Skip to content
Permalink
Browse files

Added genomes from CA, WA and NH

  • Loading branch information...
gkarthik committed Apr 11, 2019
1 parent 080feae commit 308e71ef31abfb3adb9e8e82dc742457764f5a62
Showing 791 changed files with 1,591 additions and 2 deletions.
@@ -1,8 +1,17 @@
#### Summary
This research is part of the [WestNile 4K Project](https://westnile4k.org/). More to come.

By partnering with West Nile virus surveillance labs across the country, the [WestNile 4K Project](https://westnile4k.org/) is planning to sequence more than 4,000 virus genomes to reconstruct a high definition picture of West Nile virus spread and evolution during the last 20 years in the United States. The data that they generate will be immediately released and, along with other entomological data, will be used to uncover local transmission dynamics. As little progress has been made in effectively controlling West Nile virus outbreaks since its emergence, their goal is to use fine-scale transmission networks revealed through virus genomics to better design targeted control measures.

#### Data
Data will be here.
Below is a table showing the number of sequenced genomes by state.

| State | Count |
|:------|:------|
| CA | 742 |
| NH | 41 |
| WA | 7 |
| Total | 790 |


**Disclaimer**. Please note that this data is still based on work in progress and should be considered preliminary. If you intend to include any of these data in publications, please let us know – otherwise please feel free to download and use without restrictions. We have shared this data with the hope that people will download and use it, as well as scrutinize it so we can improve our methods and analyses. Please contact us if you have any questions or comments – we’ll buy beers for #ResearchParasites that spot flaws and faults in the data and come up with improvements!

@@ -0,0 +1,2 @@
>W001_2007-10-02_USA_CA_sandiego_-116.93_32.846
AGTAGTGTTTGTGAGGATTAACAACAATTAACACAGTGCGAGCTGTTTCTTAGCACGAAGATCTCGATGTCTAAGAAACCAGGAGGGCCCGGCAAGAGCCGGGCTGTCAATATGCTAAAACGCGGAATGCCCCGCGTGTTGTCCTTGATTGGACTGAAGAGGGCTATGTTGAGCCTGATCGACGGCAAGGGGCCAATACGATTTGTGTTGGCTCTCTTGGCGTTCTTCAGGTTCACAGCAATTGCTCCGACCCGAGCAGTGCTGGATCGATGGAGAGGTGTGAACAAACAAACAGCGATGAAACACCTCCTGAGTTTTAAGAAGGAACTAGGGACCTTGACCAGTGCTATCAATCGGCGGAGCTCAAAACAAAAGAAAAGAGGAGGAAAGACCGGAATTGCAGTCATGATTGGCCTGATCGCCAGCGTAGGAGCAGTTACCCTCTCTAACTTCCAAGGGAAGGTGATGATGACGGTAAATGCTACTGACGTCACAGATGTCATCACGATTCCAACAGCTGCTGGAAAGAACCTATGCATTGTCAGAGCAATGGATGTGGGATACATGTGCGATGATACTATCACTTATGAATGCCCAGTGCTGTCGGCTGGTAATGATCCAGAAGACATTGACTGTTGGTGCACAAAGTCAGCAGTCTACGTCAGGTATGGAAGATGCACCAAGACACGCCACTCAAGACGCAGTCGGAGGTCACTGACAGTGCAGACACACGGAGAAAGCACTCTAGCGAACAAGAAGGGGGCTTGGATGGACAGCACCAAGGCCACAAGGTATTTGGTAAAAACAGAATCATGGATCTTGAGGAATCCTGGATATGCCCTGGTGGCAGCCGTCATTGGTTGGATGCTTGGGAGCAACACCATGCAGAGAGTTGTGTTTGTCGTGCTATTGCTTTTGGTGGCCCCAGCTTACAGCTTCAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTGTCTGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGACTATCATGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATGAATATGGAGGCGGCCAACCTGGCAGAGGTCCGCAGTTATTGCTATTTGGCTACCGTCAGCGATCTCTCCACCAAAGCTGCGTGCCCGACCATGGGAGAAGCTCACAATGACAAACGTGCTGACCCAGCTTTTGTGTGCAGACAAGGAGTGGTGGACAGGGGCTGGGGCAACGGCTGCGGACTATTTGGCAAAGGAAGCATTGACACATGCGCTAAATTTGCCTGCTCTACCAAGGCAATAGGAAGAACCATCTTGAAAGAGAATATCAAGTACGAAGTGGCCATTTTTGTCCATGGACCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGCTGGAGCCACTCAGGCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCTCAACCTCCCTTGGAGCAGTGCTGGAAGTACTGTGTGGAGGAACAGAGAGACGTTAATGGAGTTTGAGGAACCACACGCCACGAAGCAGTCTGTGATAGCATTGGGCTCACAAGAGGGAGCTCTGCATCAAGCTTTGGCTGGAGCCATTCCTGTGGAATTTTCAAGCAACACTGTCAAGTTGACGTCGGGTCACTTGAAGTGTAGAGTGAAGATGGAAAAATTGCAGTTGAAGGGAACAACCTATGGCGTCTGTTCAAAGGCTTTCAAGTTTCTTGGGACTCCCGCAGACACAGGTCACGGCACTGTGGTGTTGGAATTGCAGTACACTGGCACGGATGGACCTTGCAAAGTTCCTATCTCGTCAGTGGCTTCATTGAACGACCTAACGCCAGTGGGCAGATTGGTCACTGTCAACCCTTTTGTTTCAGTGGCCACGGCCAACGCTAAGGTCCTGATTGAATTGGAACCACCCTTTGGAGACTCATACATAGTGGTGGGCAGAGGAGAACAACAGATCAATCACCATTGGCACAAGTCTGGAAGCAGCATTGGCAAAGCCTTTACAACCACCCTCAAAGGAGCGCAGAGACTAGCCGCTCTAGGAGACACAGCTTGGGACTTTGGATCAATTGGAGGGGTGTTCACCTCAGTTGGGAAGGCTGTCCATCAAGTGTTCGGAGGAGCATTCCGCTCACTGTTCGGAGGCATGTCCTGGATAACGCAAGGATTGCTGGGGGCTCTCCTGTTGTGGATGGGCATCAATGCTCGTGATAGGTCCATAGCTCTCACGTTTCTCGCAGTTGGAGGAGTTCTGCTCTTCCTCTCCGTGAACGTGCATGCTGACACTGGGTGTGCCATAGACATCAGCCGGCAAGAGCTGAGATGTGGAAGTGGAGTGTTCATACACAATGATGTGGAGGCTTGGATGGACCGGTACAAGTATTACCCTGAAACGCCACAAGGCCTAGCCAAGATCATTCAGAAAGCTCATAAGGAAGGAGTGTGCGGTCTACGATCAGTTTCCAGACTGGAGCATCAAATGTGGGAAGCAGTGAAGGACGAGCTGAACACTCTTTTGAAGGAGAATGGTGTGGACCTTAGTGTCGTGGTTGAGAAACAGGAGGGAATGTACAAGTCAGCACCTAAACGCCTCACCGCCACCACGGAAAAATTGGAAATTGGCTGGAAGGCCTGGGGAAAGAGTATTTTATTTGCACCAGAACTCGCCAACAACACCTTTGTGGTTGATGGTCCGGAGACCAAGGAATGTCCGACTCAGAATCGCGCTTGGAATAGCTTAGAAGTGGAGGATTTTGGATTTGGTCTCACCAGCACTCGGATGTTCCTGAAGGTCAGAGAGAGCAACACAACTGAATGTGACTCGAAGATCATTGGAACGGCTGTCAAGAACAACTTGGCGATCCACAGTGACCTGTCCTATTGGATTGAAAGCAGGCTCAATGATACGTGGAAGCTTGAAAGGGCAGTTCTGGGTGAAGTCAAATCATGTACGTGGCCTGAGACGCATACCTTGTGGGGCGATGGAATCCTTGAGAGTGACTTGATAATACCAGTCACACTGGCGGGACCACGAAGCAATCACAATCGGAGACCTGGGTACAAGACACAAAACCAGGGCCCATGGGACGAAGGCCGGGTAGAGATTGACTTCGATTACTGCCCAGGAACTACGGTCACCCTGAGTGAGAGCTGCGGACACCGTGGACCTGCCACTCGCACCACCACAGAGAGCGGAAAGTTGATAACAGATTGGTGCTGCAGGAGCTGCACCTTACCACCACTGCGCTACCAAACTGACAGCGGCTGTTGGTATGGTATGGAGATCAGACCACAGAGACATGATGAAAAGACCCTCGTGCAGTCACAAGTGAATGCTTATAATGCTGATATGATTGACCCTTTTCAGTTGGGCCTTCTGGTTGTGTTCTTGGCCACCCAGGAGGTCCTTCGCAAGAGGTGGACAGCCAAGATCAGCATGCCAGCTATACTGATTGCTCTGCTAGTCCTGGTGTTTGGGGGCATTACTTACACTGATGTGTTACGCTATGTCATCTTGGTGGGGGCAGCTTTCGCAGAATCTAATTCGGGAGGAGACGTGGTACACTTGGCGCTCATGGCGACCTTCAAGATACAACCAGTGTTTATGGTGGCATCGTTTCTCAAAGCGAGATGGACCAACCAGGAGAACATTTTGTTGATGTTGGCGGCTGTTTTCTTTCAAATGGCTTATCACGATGCCCGCCAAATTCTGCTCTGGGAGATCCCTGATGTGTTGAATTCACTGGCGGTAGCTTGGATGATACTGAGAGCCATAACATTCACAACGACATCAAACGTGGTTGTTCCGCTGCTAGCCCTGCTAACACCCGGGCTGAGATGCTTGAATCTGGATGTGTACAGGATACTGCTGTTGATGGTCGGAATAGGCAGCTTGATCAGGGAGAAGAGGAGTGCAGCTGCAAAAAAGAAAGGAGCAAGTCTGCTATGCTTGGCTCTGGCCTCAACAGGACTTTTCAACCCCATGATCCTTGCTGCTGGACTGATTGCATGTGATCCCAACCGCAAACGCGGATGGCCCGCAACTGAAGTGATGACAGCTGTCGGCCTAATGTTTGCCATCGTTGGAGGGCTGGCAGAGCTTGACATTGACTCCATGGCCATTCCAATGACTATTGCGGGGCTCATGTTTGCTGCTTTCGTGATTTCTGGGAAATCAACAGATATGTGGATTGAGAGAACGGCGGACATTTCCTGGGAAAGTGATGCAGAAATTACAGGCTCGAGCGAAAGAGTTGATGTGCGACTTGATGATGATGGAAACTTCCAGCTCATGAATGATCCAGGAGCACCTTGGAAGATATGGATGCTCAGAATGTTCTGTCTCGCGATTAGCGCGTACACCCCCTGGGCAATCTTGCCCTCAGTAGTTGGATTTTGGATAACTCTCCAATACACAAAGAGAGGAGGCGTGTTGTGGGACACTCCCTCACCAAAGGAGTACAAAAAGGGGGACACGACCACCGGCGTCTACAGGATCATGACTCGTGGGCTGCTCGGCAGTTATCAAGCAGGAGCGGGCGTGATGGTTGAAGGTGTTTTCCACACCCTTTGGCATACAACAAAAGGAGCCGCTTTGATGAGCGGAGAGGGCCGTCTGGACCCATACTGGGGCAGTGTTAAGGAGGATCGACTTTGTTACGGAGGACCCTGGAAATTGCAGCACAAGTGGAACGGGCAGGATGAGGTGCAGATGATTGTGGTGGAACCTGGCAAGAACGTTAAGAACGTCCAGACGAAACCAGGGGTGTTCAAAACACCTGAAGGAGAAATCGGGGCCGTGACTTTGGACTTCCCCACTGGAACATCAGGCTCACCAATAGTGGACAAAAACGGTGATGTGATTGGGCTTTATGGCAATGGAGTCATAATGCCCAACGGCTCATACATAAGCGCGATAGTGCAGGGTGAAAGGATGGATGAGCCAATCCCAGCCGGATTCGAACCTGAGATGCTGAGGAAAAAACAGATCACTGTACTGGATCTCCATCCCGGCGCCGGTAAAACAAGGAGGATTCTGCCACAAATCATCAAAGAGGCCATAAACAGAAGACTGAGAACAGCCGTGCTAGCACCAACCAGGGTTGTGGCTGCTGAGATGGCTGAAGCACTGAGAGGACTGCCCATCCGGTACCAGACATCCGCAGTGCCCAGAGAACATAATGGAAATGAGATTGTTGATGTCATGTGTCATGCTACCCTCACCCACAGGCTAATGTCTCCTCACAGGGTGCCGAACTACAACCTGTTCGTGATGGATGAGGCTCATTTCACCGACCCAGCTAGCATTGCAGCAAGAGGTTACATTTCCACAAAGGTCGAGCTAGGGGAGGCGGCGGCAATATTCATGACAGCCACCCCACCAGGCACTTCAGATCCATTCCCAGAGTCCAATTCACCAATTTCCGACTTACAGACTGAGATCCCGGATCGAGCTTGGAACTCTGGATACGAATGGATCACAGAATACACCGGGAAGACGGTTTGGTTTGTGCCTAGTGTCAAGATGGGGAATGAGATTGCCCTTTGCCTACAACGTGCTGGAAAGAAAGTAGTCCAATTGAACAGAAAGTCGTACGAGACGGAGTACCCAAAATGTAAGAACGATGATTGGGACTTTGTTATCACAACAGACATATCTGAAATGGGGGCTAACTTCAAGGCGAGCAGGGTGATTGACAGCCGGAAGAGTGTGAAACCAACCATCATAACAGAAGGAGAAGGGAGAGTGATCCTGGGAGAACCATCTGCAGTGACAGCAGCTAGTGCCGCCCAGAGACGTGGACGTATCGGTAGAAATCCGTCGCAAGTTGGTGATGAGTACTGTTATGGGGGGCACACGAATGAAGACGACTCGAACTTCGCCCATTGGACTGAGGCACGAATCATGCTGGACAACATCAACATGCCAAACGGACTGATCGCTCAATTTTACCAACCAGAGCGTGAGAAGGTATATACCATGGATGGGGAATACCGGCTCAGAGGAGAAGAGAGGAAAAACTTTCTGGAACTGTTGAGGACTGCAGATTTGCCAGTTTGGCTGGCTTACAAGGTTGCAGCGGCTGGAGTGTCATACCACGACCGGAGGTGGTGCTTTGATGGTCCTAGGACAAACACAATTTTAGAAGACAACAACGAAGTGGAAGTCATCACGAAGCTTGGTGAAAGGAAGATTCTGAGGCCGCGCTGGATTGACGCCAGGGTGTACTCGGATCATCAGGCACTAAAGGCGTTCAAGGACTTCGCCTCGGGAAAACGTTCTCAGATAGGGCTCATTGAGGTTCTGGGAAAGATGCCTGAGCACTTCATGGGGAAGACATGGGAAGCACTTGACACCATGTACGTTGTGGCCACTGCAGAGAAAGGAGGAAGAGCTCACAGAATGGCCCTGGAGGAACTGCCAGATGCTCTTCAGACAATTGCCTTGATTGCCTTATTGAGTGTGATGACCATGGGAGTATTCTTCCTCCTCATGCAGCGGAAAGGCATTGGAAAGATAGGTTTGGGAGGCGCTGTCCTGGGAGTCGCGACCTTTTTCTGTTGGATGGCCGAAGTTCCAGGAACGAAGATCGCCGGAATGTTGCTGCTCTCCCTTCTCTTGATGATTGTGCTAATTCCTGAGCCAGAGAAGCAACGTTCGCAGACAGACAACCAGCTAGCCGTGTTCCTGATTTGTGTCATGACCCTTGTGAGCGCAGTGGCAGCCAACGAGATGGGTTGGCTAGATAAGACCAAGAGTGACATAAGCAGTTTGTTTGGGCAAAGAATTGAGGTCAAGGAGAATTTTAGCATGGGAGAGTTTCTTCTGGACTTGAGGCCAGCAACAGCCTGGTCACTGTACGCTGTGACAACAGCGGTCCTCACTCCACTACTAAAGCATTTGATCACGTCAGATTACATCAACACCTCATTGACCTCAATAAACGTTCAGGCAAGTGCACTATTCACACTCGCGCGAGGCTTCCCCTTCGTCGATGTTGGAGTGTCGGCTCTCCTGCTAGCAGCCGGATGCTGGGGACAAGTCACCCTCACCGTTACGGTAACAGCGGCAACACTCCTTTTTTGCCACTATGCCTACATGGTTCCCGGTTGGCAAGCTGAGGCAATGCGCTCAGCTCAGCGGCGGACAGCGGCCGGAATCATGAAGAACGCTGTAGTGGATGGCATCGTGGCCACGGACGTCCCAGAATTAGAGCGCACCACACCCATCATGCAGAAGAAAGTTGGACAGATCATGCTGATCTTGGTGTCTCTAGCTGCAGTAGTAGTGAACCCGTCTGTGAAGACAGTACGAGAAGCCGGAATTTTGATCACGGCCGCAGCGGTAACGCTTTGGGAGAATGGAGCAAGCTCTGTTTGGAACGCAACAACTGCCATCGGACTCTGCCACATCATGCGTGGGGGTTGGTTGTCATGTCTATCCATAACATGGACACTCATAAAGAACATGGAAAAACCAGGACTAAAAAGAGGTGGGGCAAAAGGACGCACCTTGGGAGAGGTTTGGAAAGAAAGACTCAACCAGATGACAAAAGAAGAGTTCACTAGGTACCGCAAAGAGGCCATCATCGAAGTCGATCGCTCAGCGGCAAAACACGCCAGGAAAGAAGGCAATGTCACTGGAGGGCATCCAGTCTCTAGGGGCACAGCAAAACTGAGATGGCTGGTCGAACGGAGGTTTCTCGAACCGGTCGGAAAAGTGATTGACCTTGGATGTGGAAGAGGCGGCTGGTGTTACTATATGGCAACCCAAAAAAGAGTCCAAGAAGTCAGAGGGTACACAAAGGGCGGTCCCGGACATGAAGAGCCCCAACTAGTGCAAAGTTATGGATGGAACATTGTCACCATGAAGAGTGGAGTGGATGTGTTCTACAGACCTTCTGAGTGTTGTGACACCCTCCTTTGTGACATCGGAGAGTCCTCGTCAAGTGCTGAGGTTGAAGAGCATAGGACGATTCGGGTCCTTGAAATGGTTGAGGACTGGCTGCACCGAGGGCCAAGGGAATTTTGCGTGAAGGTGCTCTGCCCCTACATGCCGAAAGTCATAGAGAAGATGGAGCTGCTCCAACGCCGGTATGGGGGGGGACTGGTCAGAAACCCACTCTCACGGAATTCCACGCACGAGATGTATTGGGTGAGTCGAGCTTCAGGCAATGTGGTACATTCAGTGAATATGACCAGCCAGGTGCTCCTAGGAAGAATGGAAAAAAGGACCTGGAAGGGACCCCAATACGAGGAAGATGTAAACTTGGGAAGTGGAACCAGGGCGGTGGGAAAACCCCTGCTCAACTCAGACACCAGTAAAATCAAGAACAGGATTGAACGACTCAGGCGTGAGTACAGTTCGACGTGGCACCACGATGAGAACCACCCATATAGAACCTGGAACTATCACGGCAGTTATGATGTGAGGCCCACAGGCTCCGCCAGTTCGCTGGTCAATGGAGTGGTCAGGCTCCTCTCAAAACCATGGGACACCATCACGAATGTTACCACCATGGCCATGACTGACACTACTCCCTTCGGGCAGCAGCGAGTGTTCAAAGAGAAGGTGGACACGAAAGCTCCTGAACCGCCAGAAGGAGTGAAGTACGTGCTCAACGAGACCACCAACTGGTTGTGGGCGTTTTTGGCCAGAGGAAAACGTCCCAGAATGTGCTCTCGAGAGGAATTCATAAGAAAGGTCAACAGCAATGCAGCTTTGGGTGCCATGTTTGAAGAGCAGAATCAATGGAGGAGCGCCAGAGAAGCAGTTGAAGATCCAAAATTTTGGGAGATGGTGGATGAGGAGCGCGAGGCACATCTGCGGGGGGAATGTCACACTTGCATTTACAACATGATGGGAAAGAGAGAGAAAAAACCCGGAGAGTTCGGAAAGGCCAAGGGAAGCAGAGCCATTTGGTTCATGTGGCTCGGAGCTCGCTTTCTGGAGTTCGAGGCTCTGGGTTTTCTCAATGAAGACCACTGGCTTGGAAGAAAGAACTCAGGAGGAGGTGTCGAGGGCTTGGGCCTCCAAAAACTGGGTTACATCCTGCGTGAAGTTGGCACCCGGCCTGGGGGCAAGATCTATGCTGATGACACAGCTGGCTGGGACACCCGCATCACGAGAGCTGACTTGGAAAATGAAGCTAAGGTGCTTGAGTTGCTTGATGGGGAACATCGGCGTCTTGCCAGGGCCATCATTGAGCTCACCTATCGTCACAAAGTTGTGAAAGTGATGCGCCCGGCTGCTGATGGAAGAACCGTCATGGATGTTATCTCTAGAGAAGATCAGAGGGGGAGTGGACAAGTTGTTACCTACGCCCTAAACACTTTCACCAACCTGGCCGTCCAGCTGGTGAGGATGATGGAAGGGGAAGGAGTGATTGGCCCAGATGATGTGGAGAAACTCACAAAAGGGAAAGGACCCAAAGTCAGGACCTGGCTGTTTGAGAATGGGGAAGAAAGACTCAGCCGCATGGCTGTCAGTGGAGATGACTGTGTGGTAAAGCCCCTGGACGATCGCTTTGCCACCTCGCTCCACTTCCTCAATGCTATGTCAAAGGTTCGCAAAGACATCCAAGAGTGGAAACCGTCAACTGGATGGTATGATTGGCAGCAGGTTCCATTTTGCTCAAACCATTTCACTGAATTGATCATGAAAGATGGAAGAACACTGGTGGTTCCATGCCGAGGACAGGATGAATTGGTAGGCAGAGCTCGCATATCTCCAGGGGCCGGATGGAACGTCCGCGACACTGCTTGTCTGGCTAAGTCTTATGCTCAGATGTGGCTGCTTCTGTACTTTCACAGAAGAGACCTGCGGCTCATGGCCAACGCCATTTGCTCCGCTGTCCCTGTGAATTGGGTCCCTACCGGAAGAACCACGTGGTCCATCCATGCAGGAGGAGAGTGGATGACAACAGAGGACATGTTGGAGGTCTGGAACCGTGTTTGGATAGAGGAGAATGAATGGATGGAAGACAAAACCCCAGTGGAGAAATGGAGTGACGTCCCATATTCAGGAAAACGAGAGGACATCTGGTGTGGCAGCCTGATTGGCACAAGAGCCCGAGCCACGTGGGCAGAAAACATCCAGGTGGCTATCAACCAAGTCAGAGCAATCATCGGAGATGAGAAGTATGTGGATTACATGAGTTCACTAAAGAGATATGAAGACACAACTTTGGTTGAGGACACAGTATTGTAGATATTTAATCAATTGTAAATAGACAATATAAGTATGCATAAAAGTGTAGTTTTATAGTAGTATTTAGTGGTGTTAGTGTAAATAGTTAAGAAAATTTTGAGGAGAAAGTCAGGCCGGGAAGTTCCCGCCACCGGAAGTTGAGTAGACGGTGCTGCCTGCGACTCAACCCCAGGAGGACTGGGTGAACAAAGCCGCGAAGTGATCCATGTAAGCCCTCAGAACCGTCTCGGAAGGAGGACCCCACATGTTGTAACTTCAAAGCCCAATGTCAGACCACGCTACGGCGTGCTACTCTGCGGAGAGTGCAGTCTGCGATAGTGCCCCAGGAGGACTGGGTTAACAAAGGCAAACCAACGCCCCACGCGGCCCTAGCTCCGGTAATGGTGTTAACCAGGGCGAAAGGACTAGAGGTTAGAGGAGACCCCGCGGTTTAAAGTGCACGGCCCAGCCTGGCTGAAGCTGTAGGTCAGGGGAAGGACTAGAGGTTAGTGGAGACCCCGTGCCACAAAACACCACAACAAAACAGCATATTGACACCTGGGATAGACT
Oops, something went wrong.

0 comments on commit 308e71e

Please sign in to comment.
You can’t perform that action at this time.