Skip to content

akiomiyao/tif

master
Switch branches/tags
Code

Latest commit

 

Git stats

Files

Permalink
Failed to load latest commit information.
Type
Name
Latest commit message
Commit time
 
 
 
 
 
 
 
 
 
 

TIF

Transposon Insertion Finder

Transposon Insertion Finder (TIF) is a search program to detect insertions of transposable element from short reads of next generation sequencer. The program is written in a perl script. The program runs on Unix (Linux) platform. The TIF requires short sequences of both ends of target transposable element. Basic TIF (tif_basic.pl) does not require reference genome sequence to select short reads containing target sites, whereas extended TIF (tif_extended require the reference sequence and BLAST program). Length of target site duplication (TSD) is required by tif_basic.pl and tif_original.pl.

TIF (tif_original.pl) is one of the fastest and the smallest program among analysis programs of next generation sequencing (NGS). The distinctive feature of TIF is direct selection containing end sequences of the target transposable element from short reads of NGS.

Web page: https://akiomiyao.github.io/tif/

Update

  • tif.pl genotyping function has been added. (2022-01-04)
    Run tif.pl without an argument, help will be shown.

  • tif.pl has been improved. (2021-03-23)

    e.g. perl tif.pl reference_genome.fasta target_directory TE_head_sequence TE_tail_sequence
    First argument is the path of reference sequence with multi-fasta format.
    Second argument is the target directory containing read directory.
    Third argument is the head sequence of transposon.
    Fourth argument is the tail sequence of transposon.
    Fifth argument is maximun number of process (optional).
    All short reads (e.g name_r1.fastq, name_r2.fastq) in 'target/read' directory will be analyzed.
    TE_head and TE_tail sequences are 17-23 bases of 5'-end, and 3'-end of the transposable element.
    Run without argument, help will be shown.

    e.g. perl tif.pl IRGSP-1.0_genome.fasta ttm5 TGTTAAATATATATACA TTGCAAGTTAGTTAAGA

    This version does not depend on BLAST search. Search script was included in tif.pl.
    This update is for the multi-core environment.

  • New script tif_nonltr.pl is implemented. (2020-08-19)
    tif_nonltr.pl detects insertions of non-LTR retrotransposons.
    perl tif_nonltr.pl
    will show the usage.

  • New script tif_flanking.pl is implemented. (2019-03-21)
    tif_flanking is update of tif_basic.pl.
    If you do not have reference genome sequnce, try tif_flanking.pl.
    tif_flanking outputs flanking sequence of transposon insertion in fasta format.
    Run without argument, help will be shown.

  • TIF is a powerful tool.
    Genomic impact of stress-induced transposable element mobility in Arabidopsis
    David Roquis, Marta Robertson, Liang Yu, Michael Thieme, Magdalena Julkowska, Etienne Bucher
    Nucleic Acids Res. 49(18):10431-10447 (2021)
    https://doi.org/10.1093/nar/gkab828

    Sensitive detection of pre-integration intermediates of long terminal repeat retrotransposons in crop plants
    Jungnam Cho, Matthias Benoit, Marco Catoni, Hajk-Georg Drost, Anna Brestovitsky, Matthijs Oosterbeek, Jerzy Paszkowski
    Nature Plants, 5:26–33 (2019)
    https://doi.org/10.1038/s41477-018-0320-9

    Mobilization of Pack-CACTA transposons in Arabidopsis suggests the mechanism of gene shuffling
    Marco Catoni, Thomas Jonesman, Elisa Cerruti, Jerzy Paszkowski
    Nucleic Acids Research, 47(3):1311–1320 (2019)
    https://doi.org/10.1093/nar/gky1196

Download TIF

Download zip file of PED from https://github.com/akiomiyao/tif and extract.

or

  git clone https://github.com/akiomiyao/tif.git  

If you got scripts from github, update to newest version is very easy using git pull command.

  git pull  

Demonstration of tif.pl

For example,

  perl tif.pl IRGSP-1.0_genome.fasta target TGTTAAATATATATACA TTGCAAGTTAGTTAAGA

or

  perl tif.pl TAIR10_chr_all.fas target GAGGGATCATCTCTTGTGTC GACTGGCCAGACGATTATTC

or

  perl tif.pl dmel-all-chromosome-r6.29.fasta target CATGATGAAATAACAT ATGTTATTTCATCATG

Before run tif.pl, download fastq file in target/read directory.
For example, in the case of target name is ttm2

  cd tif  
  mkdir ttm2  
  mkdir ttm2/read  
  cp somewhere/ttm2.fastq ttm2/read  
  perl tif.pl IRGSP-1.0_genome.fasta ttm2 TGTTAAATATATATACA TTGCAAGTTAGTTAAGA  

Result will be saved to tif_result.head_sequence.tail_sequence and vcf files in the target directory.

The tif.pl is easy to use and has high sensitivity rather than old programs.

For Tos17 retrotransposon of rice

  Head of Tos17: TGTTAAATATATATACA
  Tail of Tos17: TTGCAAGTTAGTTAAGA
  Size of TSD: 5
  fastq: SRR556173 SRR556174 SRR556175
  reference: https://rapdb.dna.affrc.go.jp/download/archive/irgsp1/IRGSP-1.0_genome.fasta.gz

For mPing transposon of rice (DNA type transposon)

  Head of mPing: GGCCAGTCACAATGGGG
  Tail of mPing: AGCCATTGTGACTGGCC
  Size of TSD: 3

For nDart transposon of rice (DNA type transposon)

  Head of nDart: TAGAGGTGGCCAAACGGGC
  Tail of nDart: GCCCGTTTGGCCACCTCTA
  Size of TSD: 8

For P-element of Drosophila melanogaster

  Head of P-element: CATGATGAAATAACAT
  Tail of P-element: ATGTTATTTCATCATG
  Size of TSD: 8
  fastq: SRR823377 SRR823382
  reference: ftp://ftp.flybase.net/genomes/Drosophila_melanogaster/dmel_r6.29_FB2019_04/fasta/dmel-all-chromosome-r6.29.fasta.gz

For Hi of Arabidopsis thaliana

  Head of Hi: GAGGGATCATCTCTTGTGTC
  Tail of Hi: GACTGGCCAGACGATTATTC
  Size of TSD: 9
  doi: https://doi.org/10.1038/emboj.2013.169
  fastq: DRR001193 (ddm1 mutant)
  reference: https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas

For ONSEN of Arabidopsis thaliana

  Head of ONSEN: TGTTGAAAGTTAAACTTGAT
  Tail of ONSEN: AAAAGAATTTTACTCTAACA
  Size of TSD: 5
  ONSEN accessions: AT1G11265, AT1G21945, AT1G48710, AT1G58140, AT3G32415, AT3G59720, AT3G61330, AT5G13205
  doi: https://doi.org/10.1093/nar/gkab828
  fastq: https://zenodo.org/record/5052019#.Yd-Fu_7P2Ul
  reference: https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas

To obtain short read data

Download sra tool kit from

https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=software

In your home directory,

  tar xvfz sratoolkit.2.x.x-xxxxxx_linux64.tar.gz
  copy fastq-dump in bin directory to executable directory.

Detail of fastq-dump setup is described in

https://akiomiyao.github.io/ped/sratoolkit/index.html (English)

https://akiomiyao.github.io/ped/sratoolkit/index_ja.html (Japanese)

For ttm2 (Rice mutant)

    fastq-dump --split-files -A SRR556173

For ttm5 (Rice mutant)

    fastq-dump --split-files -A SRR556174
    fastq-dump --split-files -A SRR556175

For D. melanogaster

    fastq-dump --split-files -A SRR823377
    fastq-dump --split-files -A SRR823382

for tif.pl,
fastq files saved in tif/target/read directory are analyzed.

target name can be changed to your fevorite.

for old programs,
fastq files saved in tif/read directory are analyzed.

BLAST

BLAST is required by blast.pl and tif_extended.pl.
New script, tif.pl, does not require BLAST.

Download BLAST programs

ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/ncbi-blast-2.9.0+-x64-linux.tar.gz

New version of BLAST can be downloaded from https://ftp.ncbi.nlm.nih.gov/blast/executables/

Copy blastn and makeblastdb to executable directory.
cp ncbi-blast-2.9.0+/bin/blastn ~/bin
cp ncbi-blast-2.9.0+/bin/makeblastdb ~/bin

To make blast data base

  makeblastdb -in reference_genome.fasta -dbtype nucl

For Rice

  cd tif
  wget http://rapdb.dna.affrc.go.jp/download/archive/irgsp1/IRGSP-1.0_genome.fasta.gz
  gzip -d IRGSP-1.0_genome.fasta.gz
  makeblastdb -in IRGSP-1.0_genome.fasta -dbtype nucl

For Drosophira melanogaster

  cd tif
  wget ftp://ftp.flybase.net/genomes/Drosophila_melanogaster/dmel_r6.29_FB2019_04/fasta/dmel-all-chromosome-r6.29.fasta.gz
  gzip -d dmel-all-chromosome-r6.29.fasta.gz
  makeblastdb -in dmel-all-chromosome-r6.29.fasta -dbtype nucl 

Search insertions of transposon by tif_basic.pl, blast.pl and tif_extended.pl

Run without any arguments, help message will be shown.

Save fastq files in read directory.

 cd tif
 cp somewhere/foo.fastq read

To test TIF algorithm 1

  cd tif
  perl tif_basic.pl head_sequence tail_sequence TSD_size
  perl blast.pl blatdb_name

  For example,
  cd tif
  perl tif_basic.pl TGTTAAATATATATACA TTGCAAGTTAGTTAAGA 5
  perl blast.pl IRGSP-1.0_genome.fasta

Output of tif_basic.pl is tif.fasta, a multiple FASTA file.
tif.fasta will be saved in tif directory.

The blast.pl reads tif.fasta and returns tif.position containing location and direction of TE insertion sites.

To test TIF algorithm 2

  cd tif
  perl tif_extended.pl reference_fasta_file head_sequence tail_sequence

  For example,
  cd tif
  perl tif_extended.pl IRGSP-1.0_genome.fasta TGTTAAATATATATACA TTGCAAGTTAGTTAAGA

The tif_extended.pl returns both tif.fasta and tif.position files in the tif directory.

Citing TIF

Update

  • 1.7 tif.pl has been improved for multi-core environment. 2021-03-23
  • 1.6 tif_flanking.pl is implemented 2019-03-21.
  • 1.5 tif.pl is implemented. 2019-03-19
  • 1.4 tif2.pl is improved. 2016-10-22
  • 1.3 Add new extended version tif2.pl 2015-03-02
  • 1.2 Update README.md 2014-10-09
  • 1.1 Update link of SRA-toolkit in README.md 2014-08-01
  • 1.0 Inital version 2014-02-05

About

Transposon Insertion Finder - Detection of new insertions in NGS data

Topics

Resources

Stars

Watchers

Forks

Packages

No packages published

Languages