI)+PCR", "RT(specific+UMI)+PCR", "RT(specific+UMI)+TS+PCR", "RT(specific)+TS", "other"]} Generic type of library generation RT(oligo-dT)+PCR library_generation_method
3 / process (nucl. acid) Library generation protocol string Free text Description of processes applied to substrate to obtain a library that is ready for sequencing cDNA was generated using library_generation_protocol
3 / process (nucl. acid) Protocol IDs string Free text When using a library generation protocol from a commercial provider, provide the protocol version number v2.1 (2016-09-15) library_generation_kit_version
3 / process (nucl. acid) Target locus for PCR string Free text Designation of the target locus according to standard gene nomencleature Constant region vs. V region amplification pcr_target_locus
3 / process (nucl. acid) Forward PCR primer target location string Free text Position of the most distal nucleotide templated by the forward primer or primer mix IGHV, +23 forward_pcr_primer_target_location
3 / process (nucl. acid) Reverse PCR primer target location string Free text Position of the most proximal nucleotide templated by the reverse primer or primer mix IGHG, +57 reverse_pcr_primer_target_location
3 / process (nucl. acid) Complete sequences string {"controlled_vocabulary": ["partial", "complete", "complete+untemplated"]} To be considered `complete`, the procedure used for library construction MUST generate sequences that 1) include the first V segment codon that encodes the mature polypeptide chain (i.e. after the leader sequence) and 2) include the last complete codon of the J segment (i.e. 1 bp before the J->C splice site) and 3) provide sequence information for all positions between 1) and 2). To be considered `complete & untemplated`, the sections of the sequences defined in points 1) to 3) of the previous sentence MUST be untemplated, i.e. MUST NOT overlap with the primers used in library preparation. partial complete_sequences
3 / process (nucl. acid) Physical linkage of different loci string {"controlled_vocabulary": ["none", "hetero_head-head"]} Describes the mode of linkage if a method was used which physically links nucleic acids derived from distinct loci in a single-cell context IGH-IGK/IGL-head/head physical_linkage
3 / process (nucl. acid) Total reads passing QC filter integer Number Number of usable reads for analysis 10365118 total_reads_passing_qc_filter
3 / process (nucl. acid) Sequencing platform string Free text Designation of sequencing instrument used Alumina LoSeq 1000 sequencing_platform
3 / process (nucl. acid) Read lengths integer Array of numbers Read length in bases for each direction [300,300] read_length
3 / process (nucl. acid) Sequencing facility string Free text Name and address of sequencing facility Seqs-R-Us, Vancouver, BC, Canada sequencing_facility
3 / process (nucl. acid) Batch number string Free text ID of sequencing run assigned by the sequencing facility 160101_M01234_0201_000000000-D2T7V sequencing_run_id
3 / process (nucl. acid) Date of sequencing run string ISO8601-compliant date Date of sequencing run 2016-12-16 sequencing_run_date
3 / process (nucl. acid) Sequencing kit string Free text Name, manufacturer, order and lot numbers of sequencing kit FullSeq 600, Alumina, #M123456C0, 789G1HK sequencing_kit
4 / data (raw reads) Raw sequence data FASTQ Sequence and quality score of all passing reads <n/a>
5 / process (comput.) Software tools and version numbers string Free text Version number and / or date, include company pipelines IgBLAST 1.6 software_versions
5 / process (comput.) Paired read assembly string Free text How paired end reads were assembled into a single receptor sequence PandaSeq (minimal overlap 50, threshold 0.8) paired_reads_assembly
5 / process (comput.) Quality thresholds string Free text How sequences were removed from (4) based on base quality scores quality_thresholds
5 / process (comput.) Primer match cutoffs string Free text How primers were identified in the sequences, were they removed/masked/etc? primer_match_cutoffs
5 / process (comput.) Collapsing method string Free text The method used for combining multiple sequences from (4) into a single sequence in (5) MUSCLE 3.8.31 collapsing_method
5 / process (comput.) Data processing protocols string Free text General description of how QC is performed data_processing_protocols
6 / data (proc. seq.) V(D)J germline reference database string Free text Databases used for VDJC gene annotation plus date of retrieval / version ENSEMBL, Homo sapiens build 90, 2017-10-01 germline_database
6 / data (proc. seq.) Cell Index string Free text User-specified ID for the cell from which the sequence was obtained W06_046_091 cell_id
6 / data (proc. seq.) V gene string Free text V segment gene and allele IGHV1-34*01 v_call
6 / data (proc. seq.) D gene string Free text D segment gene and allele IGHD2-2*01 d_call
6 / data (proc. seq.) J gene string Free text J segment gene and allele IGHJ4*01 j_call
6 / data (proc. seq.) C region string Free text Constant region gene and allele IGHG1 c_call
6 / data (proc. seq.) IMGT-JUNCTION nucleotide sequence string Free text Nucleotide sequence of the IMGT-JUNCTION TGTGCAAGAGCGGGAGTTTACGACGGATATACTATGGACTACTGG junction
6 / data (proc. seq.) IMGT-JUNCTION amino acid sequence string Free text Amino acid sequence of the IMGT-JUNCTION CARAGVYDGYTMDYW junction_aa
6 / data (proc. seq.) Read count integer Number Number of reads used to build sequence 123 duplicate_count