Permalink
Switch branches/tags
Nothing to show
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
88 lines (85 sloc) 652 KB
#NEXUS
begin taxa;
dimensions ntax=35;
taxlabels
'KR063671|Yambuku-Mayinga|DRC|1976-10-01'
'KC242791|Bonduni|DRC|1977'
'KC242801|deRoover|DRC|1976'
'KM655246|Yambuku-Ecran|DRC|1976'
'KU978803|Zaire-199510621|DRC|1995-04-01'
'KR867676|Kikwit-9510621|DRC|1995-05-04'
'KR063672|Kikwit-807223|DRC|1995-04-01'
'KC242796|13625_Kikwit|DRC|1995'
'KC242799|13709_Kikwit|DRC|1995'
'KR824526|Zaire-199510621|DRC|1995'
'KP271018|Lomela-Lokolia16|DRC|2014-08-20'
'KP271020|Lomela-Lokolia19|DRC|2014-08-20'
'KM519951|Boende-Lokolia|DRC|2014'
'KC242792|Gabon|Gabon|1994'
'KC242793|1Eko|Gabon|1996'
'KC242795|1Mbie|Gabon|1996'
'KC242797|1Oba|Gabon|1996'
'KC242794|2Nza|Gabon|1996'
'KC242798|1Ikot|Gabon|1996'
'KC242784|9_Luebo|DRC|2007'
'KC242785|0_Luebo|DRC|2007'
'KC242786|1_Luebo|DRC|2007'
'KC242787|23_Luebo|DRC|2007'
'KC242789|4_Luebo|DRC|2007'
'KC242790|5_Luebo|DRC|2007'
'KC242788|43_Luebo|DRC|2007'
'HQ613402|034-KS|DRC|2008-12-31'
'HQ613403|M-M|DRC|2007-08-31'
'KY471124|inoculum_strain_Gabon||Gabon|2001'
'KC242800|Ilembe|Gabon|2002'
'KF113528|Kelle_1|DRC|2003'
'KF113529|Kelle_2|DRC|2003'
'KJ660346|Makona-Kissidougou-C15|Guinea|2014-02-19'
'KJ660347|Makona-Gueckedou-C07|Guinea|2014-01-20'
'KJ660348|Makona-Gueckedou-C05|Guinea|2014-01-29'
;
end;
begin characters;
dimensions nchar=18962;
format datatype=dna missing=? gap=-;
matrix
'KR063671|Yambuku-Mayinga|DRC|1976-10-01' -GGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACACCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGGGGAUUGAAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAAUCUGGAUGGCGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAAGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUCUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGCUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAGAACAGUCAAAAGGGCCAGCAUAUAGAGGGCAGACAGACACAAUCCAGGCCAAUUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCGCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAGCAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGACGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGUCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUGAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUUCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAAACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGAAUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGGCUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUACACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCAUCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUAUAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGACACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAGGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUUUUUGCCCUUAUCCUCAAAUUGCCUGCAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAAAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCGUCAGGUCCUUUUCAAUCGUGUAACCAAAAUAAACUCCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGCGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCAUAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGUUGUAUCAAACGGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUAACAACCCUUGCCACAAUCUCCACGAGUCCCCAAUCCCUCACAACCAAACCAGGUCCGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCUCUGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAGCAAGAGCACUGACUUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUCUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGAAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUUGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUCAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUAUGCUUCAAGCUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGGCACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACACCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCUUACCUACAACGAACAUCACUUUGAGCGCCCUCACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUUGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAUGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGGUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAACAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAGUUCUUCUCAAGGCACUGUCAGGCAAUGGAUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGAACACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACUGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCGGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCACCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCACAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAGAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACUGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGCCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUUCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAGUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAAUCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACUCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUGAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGACACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUUUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGAUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUCAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCUAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGAAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAGUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUUAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUCUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUAUACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACAACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGUUUUAAAAACGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACCUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCC-
'KC242791|Bonduni|DRC|1977' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACACCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGGGGAUUGAAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAAUCUGGAUGGCGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAAGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUCUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGCUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAGAACAGUCAAAAGGGCCAGCAUAUAGAGGGCAGACAGACACAAUCCAGGCCAAUUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCGCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAGCAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGACGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGUCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUGAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUUCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAAACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGAAUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGGCUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUACACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCAUCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUCAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUAUAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGACACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAGGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUUUUUGCCCUUAUCCUCAAAUUGCCUGCAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAAAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCGUCAGGUCCUUUUCAAUCGUGUAACCAAAAUAAACUCCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGCGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCAUAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGUUGUAUCAAACGGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUAACAACCCUUGCCACAAUCUCCACGAGUCCCCAAUCCCUCACAACCAAACCAGGUCCGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCUCUGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAGCAAGAGCACUGACUUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUCUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGAAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUUGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUCAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUAUGCUUCAAGCUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGGCACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACACCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCUUACCUACAACGAACAUCACUUUGAGCGCCCUCACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUUGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAUGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGGUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAACAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAGUUCUUCUCAAGGCACUGUCAGGCAAUGGAUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGAACACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACUGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCGGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCACCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCACAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAGAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACUGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGCCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUUCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAGUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAAUCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACUCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUGAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGACACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUUUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGAUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUCAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCUAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGAAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAGUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUUAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUCUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUAUACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACAACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGUUUUAAAAACGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACCUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242801|deRoover|DRC|1976' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACACCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGGGGAUUGAAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAAUCUGGAUGGCGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAAGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUCUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGCUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAGAACAGUCAAAAGGGCCAGCAUAUAGAGGGCAGACAGACACAAUCCAGGCCAAUUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCGCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAGCAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGACGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGUCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUGAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUUCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAAACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGAAUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGGCUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUACACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCAUCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUAUAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGACACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAGGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUUUUUGCCCUUAUCCUCAAAUUGCCUGCAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAAAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCGUCAGGUCCUUUUCAAUCGUGUAACCAAAAUAAACUCCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGCGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCAUAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGUUGUAUCAAACGGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUAACAACCCUUGCCACAAUCUCCACGAGUCCCCAAUCCCUCACAACCAAACCAGGUCCGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCUCUGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAGCAAGAGCACUGACUUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUCUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGAAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUUGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCCUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUCAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUAUGCUUCAAGCUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGGCACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACACCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCUUACCUACAACGAACAUCACUUUGAGCGCCCUCACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUUGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAUGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGGUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAACAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAGUUCUUCUCAAGGCACUGUCAGGCAAUGGAUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGAACACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACUGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCGGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCACCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCACAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAGAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACUGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGCCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUUCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAGUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAAUCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACUCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUGAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGACACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUUUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGAUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUCAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCUAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGAAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAGUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUUAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUCUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUAUACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACAACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGUUUUAAAAACGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACCUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KM655246|Yambuku-Ecran|DRC|1976' ---------------------------------------------GAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUCACUGUAAUCACACCUGGUUUGUCUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACACCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGGGGAUUGAAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAAUCUGGAUGGCGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAAGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUCUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGCUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAGAACAGUCAAAAGGGCCAGCAUAUAGAGGGCAGACAGACACAAUCCAGGCCAAUUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCGCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAGCAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGACGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGUCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUGAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUUCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAAACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGAAUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGGCUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUACACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCAUCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUAUAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGACACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAGGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUUUUUGCCCUUAUCCUCAAAUUGCCUGCAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAAAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCGUCAGGUCCUUUUCAAUCGUGUAACCAAAAUAAACUCCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGCGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCAUAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGUUGUAUCAAACGGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUAACAACCCUUGCCACAAUCUCCACGAGUCCCCAAUCCCUCACAACCAAACCAGGUCCGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCUCUGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAGCAAGAGCACUGACUUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACAUAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUCUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGAAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUUGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUCAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUAUGCUUCAAGCUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGGCACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACACCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCUUACCUACAACGAACAUCACUUUGAGCGCCCUCACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUUGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACUUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAUGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGGUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAACAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAGUUCUUCUCAAGGCACUGUCAGGCAAUGGAUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGAACACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACUGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCGGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCACCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCACAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAGAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACUGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGCCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUUCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAGUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAAUCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACUCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUGAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGACACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUUUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGAUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUCAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCUAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGAAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAGUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUUAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUCUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUAUACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACAACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGUUUUAAAAACGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACCUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGA---------------------------------------------------------------------------------------------------------------------
'KU978803|Zaire-199510621|DRC|1995-04-01' ----CACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUCCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAAUACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAACAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGUCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGCGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCAACUGACUCACAAGAUACGACCAUUCCUGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCAACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCUCCACUCACGGAUAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCCUGGAGUCAGACGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAGAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAGGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUCCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCCUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACCAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUUGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCUAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCCAUCUUCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUGAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUCGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUACCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACAACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGGAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUCCAAAUGUUAAUCUUUCUCAUUGCAAAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGUAGGGAUCGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGACCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAAGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGUACCGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGGAGAGCUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACAUAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGUGAGGGGCUUGGGCAAGAUCAGGCAGAACCUGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGACCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCUGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGACAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUCCUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAAAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACGCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUUUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCAAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAGGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUGUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCUAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUGACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUAGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUUACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCUAAUGAGUCACAGACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUAAUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUGUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUAUCGAUUUGAAAAUGGUAAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGUUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUUGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCC-
'KR867676|Kikwit-9510621|DRC|1995-05-04' -GGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUCCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAAUACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAACAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGUCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGCGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCAACUGACUCACAAGAUACGACCAUUCCUGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCAACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCUCCACUCACGGAUAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCCUGGAGUCAGACGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAGAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAGGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUCCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCCUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACCAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUUGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCUAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCCAUCUUCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUGAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUCGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUACCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACAACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGGAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUCCAAAUGUUAAUCUUUCUCAUUGCAAAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGUAGGGAUCGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGACCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAAGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGUACCGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGGAGAGCUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACAUAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGUGAGGGGCUUGGGCAAGAUCAGGCAGAACCUGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGACCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCUGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGACAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUCCUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAAAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACGCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUUUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCAAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAGGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUGUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCUAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUGACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUAGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUUACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCUAAUGAGUCACAGACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUAAUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUGUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUAUCGAUUUGAAAAUGGUAAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGUUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUUGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCU-UUUUGUGUGUCC-
'KR063672|Kikwit-807223|DRC|1995-04-01' -GGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUCCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAAUACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAACAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGUCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGCGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCAACUGACUCACAAGAUACGACCAUUCCUGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCAACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCUCCACUCACGGAUAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCCUGGAGUCAGACGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAGAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAGGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUCCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCCUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACCAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUUGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCUAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCCAUCUUCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUGAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUCGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUACCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACAACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGGAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUCCAAAUGUUAAUCUUUCUCAUUGCAAAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGUAGGGAUCGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGACCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAAGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGUACCGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGGAGAGCUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGUGAGGGGCUUGGGCAAGAUCAGGCAGAACCUGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGACCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCUGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGACAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUCCUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAAAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACGCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUUUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCAAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAGGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUGUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCUAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUGACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUAGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUUACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCUAAUGAGUCACAGACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUAAUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUGUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUAUCGAUUUGAAAAUGGUAAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGUUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUUGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCU-UUUUGUGUGUCC-
'KC242796|13625_Kikwit|DRC|1995' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUCCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAAUACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAACAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGUCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGCGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCAACUGACUCACAAGAUACGACCAUUCCUGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCAACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCUCCACUCACGGAUAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCCUGGAGUCAGACGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAGAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAGGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUCCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCCUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACCAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUUGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCUAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCCAUCUUCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUGAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUCGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUACCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACAACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGGAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUCCAAAUGUUAAUCUUUCUCAUUGCAAAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGUAGGGAUCGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGACCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAAGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGUACCGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGGAGAGCUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGUGAGGGGCUUGGGCAAGAUCAGGCAGAACCUGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGACCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCUGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAAACAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAAAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACGCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUUUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUCGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGGAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCAAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCAGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAGGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUGUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCUAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUGACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUAGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCUAAUGAGUCACAGACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUAAUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUGUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUAUCGAUUUGAAAAUGGUAAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGUUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUUGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242799|13709_Kikwit|DRC|1995' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUCCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAAUACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAACAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGUCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGCGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCAACUGACUCACAAGAUACGACCAUUCCUGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCAACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCUCCACUCACGGAUAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCCUGGAGUCAGACGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAGAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAGGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUCCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCCUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACCAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUUGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCUAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCCAUCUUCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUGAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUCGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUACCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACAACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGGAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUCCAAAUGUUAAUCUUUCUCAUUGCAAAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGUAGGGAUCGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGACCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAAGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGUACCGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGGAGAGCUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGUGAGGGGCUUGGGCAAGAUCAGGCAGAACCUGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGACCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCUGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAAAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACGCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUUUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUCGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGGAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCAAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCAGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAGGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUGUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCUAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUGACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUAGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCUAAUGAGUCACAGACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUAAUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUGUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUAUCGAUUUGAAAAUGGUAAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGUUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUUGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KR824526|Zaire-199510621|DRC|1995' -GGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUCCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAAUACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAACAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGUCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGCGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCAACUGACUCACAAGAUACGACCAUUCCUGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCAACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCCAGUGCUCCACUCACGGAUAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCCUGGAGUCAGACGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAGAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAGGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUCCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCCUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACCAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUUGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCUAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCCAUCUUCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUGAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUCGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUACCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACAACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGGAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUCCAAAUGUUAAUCUUUCUCAUUGCAAAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGUAGGGAUCGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAGGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGACCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAAGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACUAAAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGUACCGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGGAGAGCUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGUGAGGGGCUUGGGCAAGAUCAGGCAGAACCUGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGACCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCUGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGACAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUCCUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAAAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAGAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACGCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUUUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCAAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAGGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUGUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCUAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUGACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUAGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUUACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCUAAUGAGUCACAGACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUAAUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUGUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUAUCGAUUUGAAAAUGGUAAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGUUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUUGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAA---------------------------------------
'KP271018|Lomela-Lokolia16|DRC|2014-08-20' ----------------AAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUAAAGGGGGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGAGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUCCCGAGUAUGAAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCCUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCCUGGAAAGUGGCGCAGUCAAGUACUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUCAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGGCCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAAGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAGCAAUCCACCACACCAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCAGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACCUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAACGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUAUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCUCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUCAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUAAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACGGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUUGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGGCACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUGAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUCGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUAUCCUCCAGAGUAGGGAUUGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAAGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACCGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGUUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACCCAAGCUGAACAACAUCACCGCAGAACAGACAACGACAGCACAACCUCCGACACUCCCCCCGCCAUGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCCGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUCUAGUUGCAACCUAGCACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAACAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAGUGGGAUCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGACAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCGAUGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCCUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUCCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCAAAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUUGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCACACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCGUCGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAGCCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUAAUAUUAAAUGGCUACACAACAUACCCAGUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGAUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUUUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCCGGGUCGCAGGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGAUUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAACUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACAUCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUAUUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCGUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUCAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUGUGUCGAUUUAAAAAUGGUGAUAGCCUUAACCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUU-------------------
'KP271020|Lomela-Lokolia19|DRC|2014-08-20' -----------------------------------------------------AUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUAAAGGGGGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGAGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUCCCGAGUAUGAAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCCUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCCUGGAAAGUGGCGCAGUCAAGUACUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUCAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGGCCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAAGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAGCAAUCCACCACACCAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCAGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACCUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAACGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUAUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCUCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUCAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCNNGUAUUUCACCUUUGAUUUGACAGCACUCAAACUAAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACGGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUUGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGGCACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUGAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUCGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUAUCCUCCAGAGUAGGGAUUGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAAGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACCGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGUUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACCCAAGCUGAACAACAUCACCGCAGAACAGACAACGACAGCACAACCUCCGACACUCCCCCCGCCAUGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCCGGACCCCGCCACCACAACAGGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGAUCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUCUAGUUGCAACCUAGCACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAACAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAGUGGGAUCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGACAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCGAUGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCCUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUCCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCAAAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUUGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCACACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCGUCGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAGCCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUAAUAUUAAAUGGCUACACAACAUACCCAGUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGAUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUUUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCCGGGUCGCAGGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGAUUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAACUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACAUCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUAUUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCGUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUCAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCCAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUGUGUCGAUUUAAAAAUGGUGAUAGCCUUAACCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGG---------------------------------------------------
'KM519951|Boende-Lokolia|DRC|2014' ---ACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUAAAGGGGGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGAGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUCCCGAGUAUGAAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCCUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUACAAACUUUUCCUGGAAAGUGGCGCAGUCAAGUACUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUCAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGGCCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAAGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAGCAAUCCACCACACCAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCAGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACCUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAACGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGGGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUAUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCUCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUCAAACGACCAAGAUAAAAUUGUUCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUAAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACGGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUUGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGGCACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUUGAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUCCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUCGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUAUCCUCCAGAGUAGGGAUUGUCAGGUCCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAAGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACCGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGUUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACCCAAGCUGAACAACAUCACCGCAGAACAGACAACGACAGCACAACCUCCGACACUCCCCCCGCCAUGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCCGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUCUAGUUGCAACCUAGCACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAACAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAGUGGGAUCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGACAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCGAUGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCCUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUCCAGGGUAGUCCAAUUAGUGACACGUCUCUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCAAAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUUGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCACACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCGUCGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAAUCUUAUAUACUAAAUGGUUAAUUGUAACUGAGCCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUAAUAUUAAAUGGCUACACAACAUACCCAGUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUAUCUCAAAAAUGUGGAUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUUUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCCGGGUCGCAGGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGAUUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAACUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACAUCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUAUUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCGUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUGAUUUCAAUAAACAACUAUUCAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUGUGUCGAUUUAAAAAUGGUGAUAGCCUUAACCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGU---
'KC242792|Gabon|Gabon|1994' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAGCAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUGCAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCCAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCUAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAAUUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAAGAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGAUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUAUCCCAGGCCCUCACAGAACAAUCCACCACGCAAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAAACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACCUCCAAUCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCGACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGGAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCAAACAAGAUGACAACCAGAACAAAGAGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGAUCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUUUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUCCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACUAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGACUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUGCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUAAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUAAAUUGAUCGAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGGUUUUAAAAGAUUGAUUGAUAGAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGUUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGCAGGGAUCGUCAGGUUCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCUAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACGAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAAGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUGGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGCUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCUUCGACCCCCCAUAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGCCAGCACAACCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUCUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUAUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACUAAGAACAUAACGGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUAACAGUUAUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAACUUAAACAGUGAGUGGAGGCAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCAAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCGCUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGCAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUUGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCCCUUAGUUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGUUGAAAAAAGGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAAGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAAAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUUCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAACCUUAUAUACUAAAUGGUUAAUUGUAACUGAAUCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUGUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAGAUCAUCAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUACUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCAGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACGACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGAUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACUCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGCCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUUGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUGGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACGCAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGUUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGUGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACCGCUUUUGAGCGGUCCAUUUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACAUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGGGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUCUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUCCAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCGUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUACAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGCGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAACACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACGACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCAUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGAAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCGCACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUGACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUGAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCCGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUGAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGACUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAGAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242793|1Eko|Gabon|1996' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAGAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAGCAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUGCAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCCAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAAUUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAAGAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGAUUUGAUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUAUCCCAGGCCCUCACAGAACAAUCCACCACGCAAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAAGAAGAACAGGACAGGGACGGAACCUCCAAUCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCGACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGAGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGAUCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUCCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUGACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACUAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGACUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUGCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUAAAUUGAUCGAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGGUUUUAAAAGAUUGAUUGAUAGAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCGCAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGUUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGCAGGGAUCGUCAGGUUCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACGAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAAGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUGGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGCUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCUUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGCCAGCACAACCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUAUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACUAAGAACAUAACGGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUGAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAACUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUAACAGUUAUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGGCAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCAAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCGCUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUCACCUUCUACUUGAUCACAAUACUCCGUAUACCUGUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGCAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUUGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCCCUUAGUUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGUUGAAAAAAGGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAAGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAGGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAAAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUUCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGUAUUUUAUCACCAGAAACCUUAUAUACUAAAUGGUUAAUUGUAACUGAAUCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUGUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAGAUCAUCAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUACUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUGCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCAGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACGACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGAUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAAGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGCCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAAAAUGUUCUUUCCUACGCGCAAAAACUUGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUGGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACGCAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGUUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCAUACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGUGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACCGCUUUUGAGCGGUCCAUUUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACAUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGGGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUCCAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCGAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCGUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGCAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGCGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAACACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACGACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCAUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGAAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAGAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCGCACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUGACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUGAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACCUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCCGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG--UUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGACUUAAUCUCUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAGAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242795|1Mbie|Gabon|1996' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAGAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAGCAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUGCAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCCAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAAUUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAAGAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGAUUUGAUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUAUCCCAGGCCCUCACAGAACAAUCCACCACGCAAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAAGAAGAACAGGACAGGGACGGAACCUCCAAUCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCGACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGAGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGAUCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUCCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUGACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACUAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGACUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUGCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUAAAUUGAUCGAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGGUUUUAAAAGAUUGAUUGAUAGAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCGCAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGUUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGCAGGGAUCGUCAGGUUCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACGAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAAGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUGGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGCUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCUUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGCCAGCACAACCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUAUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACUAAGAACAUAACGGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUGAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAACUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUAACAGUUAUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGGCAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCAAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCGCUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUCACCUUCUACUUGAUCACAAUACUCCGUAUACCUGUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGCAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUUGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCCCUUAGUUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGUUGAAAAAAGGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAAGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAGGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAAAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUUCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGUAUUUUAUCACCAGAAACCUUAUAUACUAAAUGGUUAAUUGUAACUGAAUCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUGUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAGAUCAUCAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUACUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUGCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCAGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACGACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGAUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAAGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGCCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAAAAUGUUCUUUCCUACGCGCAAAAACUUGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUGGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACGCAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGUUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCAUACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGUGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACCGCUUUUGAGCGGUCCAUUUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACAUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGGGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUCCAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCGAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCGUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGCAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGCGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAACACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACGACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCAUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGAAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAGAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCGCACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUGACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUGAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACCUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCCGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG--UUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGACUUAAUCUCUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAGAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242797|1Oba|Gabon|1996' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAGAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAGCAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUGCAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCCAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAAUUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAAGAAAGAGCGCCUGGCCAAGCUGACGGAAGCUAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGAUUUGAUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUAUCCCAGGCCCUCACAGAACAAUCCACCACGCAAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAAGAAGAACAGGACAGGGACGGAACCUCCAAUCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCGACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCAGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGAGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGAUCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUCCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUGACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACUAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGACUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUGCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUAAAUUGAUCGAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGGUUUUAAAAGAUUGAUUGAUAGAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCGCAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGUUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGCAGGGAUCGUCAGGUUCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACGAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAAGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUGGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGCUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCUUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGCCAGCACAACCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUAUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACUAAGAACAUAACGGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUGAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAACUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUAACAGUUAUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGGCAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCAAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCGCUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUCACCUUCUACUUGAUCACAAUACUCCGUAUACCUGUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGCAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUUGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCCCUUAGUUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGUUGAAAAAAGGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAAGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAGGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAAAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUUCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGUAUUUUAUCACCAGAAACCUUAUAUACUAAAUGGUUAAUUGUAACUGAAUCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUGUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAGAUCAUCAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUACUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUGCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCAGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACGACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGAUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAAGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGCCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAAAAUGUUCUUUCCUACGCGCAAAAACUUGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUGGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACGCAAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGUUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCAUACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGUGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACCGCUUUUGAGCGGUCCAUUUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACAUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGGGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUCCAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCGAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCGUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGCAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGCGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAACACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACGACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCAUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGAAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAGAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCGCACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUGACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUGAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACCUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCCGAUUUCAAUAAACAACUAUUUAAAUAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG--UUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGACUUAAUCUCUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAGAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242794|2Nza|Gabon|1996' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAGCAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUGCAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAGAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAAUUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCCAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCAAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGGCGGAACCUCCAAUCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCGACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCCGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCAUAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUCCUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUUAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGAGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAGACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGAUCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAGACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGCGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAGGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUUAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUCCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACAUACCAGGCAGUGUUUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACUAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGACUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUGCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUAAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGGUUUUAAAAGAUUGAUUGAUAGAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGUUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGCAGGGAUCGUCAGGUUCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACGAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAAGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUGGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCUUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAAAUAUCAGGCUACCGGCUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCCUGCCACAAUCUCCACGAGUCUUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGCCAGCACAACCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUACCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUAUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACUAAGAACAUAACGGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUGUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUAACAGUUAUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGGCAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUCAUCGAGGCGAGCACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCAAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUACUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCUCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCCGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUUGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCCCUUAGUUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGUUGAAAAAAGGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAAGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAAAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAGUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAACCUUAUAUACUAAAUGGUUAAUUGUAACUGAAUCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUGUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAGAUCAUCAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUACUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCAGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACGACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGAUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGCCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUUGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUGGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACGCGAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGUUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGUGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACCGCUUUUGAGCGGUCCAUUUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACAUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGGGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAACAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCGUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCCGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGCGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAACACAAUUCUUCGGACCAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGUGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACGACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCAUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGAAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAGACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUGACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUGCGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGACUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUCAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUGAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCCGAUUUCAAUAAACAACUAUUUAAACAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAGAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGACUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUCUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAGAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUACAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCACCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242798|1Ikot|Gabon|1996' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAACCUAGGUCUCUGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGGUUUUGAACUUGAACACUUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAGCAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAGAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAGGGAGAUUGCAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACAACUGAAGCUAAUGCCGGUCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGACGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAGAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCAGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGUACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAACUCAGAGAGGCUGCCACUGAGGCUGAGAAGCAACUCCAACAAUACGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAAUUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACGGAAGCCAUCACUGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGAUGAGGACACUAAGCCAGUGCCUAAUAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCACAGAACAAUCCACCACGCAAGUGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGGCGGAACCUCCAAUCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCGACAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCCGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCUAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAACAAUGGGAUGAUUCAACCGACAAAUAGCUAACAUUAAGUAGUCAAGGAACGAAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCAUAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUCCUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCCUAACUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUACCCAACAUUUACACGAUCAUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUUAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCUAACAAGAUGACAACCAGAACAAAGAGCAGGGGCCACACUGCGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAGACGAAGCCAAACCCGAAGACGCGCAACAGUCAAACCCAAACGGAUCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAGACAUUAGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGCGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCCGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCACCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAGGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUUAGCCCUGGAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUCCUUAUCUCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAGUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGAGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGGGACACUCCAUCGAAUCCACUCAGGCCAAUUGCCGAUGACACCAUCGACCAUGCCAGCCACAUACCAGGCAGUGUUUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACUAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGACUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGUUGCGCCCAGGAAUUUCAUUUCAUCCAAAACUGCGCCCCAUUCUUUUACCCAACAAGAGUGGGAAGAAGGGGAAUAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGAAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGUUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCGAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCCAUUAGAGGAGAUACUUUAAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCAUAAUAUACUUGGUUUUAAAAGAUUGAUUGAUAGAAGAUCAUAACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGAAAAAAUCGGGACCCAUUUCUAGUUUGUUCACCAUCCAAGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCCUCCAGAGCAGGGAUCGUCAGGUUCUUUUCAAUCGUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUGGUUUGCCGUGACAAACUGUCAUCCACGAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAAGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUGGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCUUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAAAUAUCAGGCUACCGGCUUUGGAACCAAUGAGACAGAGUAUUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUACAAGUGGGAAAAGGAGCAAUACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACAGAGCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGGGACCAACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCCUGCCACAAUCUCCACGAGUCUUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACCCACAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGCCAGCACAACCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCUAAAAGCAGAGAACACCAACACGAGCAAGGGCACUGACCUCCUGGACCCCGCCACCACAACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUACCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGACUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUGAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGACAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUAUUCCUGAGAGCCACAACCGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACUAAGAACAUAACGGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAGUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAACCAGGAUUUAAUUAUAUGGAUUACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUGUAAUACACUGGAGCUUUAAACAUAGCCAAUGUGAUUCUAACUCUUUUAAACUCACAGUUAAUCAUAAAUAAGGUUUGACAUCAAUCUAGUUAUCUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUAACAGUUAUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGAUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGGCAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCACGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUCAUCGAGGCGAGCACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAGAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCAAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACUCUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAGUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUUAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAGACUUACUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUGUGCAUGAUUGCCCUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACCCUACAGGAGGUAGCAACGAUCCAUCUCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCCGCUUCAAGUUGUGGAGGAGGUGUUUGGUAUUUGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGGCCGGAAAUGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCCCUUAGUUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCCCAUACAUUGUAUUGGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGUUGAAAAAAGGCCUACCUACAACGAACAUCACUUUGAGCGCCCUCACAUUUAAAAAAUAGGAACGUCGUUCCAACAAUCGAGCGCAAGGUUUCAAAGUUGAACUGAGAGUGUCUAGACAACAAAGUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAAAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGCCAAACUAUUCAGGGGUGGAAGGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUCUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAGUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAAGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGAUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUCAUAUGAAUAAGCAUUUUAUCACCAGAAACCUUAUAUACUAAAUGGUUAAUUGUAACUGAAUCCGCAGGUCACAUGUGUUAGGUUUCACAGAUUCUGUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCCUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGAAAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCGGACGCUAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUGAAAUACGAUGUAACUGUUACCAAGUUCUUGAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAGAUCAUCAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUACUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGAUCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGUUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGACUGGUAUCAGGCAUCAGUAUUCAAAGAAGCAGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACGACUCUAAUCUCAAAAAUAGCAGAGAUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGAUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUAGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGCUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUACUGUGUUUUUAAAUAUAGUAUUGCCAAACAUUAUUUUGAUAGCCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUUAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUUGAGUAUCUACUACCACAAUAUCGGAACUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACCUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUGGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACGCGAGUGAUGAUUUUGGUGAACAUGCCACAGUUAGAGGGAGUAGUUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUCGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCACAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGCGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGUGCCGAAGACAAUGCAGCGAGGGUGGCCGCUAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUAGCUAGUAUAGGCACCGCUUUUGAGCGGUCCAUUUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACAUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCAUCUCGGGUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGUAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGAUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGGGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGCAGGACCAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAACAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCUCAUAUUUUAGAGGGAAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGUUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCGUCCCGACUAAGCUGGACUAUCGGGGAUGGAAUCCCUUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAGCCAUUUUUGGAAGCACGAGUAAAUUUGAGUGUUCAAGAAAUACUUCAAAUGACUCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCCGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACAGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCAUCUACAGACCCAAUUAGCAGCGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAACACAAUUCUUCGGACCAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGUGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCUAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUUCUCUAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACGACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCAUCAUUGGCAUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGACUCUUCAACUGAAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUUCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCGUUCCAGUCCUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAGACUAAAUUUCGAUCGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUGACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUGCGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUAACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAAGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAACUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGAAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGUGACUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUAACUAAUGAUUAUAAUCAACAGCGACAAAGUCGAACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUCAGUGUGUGCAAUAGGUUCUACCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUGAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGCAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCCGAUUUCAAUAAACAACUAUUUAAACAACGAAAGGAGUCCCUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCUUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUUUAACGCAACAUAAUAAACUCUGCACUCUUUAGAAUUAAGCUUUAACGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUAUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGACUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUCUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAGAGGCAGGACUGUAAAAUCAUAAAUACCUUCUUUACAAUACAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCACCAAAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242784|9_Luebo|DRC|2007' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACCUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACCUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUACCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCUUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242785|0_Luebo|DRC|2007' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCGAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUUCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUGCACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUCACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242786|1_Luebo|DRC|2007' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACAUAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242787|23_Luebo|DRC|2007' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCUAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242789|4_Luebo|DRC|2007' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGAUUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACAUAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUAUAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242790|5_Luebo|DRC|2007' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCGAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCAUAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUCGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCUCCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCUCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KC242788|43_Luebo|DRC|2007' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGAUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCUAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUCUCCAGCAAAGCACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCCUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCCAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAACUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGAAGGCUCGCCAGAAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'HQ613402|034-KS|DRC|2008-12-31' ---------------------------------------------------------------------------------UUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGUUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAACAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGGUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGGAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAAUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAACAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACCAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAGGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGACAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAAGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUC-------------------------------------------------------------------------------------------------------
'HQ613403|M-M|DRC|2007-08-31' ------------------------------------------------UAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGUUUUGUUUCAGAGCCAUGUCACAAAGAUAGAGAACAACCUAGGUCUCCGAAGGGAGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAGGUUCCACCUCAGGCUCUGCAGGGUGAUCCAACAACCUUAAUAGAAACAUUAUUGUUAAAGGACAACAUUAGGUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUGAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAGCUUGGGGUAAAACAUUGGAAAUAGUUAAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUAACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCAAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUCUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUCUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUGGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAGUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUCCUUAUGAACUUCCAUCAGAAGAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACCGCUGCGUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCUAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGUAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUCGACCAAGGGUGAACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCAUGCCAGCGCUCCACUCACGGACAAUGACAGAAGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAGGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCCAGCCUUCCGCCCUUGGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAACAAGACCAGGACCACACUCAAGAGGCCAAGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAAGGGCCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAACCAUAAUUGUAACUCAAUAUCUUAGCUAGUGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACUUAUUAGCCCGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUAGUCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCUAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAAACGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGACGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAGCAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAGUUAGUACAAGUGAUUUGUAAAUUGGGAAAGGAUAGCAACUCAUUGGACAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUCACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUACGUCCAGUCCCGCCAUCGCCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAACGAGGCGACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUACGUUACAUUAAUGAUACACUUGUGAGCAUCAGCCCUAAAUAAUAUAAGUCAAUUAAACGACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGUAAUAGGAGCUAUAUCUGUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCAAAUCCACUCAGACCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAACGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAAUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUUAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGCUCGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGGUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCGUUGUCUCUUUUUUCUCCUAAAUGUAGAACUUAACAAAAAACUCAUAAUAUACUUGUCUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUUAAUCUUUCUCAUUGCACAUACUCUUUGCCCUUAUCCUCAAAUUGCCUACAUGCUUACAUUUGGGGAUAACCAGUGUGACUUGGAUUGGAGAUGUGAAGAAAAAAUCGGGACCCAUUUCUAGGUUGUUCACAAUCCAGGUACAGACAUUGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUCGUAUAACCAAAGUAAACUUCACUAGAAGGAUAUUGUGGGGCAACAACACAAUGGGUGUCACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGAUGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACAGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUUUACCGAGGGACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCUAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAAGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAAACCUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAAAGACCAACACAACAACUGAAGACCACAAAAUCGUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCCCCCACAACCAAACCAGGUCCGGACAACAGCACUUAUAAUACACCCGUAUAUAAACUUGACACCUCUGAGGCAACUCAAGUUGAACAACAUCACCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACACCCAAAAGCAGAGAACACCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCCAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCUAACUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCUACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCAUAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAAAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAAUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAGUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGAACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCCGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUAAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUGUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCCUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGACAAAAGAAAAUCAUAAUCUCGUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUACACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCGAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAUAAUAUUAAGAAAAACUGAUGGAACAUAAAUCCUUUCUACUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAAGUAGAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCUUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUACCAGUCGCCCUUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGAGGCAAUAGUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCCCCAGGUUAACUCCAUUAGCUGAAAAGAAGCCCACCCACAACGAACAUCACUUUGAGCGCCCUCACAAUUUAAAAAUAGGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUUCAGGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUAACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCGAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCUACAAUUGAAUCACCGCUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGAUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCAACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAACUAAGAUAGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUGGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAAGCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUACUUUAUUAUAUGAAUAAGCAUUUUAUCACCAGAAAUCCAAUAUACUAAAUGGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCUAUACUCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCACAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCUUGAAAUAUUACCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCGAUUUCAAUGUUACCACUGAACUCACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCGCUAAAGUCUUCACAGGCACAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAGAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGGUCUUGGUACAGUGUUACUUCAGAUAGGAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGAUUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCUGCCAGCCUAGCAAAAGUUACAAGUGCUUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACACAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUCAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCGUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGCUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGUUAAAUCCUAGCGGAUUAAAUGUCCCUGGGUCACAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCAGCCGAUAUUUUUUCACGUACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGUUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGUGGUGGCCAGUCUGCACGUGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUUAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUGAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUCAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGAUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGAUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAAGAAUGGAUAAUUAAUCGCGGGACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAAUUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUCUAAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAUACUUGGCAAGAGAUUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGGUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAACACGCACCAGGGUCCGUCAUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUUCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGAUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCCUUCUUUACAUUAUCUCAAGGGACACGCAAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAAUACUUACGGCAAUUAAGAUCCGUAAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCUAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAGUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGACGCAGAGACAACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAAUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCUUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAGAGAGGUCCACUAGUCUCUAUCACUCAGCACUUAGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUUGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGUAUAGUAUCCUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCUAAUUUCAAUAAAUAACUAUUUAAAUAACAAAAGAGGUCCUUAUAUUAUACACUGUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUGCCGCAAUGAAUCUAACACAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAAUGAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGGUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUGGGUGUAAUAACUUUAAC-UUUUUGUCUAGUAAGCUACUAUUUCAUACAGAACGAUAAAAUUAAAAGAAAAGGCAUGAUUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUC-------------------------------------------------------------------------------------------------------
'KY471124|inoculum_strain_Gabon||Gabon|2001' -----------------------AUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAGCCUAGGUCUCCGAAGGGAACAAGGGCACCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCCUAAUAGAAAAAUUAUUGUUAACGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUCAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAACUUGGGGUAAAACAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUUACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUCACAAACUUUUCUUGGAAAGUGGUGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAACGUGAUGGGGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGUCAGUUUCUCUCUUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAAGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUCCUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACUGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAAUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCAUCACUGCCCAAAACAAGUGGACCUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUUGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCACGCCAGUGCUCCACUCACGGACAACGACAGAGGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGUCUUCCGCCCUUGGAGUCAGACGAUGAAGAACAGGACAGGGACGAAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAGCAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGACCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACUAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGAAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGAAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCUUAGCUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCCAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCCGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGUUACGCAUCCCAAAUGCAACAAACAAAGCCAAACCCGAAGAUGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACUAUCGCAUCAGAAUCAUUAGAACAACGUAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCAGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGAUAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCGCCAUCACCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUCCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACCAAUAGCAGAGGCUUCAACUGCUGAACUACAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUAGAUAAUAUAAGUCAAUUAAACGACCAAGCCAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGAAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAGAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAACAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCGAAUCCACUCAGGCCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGCUGCGUCCAGGAAUUUCGUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCUAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCAGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCACAAUAUACUUGUCUUAAAGAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUAUUAAUCUUUCUAAUUGCACAUACUCUCUGCCCCUAUCCUCAAAUUGCCUACAUGCCUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUAGGGAAGAAAUCGGAACCCAUCUCCAGGUUGUUCACAAUCCAAGCACAGACAUCGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGCAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUCCAAUCAUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGAGGCAACAACACAAUGGGUAUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAAGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCUCCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCCAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACGGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACGCCACAGUUUUUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAGACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGAGACCUACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAAUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGAUAACCCUUGCCACAAUCUCCACGAGUCCUCAAUCCCCUACAACCAAACCAGGUCAGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCAUCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACAUCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCAAAACUACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCGGCAGCGGGAAGCUGGGCUUGAUUGCCAAUACUAUUGCUGGAGUCGCAGGGCUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCCAAUCUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGAUUGAGGCAGCUGGCCAAUGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACUGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUUGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAGAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAAUAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAAUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAGUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAGUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAAUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUCAAAUGGAAGCUCCAUACGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCAUCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAGGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGGACCACAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUGAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUCGAAGCUGCACUAUGGCAACAAUGGGAUCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAUGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUCAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCUUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCUUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACACAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAACGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAACCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCCACCUACAACGAACAUCACUUUGAGCGCCCUUACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUUGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGCCUAAACACCAAAAUAUCGAUAAUUCAGACACCAAGCAAGACCUGAG-AAGGAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCCUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAGUCACCACUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGGUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUUAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACCAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGGUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUUAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAAUUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUAACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUGUUAUCACCAGAAAUCCAAUAUACUAAAUAGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCCAUACCCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAACGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCAAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGUCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCCUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAGGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUCUUCUGGUAUGACCUGGCUAUUUUGACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCCCUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAGAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCGAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGAUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCCACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUUUAACGCCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCCCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUGGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCAGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUACCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUCACAGAGCGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGUAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCCCAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACUCUGGAAAAUCGAGACAACCCCCCCGAAGGGCCCAGUUCAUACAGAGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUAAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAACGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAACAUCAUCACCUCGGGUUCAAUAAGGGUUUUGACCUUGGACAGUUGACACUUGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUUUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCCGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUGCGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACUUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCCAGUGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAAACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCAGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUUCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGAUUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUAUAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCGACGCGAUUGAUUGUUUCUACUAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUAAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCGGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUGCAUUUAUAAAAGAGUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGAAGCAGGCACAGAAACAGCAAUCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAGCACGCACCAGGGUCCGUCGUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUAGAUCGAGACAUAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUGUCUCAAGGGACGCGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAACGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAAUUCGGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUCAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUGGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUCUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUCCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGUAAAGGUUGAUUAUCAACGUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCGAAUUUCAAUAAAUAACUAUUUAAAUAACGAAAGAAGUCCUUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUUCCGCGAUGAAUCUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACAAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUCAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAAC-AUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAUGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGGAGGCUCGCCAGGAUAAACGUUGCAAAAAGGAUU----------------------------------------------------------------
'KC242800|Ilembe|Gabon|2002' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAGCCUAGGUCUCCGAAGGGAACAAGGGCACCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCCUAAUAGAAAAAUUAUUGUUAACGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUCAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAACUUGGGGUAAAACAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUUACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUCACAAACUUUUCUUGGAAAGUGGUGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAACGUGAUGGGGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGUCAGUUUCUCUCUUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAAGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUCCUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACUGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAAUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCAUCACUGCCCAAAACAAGUGGACCUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUUGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCACGCCAGUGCUCCACUCACGGACAACGACAGAGGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGUCUUCCGCCCUUGGAGUCAGACGAUGAAGAACAGGACAGGGACGAAACUUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAGCAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGACCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACUAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGAAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGAAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCUUAGCUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCCAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCCGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGUUACGCAUCCCAAAUGCAACAAACAAAGCCAAACCCGAAGAUGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACUAUCGCAUCAGAAUCAUUAGAACAACGUAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCACUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCAGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGAUAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCGCCAUCACCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUCCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACCAAUAGCAGAGGCUUCAACUGCUGAACUACAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUAGAUAAUAUAAGUCAAUUAAACGACCAAGCCAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGAAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUCCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUACGAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAACAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCGAAUCCACUCAGGCCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGCUGCGUCCAGGAAUUUCGUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCUAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCAGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCACAAUAUACUUGUCUUAAAGAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUAUUAAUCUUUCUAAUUGCACAUACUCUCUGCCCCUAUCCUCAAAUUGCCUACAUGCCUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUAGGGAAGAAAUCGGAACCCAUCUCCAGGUUGUUCACAAUCCAAGCACAGACAUCGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGCAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUCCAAUCAUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGAGGCAACAACACAAUGGGUAUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAAGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCUCCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCCAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACGGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACGCCACAGUUUUUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAGACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGAGACCUACACAACAACUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAAUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGAUAACCCUUGCCACAAUCUCCACGAGUCCUCAAUCCCCUACAACCAAACCAGGUCAGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCAUCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACAUCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCAAAACUACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCGGCAGCGGGAAGCUGGGCUUGAUUGCCAAUACUAUUGCUGGAGUCGCAGGGCUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCCAAUCUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGAUUGAGGCAGCUGGCCAAUGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACUGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGCGUUAUAAUUGCAGUUAUUGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUCAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAGAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAAUAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAAUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAGUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAGUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAAUUGCAACCUAACACACAUAAAGCAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUCAAAUGGAAGCUCCAUACGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCAUCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAGGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGGACCACAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUGAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUCGAAGCUGCACUAUGGCAACAAUGGGAUCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAUGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUCAAUCAAGACGGUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCUUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCUUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGACUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACACAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAACGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUACUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAACCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCCACCUACAACGAACAUCACUUUGAGCGCCCUUACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUUGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGCCUAAACACCAAAAUAUCGAUAAUUCAGACACCAAGCAAGACCUGAG-AAGGAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCCUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAGUCACCACUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGGUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUUAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACCAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGGUUGUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUUAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAAUUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUAACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUGUUAUCACCAGAAAUCCAAUAUACUAAAUAGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCCAUACCCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAACGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCAAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGUCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCCUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAGGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUCUUCUGGUAUGACCUGGCUAUUUUGACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCCCUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAGAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCGAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUGCGUGCACUAAAGCCUUCACAGGAUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCCACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUUUAACGCCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCCCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUGGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUACCAGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUACCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUCACAGAGCGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGUAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCCCAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACUCUGGAAAAUCGAGACAACCCCCCCGAAGGGCCCAGUUCAUACAGAGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUAAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAACGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAACAUCAUCACCUCGGGUUCAAUAAGGGUUUUGACCUUGGACAGUUGACACUUGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUUUAGGAGAUCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCCGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUGCGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACUUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCCAGUGGGAAGCGAUUGCAAAUUCUAGGAUACCUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAAACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCAGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUUCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAACUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGAUUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUAUAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCGACGCGAUUGAUUGUUUCUACUAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCUGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUAAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUAUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCGGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUGCAUUUAUAAAAGAGUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGAAGCAGGCACAGAAACAGCAAUCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAGCACGCACCAGGGUCCGUCGUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUAGAUCGAGACAUAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUGUCUCAAGGGACGCGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGACGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAACGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAAUUCGGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUCAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAAAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUGGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUCUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUCCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGUGAAGGUUGAUUAUCAACGUACAGAUUAUAAAAAACUCACAAAUUGCUCUCAUACAUCAUAUUGAUCGAAUUUCAAUAAAUAACUAUUUAAAUAACGAAAGAAGUCCUUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUUCCGCGAUGAAUCUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACAAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUCAAGAUUAAG-UUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAAC-AUUUUGUCUAGUAAGCUACUAUUUCAUACAGAAUGAUAAAAUUAAAAGAAAAGGCAUGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGGAGGCUCGCCAGGAUAAACGUUGCAAAAAGGAUUCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KF113528|Kelle_1|DRC|2003' ----CACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUAUGCGAAUAACUAUGAGGAAGAUUAAUAAUCUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAGCCUAGGUCUCCGAAGGGAACAAGGGCACCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCCUAAUAGAAAAAUUAUUGUUAACGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUCAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAACUUGGGGUAAAACAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUUACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUCACAAACUUUUCUUGGAAAGUGGUGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAACGUGAUGGGGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCUUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAAGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUCCUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACUGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAAUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCAUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUUGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCACGCCAGUGCUCCACUCACGGACAACGACAGAGGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGUCUUCCGCCCUUGGAGUCAGACGAUGAAGAACAGGACAGGGACGAAACCUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAGCAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGACCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACUAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGAAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGAAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCUUAGCUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCCAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCCGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGUUACGCAUCCCAAAUGCAACAAACAAAGCCAAACCCGAAGAUGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACUAUCGCAUCAGAAUCAUUAGAACAACGUAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCAGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGAUAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCGCCAUCACCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUCCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACCAAUAGCAGAGGCUUCAACUGCUGAACUACAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUAGAUAAUAUAAGUCAAUUAAACGACCAAGCUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGAAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCCUGUAAACGUUGAGCAAAAUUGUUAAGAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAACAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCGAAUCCACUCAGGCCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGCUGCGUCCAGGGAUUUCGUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCUAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCAGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUCGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCACAAUAUACUUGUCUUAAAGAGAUUGAUUGAUGAAAGAUCAAGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUAUUAAUCUUUCUAAUUGCACAUACUCUCUGCCCCCAUCCUCAAAUUGCCUACAUGCCUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUAGGGAAGAAAUCGGAACCCAUCUCCAGGUUGUUCACAAUCCAAGCACAGACAUCGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGCAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUCCAAUCAUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGAGGCAACAACACAAUGGGUAUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAAGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCUCCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUAAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCCAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACGGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACGCCACAGUUUUUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAGACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGAGACCUACACAACAACUGGAGACCACAAAAUCAUGGCUUCAGAAGAUUCCUCUGCAAUGGUUCAAGUGCACAAUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGAUAACCUUUGCCACAAUCUCCACGAGUCCUCAAUCCCCCACAACCAAACCAGGUCAGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGAACAACAUCAUCGCAGAACAGACAACGACAGCACAGCCUCCGACACCCCCCCCGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACAUCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGACACCGGAGAAGAGAGUGCCGGCAGCGGGAAGCUGGGCUCGAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCCAAUCUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGAUUGAGGCAGCUGGCCAAUGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACUGGAUGGAGACAAUGGAUACCGGCAGGGAUUGGAGUUACAGGGGGUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUUAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAGAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAAUAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAAUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAGUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAGUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAAUUGCAACCUAACACACAUAAAGAAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUCCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCAUCAUGGUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAGGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGGACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUGAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUCGAAGCUGCACUAUGGCAACAAUGGGAUCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAUGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUCAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCUUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCUUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGAUUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACACAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAACGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUAUUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAACCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCCACCUACAACGAACAUCACUUUGAGCGCCCUUACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUUGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGCCUAAACACCAAAAUAUCGAUAAUUCAGACACCAAGCAAGACCUGAG-AAGGAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCCUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAGUCACCACUGUGGGCAUUGAGAGUCAUCCUUGCAGCAUCGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUUAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACCAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGGUUGUUGAGCAGUAUUGAAAUUGGGACUCAAAAUCAUACAAUCAUUAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAAUUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUAACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUGUUAUCACCAGAAAUCCAAUAUACUAAAUAGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCCAUACCCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAACGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCAAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCCUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAGGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUCUUCUGGUAUGACCUGGCUAUUUUGACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCCCUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAGAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAGAUGCGUGCACUAAAGCCUUCACAGGAUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUAGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCCACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUUUAACGCCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCCCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUGGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUGCCAGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUACCGGAAUUUUUCUUUCUCAUUGAAAGAGGAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUACCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUCACAGAGCGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGUAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACUCUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGAGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUAAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAACGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAACAUCAUCACCUCGGGUUCAAUAAGGGUUUUGACCUUGGACAGUUGACACUUGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUUUAGGAGACCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCCGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUGCGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACUUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCCAGUGGGAAGCGAUUGCAAAUUCUAGGAUACUUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAAACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCAGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUUCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCAGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGAUUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCGUUCAUGGCCAAUCGUAUGAGUAAUUCAGCGACGCGAUUGAUUGUUUCUACUAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCCGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUAAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUACUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCGGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUAUAAAAGAGUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGGCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGAAGCAGGCACAGAAACAGCAAUCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGGAAUAAAAAGAACGACAAUUCCACAAGAAAGCACGCACCAGGGUCCGUCGUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUAGAUCGAGACAUAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUGUCUCAAGGGACGCGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGGCGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAACGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAAUUCGGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUCAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUGGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUCUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGUAAAGGUUGAUUAUCAACGUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCGAAUUUCAAUAAAUAACUAUUUAAAUAACGAAAGAAGUCCUUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUUCCGCGAUGAAUCUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACAAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCGGAUCGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUCAAGAUUAAGUUUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAAC-AUUUUGUCUAGUAAGCUACUAUUUCAUACAGAGUGAUAAAAUUAAAAGAAAAGGCAUGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGACAUUGACCACGCUCAUCAGGAGGCUCGCCAGGAUAAACGUUGCAAAAAGGAUUCCUGGAAAAA------------------------------------------------------
'KF113529|Kelle_2|DRC|2003' -----------------------------------------GUGCGAAUAACUAUGAGGAAGAUUAAUAAUGUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCACACCUGGUUUGUUUCAGAGCCACAUCACAAAGAUAGAGAACAGCCUAGGUCUCCGAAGGGAACAAGGGCACCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGUCUUAUCACAUCACAAGUUCCACCUCAGACUCUGCAGGGUGAUCCAACAACCCUAAUAGAAAAAUUAUUGUUAACGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACCUUGAUUUUGAACUUCAACACCUAGAGGAUUGGAGAUUCAACAACCCUAAAACUUGGGGUAAAACAUUGGAAAUAGUUGAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUUACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCAGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUCACAAACUUUUCUUGGAAAGUGGUGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAACGUGAUGGGGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGAAAAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGCCAGUUUCUCUCUUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAAGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUCCUAAUACACCAAGGGAUGCACAUGGUUGCCGGGCAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUUUAUUGAUUGUCAAAACAGUCCUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACUGCCAAGGUAAAAAAUGAGGUGAACUCCUUUAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUAUCGGCAAUUGCACUCGGAGUCGCCACAGCACACGGGAGCACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAGCUCAGAGAGGCUGCCACUGAAGCUGAGAAGCAACUCCAACAAUAUGCAGAAUCUCGCGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCUAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCAUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUGGUUGAUCCCGAUGAUGGAAGCUACGGCGAAUACCAGAGUUACUCGGAAAACGGCAUGAAUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACUAAGCCAGUGCCUAACAGAUUGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCAGGCCAACUCAAAAUGUCCCAGGCCCUCGCAGAACAAUCCACCACGCCAGUGCUCCACUCACGGACAACGACAGAGGAAAUGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACACCAAUUAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGUCUUCCGCCCUUGGAGUCAGACGAUGAAGAACAGGACAGGGACGAAACCUCCAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCUGAAAAGAAAGAACUCCCGCAAGAUGAGCAGCAAGAUCAGGACCACACUCAAGAGGCCAGGAACCAGGACAGUGACAACACCCAGCCAGAACACUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGACCAUUUGAUGCUGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACUAGUGAUGGCAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAAGAGAAUAGAUUUGUUACAUUGGAUGGUCAACAAUUUUAUUGGCCGGUAAUGAAUCACAAGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGAAUGGAAUAAUGGGAUGAUUUAACCGACAAAUAGCUAACAUUAAAUAGUCAAGAAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAUUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAGGCGUUAAGCCACAGUUAUAGCCAUAAUUGUAACUCAAUAUCUUAGCUAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUCGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGUCCAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCCGAGCAGCUAAUGACCGGAAGAAUUCCUGUAAGCGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGUUACGCAUCCCAAAUGCAACAAACAAAGCCAAACCCGAAGAUGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACUAUCGCAUCAGAAUCAUUAGAACAACGUAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCAAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACCGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCAGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAACUCAUUGGAUAUCAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCUCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAAAGCUUGCGUCCAGUCCCGCCAUCACCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUCCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCCCUUCCCUCCGAAAGAGGCGACCAAUAGCAGAGGCUUCAACUGCUGAACUACAGGGUACGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUAGAUAAUAUAAGUCAAUUAAACGACCAAGCUAAAAUUGUUCAUAUCCCGCUAGCAGCUUAAAAUAUAAAUGAAAUAGGAGCUAUAUCUCUGACAGUAUUAUAAUCAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAGAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGUCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAACAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCGAAUCCACUCAGGCCAAUUGCUGAUGACACCAUCGACCAUGCUAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUUGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCACUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCCUUCCUCCAGGAGUUCGUUCUUCCGCCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACCCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACAGGAUCAAAUGGAGCGCUGCGUCCAGGGAUUUCGUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCUAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCAGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCUAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGAUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUAUUUAGUAAUCCGUCUAUUAGAGGAGAUACUUUUAAUCGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUUUUUUCUCUCCUAAAUGUAGAACUUAACAAAAGACUCACAAUAUACUUGUCUUAAAGAGAUUGAUUGAUGAAAGAUCAAGACUAAUAACAUUACAAAUAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUAUUAAUCUUUCUAAUUGCACAUACUCUCUGCCCCUAUCCUCAAAUUGCCUACAUGCCUACAUCUGAGGAUAGCCAGUGUGACUUGGAUUGGAGAUGUAGGGAAGAAAUCGGAACCCAUCUCCAGGUUGUUCACAAUCCAAGCACAGACAUCGCCCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGCAAUCUUCAUCUCUCUUAGAUUAUUUGUUUUCCAGAGUAGGGGUCAUCAGGUCCUUUCCAAUCAUAUAACCAAAAUAAACUUCACUAGAAGGAUAUUGUGAGGCAACAACACAAUGGGUAUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCACUUGGAGUCAUCCACAAUAGCACAUUACAAGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAAGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCAACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCUCCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCGUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUAAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCCAGUGGCUACUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACCAAUGAGACGGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACGCCACAGUUUUUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAAAGGAGCAACACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGAGCCAAAGACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGAGACCUACACAACAACUGGAGACCACAAAAUCAUGGCUUCAGAAGAUUCCUCUGCAAUGGUUCAAGUGCACAAUCAAGGAAGGGAAGCUGCAGUGUCGCAUCUGAUAACCUUUGCCACAAUCUCCACGAGUCCUCAAUCCCCCACAACCAAACCAGGUCAGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUAGAACAACAUCAUCGCAGAACAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACAUCAACACGAGCAAGAGCGCUGACUCCCUGGACCCCGCCACCACGACAAGUCCCCAAAACCACAGCGAGACCGCUGGCAACAACAACACUCAUCACCAAGACACCGGAGAAGAGAGUGCCGGCAGCGGGAAGCUGGGCUCGAUUACCAAUACUAUUGCUGGAGUCGCAGGACUGAUCACAGGCGGGAGAAGAACUCGAAGAGAAGCAAUUGUCAAUGCUCAACCCAAAUGCAACCCCAAUCUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAGGGAAUUUACACAGAGGGGCUAAUGCACAAUCAAGAUGGUUUAAUCUGUGGAUUGAGGCAGCUGGCCAAUGAGACGACUCAAGCUCUUCAACUGUUCCUGAGAGCCACAACUGAGCUACGCACCUUUUCAAUCCUCAACCGUAAGGCAAUUGAUUUCUUGCUGCAGCGAUGGGGCGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACUGGAUGGAGACAAUGGAUACCGGCAGGGAUUGGAGUUACAGGCGGUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUUUUUCUUUAGAUUGCUUCAUGGCAAAGCUCAGCCUCAAAUCAAUGAGAUUAGGAUUUAAUUAUAUGGAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAAUAUAAUACACUGGAGCUUUAAAUAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAAUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGUUAUAUCUUUGAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAGUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAGUGACAAGGGAAAGAAGCCUUUUUAGUAAGUUGUAAUAAUCAGAUCUGCGAACCGGUAGAGUUUAAUUGCAACCUAACACACAUAAAGAAUUGGUCAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGGAGACAACUUUUAAAUGGAAGCUCCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCAUCAUGGUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAGGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGAUCACCAGUUGGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCAGGACCAUAGAGGAUUCAAAAUUAAGAGCAUUGUUGACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUAUGUGAGACACACCUGAGGCGCGAGGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUCGAAGCUGCACUAUGGCAACAAUGGGAUCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAUGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUCAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCGUUUCAAAUUAAUAAGAUAUGCAUAAUUGCUUUAAUAUAUGAAGAGGUAUGAUACAACCCUAACAGUGAUCAAAGAAAAUCAUAAUCUCUUAUCGCUCGUAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUUACUCUACAGGAGGUAGCAACGAUCCAUCCCAUCAAAAAAUAAGUAUUUUAUGAUUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACACAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUCUUUGGUAUUGGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUAUUCUUGUUUCAAGAGGUAGAUUGUGACCGGAAACGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUAAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAGUAUUAUUUCAGGGUAGUCCAAUUAGUGACACGUCUUUUAGCUGUAUAUCAGUCGCCCCUGAGAUACGCCACAAAAGUGUCUCUAAGCUAAAUUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCGUUUAAAAUUUAGUGCAUAAACCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCCACCUACAACGAACAUCACUUUGAGCGCCCUUACAAUUAAAAAAUAGGAACGUCGUUCCAACAAUUGAGCGCAAGGUUUCAAGGUUGAACUGAGAGUGCCUAAACACCAAAAUAUCGAUAAUUCAGACACCAAGCAAGACCUGAG-AAGGAACCAUGGCUAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCCUAGUUAGUCAAACUAUUCAAGGGUGGAAGGUCUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAAUCUAUUUCCUCAUUUAUUUCAAAAUCCGAAUUCCACAAUUGAGUCACCACUGUGGGCAUUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGCUGAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUUAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACCAAUUGGAUGCUCUACAUGUCGUGAACUACAACGGGUUGUUGAGCAGUAUUGAAAUUGGGACUCAAAAUCAUACAAUCAUUAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCGACACGAAUGCAAAGUUUGAUUCUUGAAUUUAAUAGCUCUCUUGCUAUCUAAUUAAGAUGGAAUACUUCAUAUUGAGCUAACUCAUAUAUGCUGACUCAAUAGUUAUCUUGACAUCUCUGCUUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUAACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUGAAUAAGCAUGUUAUCACCAGAAAUCCAAUAUACUAAAUAGUUAAUUGUAACUGAACCCGCAGGUCACGUGUGUUAGGUUUCACAGAUUAUAUAUAUUACUAACUCCAUACCCGUAAUUAACAUUAGAUAAGUAGAUUAAGAAAAACGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUAGUCACUAGAGCUUGCGGGUUAUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUCUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCAAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUGUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUCAUUAAGUACACAAUGCAAGAUGCUCUCUUCCUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAGGACUGUGUUGAUGACCACUUUCAAGAGAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUCUUCUGGUAUGACCUGGCUAUUUUGACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACAUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCAAUGUUACCCCUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGGCAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGACGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAGAUAGCAGAGGUUGAGGAUCCAGUUUGUUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUUAUUAAGUUCCUCGAACCAUUGUGCUUGGCCAAAAUUCAAUUAUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAGAUGCGUGCACUAAAGCCUUCACAGGAUCAAAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUAGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUUCAAAAACACUGGGGGCAUCCAGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCCACGGUGCUAAAAGCAUUACGCCCUAUAGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGUAUUGCAAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACUUCAGAUAGGAAUUUAACGCCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCCCCGUUGCCAAUGAUUAAAGAACUACUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACCGCAGUGGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUAGGAUAUAAUCCACCUCACAAAUUCAGUACUAAACGUGUGCCAGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUACCGGAAUUUUUCUUUCUCAUUGAAAGAGUAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUACCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUCACAGAGCGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGUAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACUCUGGAAAAUCGAGACAACCCCCCCGAAGGGCCUAGUUCAUACAGAGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUAAAGACUGGUUUUAAGUUACGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGACGCAGACGAGCAGGAACAGAGCGCCGAAGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGCACUGCUUUUGAACGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGGAUAACCGCAGCUUUCCAUACGUUUUUUUCGGUGAGAAUCUUGCAACAUCAUCACCUCGGGUUCAAUAAGGGUUUUGACCUUGGACAGUUGACACUUGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUUUAGGAGACCCAGUUACCUCAGGCUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUCCCCGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUGCGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACUUUAUUUCAUGCGUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAAUGGCUAUUAUCAUCAACUCCUGUUAUGAGUCGUUUUGCGGCCGAUAUCUUUUCACGCACGCCCAGUGGGAAGCGAUUGCAAAUUCUAGGAUACUUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAAACACCGGUUUUGGACAGACUGAGGAAAAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCAGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUUCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCAAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUGGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCGAACGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGACAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGAUUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCAGGAAAUAUUGUUCACAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAAUUCAGCGACGCGAUUGAUUGUUUCUACUAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAGUCCGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAAUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAAGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAACGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUCGAUAACCCAUUUUUCCAAGGUAAACGGCUAAACAUUAUAGAAGAUGAUCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCCAAGACCAUCAUGCAAUCAAUUACUUCAGAUAGCAACAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGGUUAAUGAGUAUUGAUCCUCAUUUUUCUAUUUACAUAGGCGGUGCGGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUAUAAAAGAGUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCGCUAGAGGGUCAAAACCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACAACAGGCUUUUAAAACUACCAUAAGUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGAAGCAGGCACAGAAACAGCAAUCGAAAAUACUUGGCAAGAGACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUGAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAAUCUAGUCCUACAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAAAGCACGCACCAGGGUCCGUCGUUCCAGUCAUUUCUAAGUGACUCUGCUUGUGGUACAGCAAAUCCAAAACUAAAUUUCGAUAGAUCGAGACAUAAUGUGAAAUCUCAGGAUCAUAACUCGGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACACCGUCUAGUCCUACCUUUCUUUACAUUGUCUCAAGGGACGCGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGACGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAGUUUUAAGUCGGCUGUGGCGCUAGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAACGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAAUUCGGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUCAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUAUAUAAAUUGAUCUUACACCAUAUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUCCUAAGUGAUACUGAGGGUAUGUUAUGGCUAAAUGAUAAUUUAGCCCCGUUUUUUGCCACUGGUUAUUUAAUUAAGCCAAUAACGUCAAGUGCUAGAUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAACAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGUUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUCGUCGAUUCAAAAAGAGGUCCACUAGUCUCUAUCACUCAGCACUUGGCACAUCUUAGAGCAGAGAUUCGAGAAUUGACUAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUGCAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGCAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUCUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCGGAUGGUCUCUACAGGUUUGAUUGAAUUACCGUGCAUAGUAUCCUGAUACUUGUAAAGGUUGAUUAUCAACGUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUAUUGAUCGAAUUUCAAUAAAUAACUAUUUAAAUAACGAAAGAAGUCCUUAUAUUAUACACUAUAUUUAGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUGCAGCAUGUGUGACAUAUUACUUCCGCGAUGAAUCUAACGCAACAUAAUAAACUCUGCACUCUUUAUAAUUAAGCUUUAACAAAAGGUCUGGGCUCAUAUUGUUAUUGAUAUAAUAAUGUUGUAUCAAUAUCCUGUCAGAUGGAAUAGUGUUUUGGUUGAUAACACGACUUCUUAAAACAAAAUUGAUCUUCAAGAUUAAGUUUUUUUAUAAUUAUCAUUACUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
'KJ660346|Makona-Kissidougou-C15|Guinea|2014-02-19' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCAUACCUGGUUUGUUUCAGAGCCAUAUCACCAAGAUAGAGAACAACCUAGGUCUCCGGAGGGGGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGCCUUAUCACAUCACAAGUUCCGCCUUAAACUCUGCAGGGUGAUCCAACAACCUUAAUAGCAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACUUUGAUUUUGAACCUGAACACCCAGAGGACUGGAGACUCAACAACCCUAAAGCCUGGGGUAAAACAUUAGAAAUAGUUUAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCUGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGGAGAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGUCAGUUCCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUUCUAAUACACCAAGGGAUGCACAUGGUUGCCGGACAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUCUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUCAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUGUCGGCAAUUGCACUCGGAGUCGCCACAGCCCACGGGAGCACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAGCUCAGAGAGGCAGCCACUGAGGCUGAGAAGCAACUCCAACAAUAUGCGGAGUCUCGUGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCGAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCAUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAGGCUACGGCGAAUACCAAAGUUACUCGGAAAACGGCAUGAGUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACCAAGCCAGUGCCUAACAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCACGCCAACUCAAAACGUCACAGGCCCUCGCAGAACAAUCCACCAUGCCAGUGCUCCACUCACGGACAAUGACAGAAGAAACGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACCCCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUAGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCUAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCCGAAAAGAAAGAACUCCCGCAAGAUGAACAACAAGAUCAGGACCACAUUCAAGAGGCCAGGAACCAAGACAGUGACAACACCCAGCCAGAACAUUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCCGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGUAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAUGAGAAUAGAUUUGUUACACUGGAUGGUCAACAAUUUUAUUGGCCAGUAAUGAAUCACAGGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGUAAUAAUGGGAUGAUUUAAUCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAGUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAAGCGUUAAGCCACAGUUAUAGCCAUAAUGGUAACUCAAUAUCUUAGCCAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUAGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGCCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGGAUUCCUGUAAACGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGAUGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACUGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAAUUCAUUGGACAUUAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCCCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUGCGUCCAGUCCCACCAUCACCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCUUUUCCCUCCGAAAGAGGCAACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUAUGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUAGAUAAUAUAAGUCAAUUAAACAACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUUAAAGAUAAAUGUAAUAGGAGCUAUACCUCUGACAGUAUUAUAAUUAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGCCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCGAAUCCACUCAGGCCAAUUGCUGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUCGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCGCUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCACCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACUCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACUGGAUCAAAUGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCCAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGGUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUUUUUAAUAAUCCGUCUACUAGAAGAGAUACUUCUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUCUUUUCUCUCCUAAAUGUAGAGCUUAACAAAAGACUCAUAAUAUACCUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAACAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUCAAUCUUUCUCAUUGCACAUACUCUUUGUCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGACAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGGAAAAAUCGGGGCCCAUUUCUAAGUUGUUCACAAUCUAAGUACAGACAUUGCUCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUUGGAUAACCAAAAUAAGCUUCACUAGAAGGAUAUUGUGAGGCGACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCGCUUGGAGUUAUCCACAAUAGUACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAGGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCGACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCAUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCGAGUGGCUAUUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACUAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAGAGGAGCAACACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGACCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGAGACCAACACAACAAAUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGAAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCUCCCACAACCAAAACAGGUCCGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGGACAACAUCACCGUAGAGCAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCUUAAAAGCAGAGAACACCAACACGAGUAAGAGCGCUGACUCCCUGGACCUCGCCACCACGACAAGCCCCCAAAACUACAGCGAGACUGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUAGCAGGACUGAUCACAGGCGGGAGAAGGACUCGAAGAGAAGUAAUUGUCAAUGCUCAACCCAAAUGCAACCCCAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAAGGAAUUUACACAGAGGGGCUAAUGCACAACCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAAACGACUCAAGCUCUCCAACUGUUCCUGAGAGCCACAACUGAGCUGCGAACCUUUUCAAUCCUCAACCGUAAGGCAAUUGACUUCCUGCUGCAGCGAUGGGGUGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGUGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUCUUUCUUCAGAUUGUUUCACGGCAAAACUCAACCUCAAAUCAAUGAAACUAGGAUUUAAUUAUAUGAAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAACAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGCUAUAUCUUUAAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAGUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAAUGAAAAAGGAAAAAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCAAACCGGUAGAAUUUAGUUGUAACCUAACACACACAAAGCAUUGGUAAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGCAGACAACUCUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGACCACCAGUUAGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCCGAACCAUAGAGGAUUCCAAAUUAAGGGCAUUGUUAACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUGUGUGAGACACACCUAAGGCGCGAAGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCAUUUCAAAUUGAUAAGAUAUGCAUAAUUGCCUUAAUAUAUAAAGAGGUAUGAUAUAACCCAAACAUUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGCAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUGACUCUACAGGAGGUAGCAACGAUCCAUCUCAUCAAAAAAUAAGUAUUUUAUGAUUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUCUAUGGUAUUCGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAGGAGGUAUAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUGAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAAUACUAUUUCAGGAUAGUCCAGCUAGUGACACGUCUUUUAGCUGUAUACCAGUUGCCCCUGAGAUACGCCACAAAAGUGUCUCUGAGCUAAAGUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCAUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCCACCUACAACGAACAUUACUUUGAGCGCCCUCACAAUUAAAAAAUAAGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUACAAGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCCAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAAGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAACCUAUUUCCCCAUUUAUUUCAAAAUCCGAAUUCCACUAUUGAAUCACCGCUGUGGGCACUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGUUAAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAAUGGAUUAUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCGACACGAAUGCAAAGUUUAAUUCUUGAAUUCAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGGGCUAACUCAUAUAUGCUGACUCAAUAGUUAACUUGACAUCUCUGCCUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUUAAUAAGCAUUUUAUCACUAGAAAUCCAAUAUACGAAAUGGUUAAUUGUAACUAAACCCGCAGGUCAUGUGUGUUAGGUUUCACAAAUUAUAUAUAUUACUAACUCCAUACUCGUAACUAACAUUAGAUAAGUAGGUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUUGUCACUAGAGCUUGCGGGUUGUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUAUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUAUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUUAUUAAGUACACAAUGCAAGAUGCUCUCUUCCUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAAAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACGUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCACUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGACAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGAUGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGACCCAGUUUGCUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUCAUUAAGUUUCUCGAACCAUUGUGCUUGGCUAAAAUUCAAUUGUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUACGUGCACUAAAGCCUUCACAGGCUCACAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUACAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUCGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGCAUUGCAAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACCUCAGAUAGAAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUGCUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUGGGAUAUAAUCCACCUCACAAAUUCAGUACCAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAACAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUCGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGGUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAAACAACCCCCCUGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUGCGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGAUGCAGGCGAGCAGGAACAGAGCGCCGAGGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGUACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGAAUAACCGCAGCUUUCCAUACGUUCUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUUAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUUCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCAUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAGUGGCUCUUAUCAUCAACUCCUGUUAUGAGUCGUUUCGCAGCCGAUAUAUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACUUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACGCCGGUUUUGGACAGACUGAGGAAGAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCCAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUAGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCAAAUGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGGCAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCGGGAAAUAUUGUUCAUAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAACUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAAUCGGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAGUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAGGUACCAGCUCAGUACUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAAUGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUUGAUAACCCAUUUUUCCAAGGCAAACAGCUGAACAUUAUAGAAGAUGACCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCUAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAAUAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGAUUAAUGAGUAUUGAUCCCCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAGGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCAUUAGAGGGUCAAAAUCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACACCAGGCUUUUAAAACUACCAUAAAUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAGACUUGACAAGAAACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUAAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAGUCUAGUCCUGCAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAGAACACGCACCAGGGUCCGUCGUUCCAGUCAUUUCUAAGUGACUCUGCUUGCGGUACAGCAAACCCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACAUCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGAUGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAAUUUUAAGUCGGCUGUGACGCUGGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUACAUAAAUUGAUCUUACACCAUGUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACCGAGGGUAUGUUAUGGCUAAAUGAUAAUCUAGCCCCGUUUUUUGCCACUGGGUAUUUAAUUAAGCCAAUAACGUCAAGUGCCAGGUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAGCAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGCUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUUGUCGAUUCAAAAAGAGGUCCACUAGUCUCUGUCACUCAGCACUUAGCACAUCUUAGGGCAGAGAUUCGAGAAUUGACCAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUACAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGUAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCAGAUGGUCUCUACAGGUUCGAUUGAAUAACCGUGCAUAGUAUUUUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUCUUGAUCUGAUUUCAAUAAAUAACUAUUUAGAUAACGAAAGGAGUCCUUACAUUAUACACUAUAUUUGGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUACAGCAUGUGUGACAUAUUACUGCUGCAAUGAGUCUAACGCAACAUAAUAAACUCCGCACUCUUUAUAAUUAAGCUUUAACGAUAGGUCUGGGCUCAUAUUGUUAUUGAUAUAGUAAUGUUGUAUCAAUAUCUUGCCAGAUGGAAUAGUGCUUUGGUUGAUAACACGACUUCUUAAAACAAAACUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUGUCAUUGCUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUCCAUUCAGAAUGAUAAAAUUAAAAGAAAAGACAUGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGGCAUUGACCACGCUCAUCAGAAGGCUCACUAGAAUAAACGUUGCAAAAAGGAUCCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KJ660347|Makona-Gueckedou-C07|Guinea|2014-01-20' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCAUACCUGGUUUGUUUCAGAGCCAUAUCACCAAGAUAGAGAACAACCUAGGUCUCCGGAGGGGGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGCCUUAUCACAUCACAAGUUCCGCCUUAAACUCUGCAGGGUGAUCCAACAACCUUAAUAGCAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACUUUGAUUUUGAACCUGAACACCCAGAGGACUGGAGACUCAACAACCCUAAAGCCUGGGGUAAAACAUUAGAAAUAGUUUAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCUGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGGAGAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGUCAGUUCCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUUCUAAUACACCAAGGGAUGCACAUGGUUGCCGGACAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUCUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUCAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUGUCGGCAAUUGCACUCGGAGUCGCCACAGCCCACGGGAGCACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAGCUCAGAGAGGCAGCCACUGAGGCUGAGAAGCAACUCCAACAAUAUGCGGAGUCUCGUGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCGAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCAUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAGGCUACGGCGAAUACCAAAGUUACUCGGAAAACGGCAUGAGUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACCAAGCCAGUGCCUAACAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCACGCCAACUCAAAACGUCACAGGCCCUCGCAGAACAAUCCACCAUGCCAGUGCUCCACUCACGGACAAUGACAGAAGAAACGAACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACCCCAAUCAACGAAGAGGCAGACCCACUGGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUAGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCUAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCCGAAAAGAAAGAACUCCCGCAAGAUGAACAACAAGAUCAGGACCACAUUCAAGAGGCCAGGAACCAAGACAGUGACAACACCCAGCCAGAACAUUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCCGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGUAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAUGAGAAUAGAUUUGUUACACUGGAUGGUCAACAAUUUUAUUGGCCAGUAAUGAAUCACAGGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGUAAUAAUGGGAUGAUUUAAUCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAGUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAAGCGUUAAGCCACAGUUAUAGCCAUAAUGGUAACUCAAUAUCUUAGCCAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUAGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGCCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGGAUUCCUGUAAACGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGAUGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACUGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAAUUCAUUGGACAUUAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCCCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUGCGUCCAGUCCCACCAUCACCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCUUUUCCCUCCGAAAGAGGCAACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUAUGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUAGAUAAUAUAAGUCAAUUAAACAACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUUAAAGAUAAAUGUAAUAGGAGCUAUACCUCUGACAGUAUUAUAAUUAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGCCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCGAAUCCACUCAGGCCAAUUGCUGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUCGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCGCUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCACCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACUCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACUGGAUCAAAUGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCCAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGGUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUUUUUAAUAAUCCGUCUACUAGAAGAGAUACUUCUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUCUUUUCUCUCCUAAAUGUAGAGCUUAACAAAAGACUCAUAAUAUACCUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAACAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUCAAUCUUUCUCAUUGCACAUACUCUUUGUCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGACAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGGAAAAAUCGGGGCCCAUUUCUAAGUUGUUCACAAUCUAAGUACAGACAUUGCUCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUUGGAUAACCAAAAUAAGCUUCACUAGAAGGAUAUUGUGAGGCGACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCGCUUGGAGUUAUCCACAAUAGUACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAGGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCGACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCAUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCGAGUGGCUAUUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACUAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAGAGGAGCAACACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCUGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGACCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGAGACCAACACAACAAAUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGAAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCUCCCACAACCAAAACAGGUCCGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGGACAACAUCACCGUAGAGCAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCUUAAAAGCAGAGAACACCAACACGAGUAAGAGCGCUGACUCCCUGGACCUCGCCACCACGACAAGCCCCCAAAACUACAGCGAGACUGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUAGCAGGACUGAUCACAGGCGGGAGAAGGACUCGAAGAGAAGUAAUUGUCAAUGCUCAACCCAAAUGCAACCCCAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAAGGAAUUUACACAGAGGGGCUAAUGCACAACCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAAACGACUCAAGCUCUCCAACUGUUCCUGAGAGCCACAACUGAGCUGCGAACCUUUUCAAUCCUCAACCGUAAGGCAAUUGACUUCCUGCUGCAGCGAUGGGGUGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGUGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUCUUUCUUCAGAUUGUUUCACGGCAAAACUCAACCUCAAAUCAAUGAAACUAGGAUUUAAUUAUAUGAAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAACAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGCUAUAUCUUUAAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAGUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAAUGAAAAAGGAAAAAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCAAACCGGUAGAAUUUAGUUGUAACCUAACACACACAAAGCAUUGGUAAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGCAGACAACUCUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGACCACCAGUUAGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCCGAACCAUAGAGGAUUCCAAAUUAAGGGCAUUGUUAACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUGUGUGAGACACACCUAAGGCGCGAAGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCAUUUCAAAUUGAUAAGAUAUGCAUAAUUGCCUUAAUAUAUAAAGAGGUAUGAUAUAACCCAAACAUUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGCAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUGACUCUACAGGAGGUAGCAACGAUCCAUCUCAUCAAAAAAUAAGUAUUUUAUGAUUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUCUAUGGUAUUCGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAGGAGGUAUAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUGAGAAUAAACCUCAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAAUACUAUUUCAGGAUAGUCCAGCUAGUGACACGUCUUUUAGCUGUAUACCAGUUGCCCCUGAGAUACGCCACAAAAGUGUCUCUGAGCUAAAGUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCAUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCCACCUACAACGAACAUUACUUUGAGCGCCCUCACAAUUAAAAAAUAAGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUACAAGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCCAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAAGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAACCUAUUUCCCCAUUUAUUUCAAAAUCCGAAUUCCACUAUUGAAUCACCGCUGUGGGCACUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGUUAAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAAUGGAUUAUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCGACACGAAUGCAAAGUUUAAUUCUUGAAUUCAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGGGCUAACUCAUAUAUGCUGACUCAAUAGUUAACUUGACAUCUCUGCCUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUUAAUAAGCAUUUUAUCACUAGAAAUCCAAUAUACGAAAUGGUUAAUUGUAACUAAACCCGCAGGUCAUGUGUGUUAGGUUUCACAAAUUAUAUAUAUUACUAACUCCAUACUCGUAACUAACAUUAGAUAAGUAGGUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUUGUCACUAGAGCUUGCGGGUUGUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUAUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUAUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUUAUUAAGUACACAAUGCAAGAUGCUCUCUUCCUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAAAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACGUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCACUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGACAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGAUGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGACCCAGUUUGCUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUCAUUAAGUUUCUCGAACCAUUGUGCUUGGCUAAAAUUCAAUUGUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUACGUGCACUAAAGCCUUCACAGGCUCACAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUACAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUCGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGCAUUGCAAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACCUCAGAUAGAAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUGCUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUGGGAUAUAAUCCACCUCACAAAUUCAGUACCAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAACAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUCGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGGUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAAACAACCCCCCUGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUGCGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGAUGCAGACGAGCAGGAACAGAGCGCCGAGGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGUACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGAAUAACCGCAGCUUUCCAUACGUUCUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUUAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUUCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCAUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAGUGGCUCUUAUCAUCAACUCCUGUUAUGAGUCGUUUCGCAGCCGAUAUAUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACUUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACGCCGGUUUUGGACAGACUGAGGAAGAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCCAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUAGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCAAAUGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGGCAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCGGGAAAUAUUGUUCAUAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAACUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAAUCGGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAGUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAGGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAAUGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUUGAUAACCCAUUUUUCCAAGGCAAACAGCUGAACAUUAUAGAAGAUGACCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCUAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAAUAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGAUUAAUGAGUAUUGAUCCCCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAGGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCAUUAGAGGGUCAAAAUCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACACCAGGCUUUUAAAACUACCAUAAAUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAGACUUGACAAGAAACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUAAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAGUCUAGUCCUGCAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAGAACACGCACCAGGGUCCGUCGUUCCAGUCAUUUCUAAGUGACUCUGCUUGCGGUACAGCAAACCCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACAUCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGAUGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAAUUUUAAGUCGGCUGUGACGCUGGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUACAUAAAUUGAUCUUACACCAUGUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACCGAGGGUAUGUUAUGGCUAAAUGAUAAUCUAGCCCCGUUUUUUGCCACUGGGUAUUUAAUUAAGCCAAUAACGUCAAGUGCCAGGUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAGCAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGCUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUUGUCGAUUCAAAAAGAGGUCCACUAGUCUCUGUCACUCAGCACUUAGCACAUCUUAGGGCAGAGAUUCGAGAAUUGACCAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUACAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGUAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCAGAUGGUCUCUACAGGUUCGAUUGAAUAACCGUGCAUAGUAUUUUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUCUUGAUCUGAUUUCAAUAAAUAACUAUUUAGAUAACGAAAGGAGUCCUUACAUUAUACACUAUAUUUGGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUACAGCAUGUGUGACAUAUUACUGCUGCAAUGAGUCUAACGCAACAUAAUAAACUCCGCACUCUUUAUAAUUAAGCUUUAACGAUAGGUCUGGGCUCAUAUUGUUAUUGAUAUAGUAAUGUUGUAUCAAUAUCUUGCCAGAUGGAAUAGUGCUUUGGUUGAUAACACGACUUCUUAAAACAAAACUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUGUCAUUGCUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUCCAUUCAGAAUGAUAAAAUUAAAAGAAAAGACAUGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGGCAUUGACCACGCUCAUCAGAAGGCUCACUAGAAUAAACGUUGCAAAAAGGAUCCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
'KJ660348|Makona-Gueckedou-C05|Guinea|2014-01-29' CGGACACACAAAAAGAAAGAAGAAUUUUUAGGAUCUUUUGUGUGCGAAUAACUAUGAGGAAGAUUAAUAAUUUUCCUCUCAUUGAAAUUUAUAUCGGAAUUUAAAUUGAAAUUGUUACUGUAAUCAUACCUGGUUUGUUUCAGAGCCAUAUCACCAAGAUAGAGAACAACCUAGGUCUCCGGAGGGGGCAAGGGCAUCAGUGUGCUCAGUUGAAAAUCCCUUGUCAACAUCUAGGCCUUAUCACAUCACAAGUUCCGCCUUAAACUCUGCAGGGUGAUCCAACAACCUUAAUAGCAACAUUAUUGUUAAAGGACAGCAUUAGUUCACAGUCAAACAAGCAAGAUUGAGAAUUAACUUUGAUUUUGAACCUGAACACCCAGAGGACUGGAGACUCAACAACCCUAAAGCCUGGGGUAAAACAUUAGAAAUAGUUUAAAGACAAAUUGCUCGGAAUCACAAAAUUCCGAGUAUGGAUUCUCGUCCUCAGAAAGUCUGGAUGACGCCGAGUCUCACUGAAUCUGACAUGGAUUACCACAAGAUCUUGACAGCAGGUCUGUCCGUUCAACAGGGGAUUGUUCGGCAAAGAGUCAUCCCAGUGUAUCAAGUAAACAAUCUUGAGGAAAUUUGCCAACUUAUCAUACAGGCCUUUGAAGCUGGUGUUGAUUUUCAAGAGAGUGCGGACAGUUUCCUUCUCAUGCUUUGUCUUCAUCAUGCGUACCAAGGAGAUUACAAACUUUUCUUGGAAAGUGGCGCAGUCAAGUAUUUGGAAGGGCACGGGUUCCGUUUUGAAGUCAAGAAGCGUGAUGGAGUGAAGCGCCUUGAGGAAUUGCUGCCAGCAGUAUCUAGUGGGAGAAACAUUAAGAGAACACUUGCUGCCAUGCCGGAAGAGGAGACGACUGAAGCUAAUGCCGGUCAGUUCCUCUCCUUUGCAAGUCUAUUCCUUCCGAAAUUGGUAGUAGGAGAAAAGGCUUGCCUUGAGAAGGUUCAAAGGCAAAUUCAAGUACAUGCAGAGCAAGGACUGAUACAAUAUCCAACAGCUUGGCAAUCAGUAGGACACAUGAUGGUGAUUUUCCGUUUGAUGCGAACAAAUUUUUUGAUCAAAUUUCUUCUAAUACACCAAGGGAUGCACAUGGUUGCCGGACAUGAUGCCAACGAUGCUGUGAUUUCAAAUUCAGUGGCUCAAGCUCGUUUUUCAGGUCUAUUGAUUGUCAAAACAGUACUUGAUCAUAUCCUACAAAAGACAGAACGAGGAGUUCGUCUCCAUCCUCUUGCAAGGACCGCCAAGGUAAAAAAUGAGGUGAACUCCUUCAAGGCUGCACUCAGCUCCCUGGCCAAGCAUGGAGAGUAUGCUCCUUUCGCCCGACUUUUGAACCUUUCUGGAGUAAAUAAUCUUGAGCAUGGUCUUUUCCCUCAACUGUCGGCAAUUGCACUCGGAGUCGCCACAGCCCACGGGAGCACCCUCGCAGGAGUAAAUGUUGGAGAACAGUAUCAACAGCUCAGAGAGGCAGCCACUGAGGCUGAGAAGCAACUCCAACAAUAUGCGGAGUCUCGUGAACUUGACCAUCUUGGACUUGAUGAUCAGGAAAAGAAAAUUCUUAUGAACUUCCAUCAGAAAAAGAACGAAAUCAGCUUCCAGCAAACAAACGCGAUGGUAACUCUAAGAAAAGAGCGCCUGGCCAAGCUGACAGAAGCUAUCACUGCUGCAUCACUGCCCAAAACAAGUGGACAUUACGAUGAUGAUGACGACAUUCCCUUUCCAGGACCCAUCAAUGAUGACGACAAUCCUGGCCAUCAAGAUGAUGAUCCGACUGACUCACAGGAUACGACCAUUCCCGAUGUGGUAGUUGAUCCCGAUGAUGGAGGCUACGGCGAAUACCAAAGUUACUCGGAAAACGGCAUGAGUGCACCAGAUGACUUGGUCCUAUUCGAUCUAGACGAGGACGACGAGGACACCAAGCCAGUGCCUAACAGAUCGACCAAGGGUGGACAACAGAAAAACAGUCAAAAGGGCCAGCAUACAGAGGGCAGACAGACACAAUCCACGCCAACUCAAAACGUCACAGGCCCUCGCAGAACAAUCCACCAUGCCAGUGCUCCACUCACGGACAAUGACAGAAGAAACGGACCCUCCGGCUCAACCAGCCCUCGCAUGCUGACCCCAAUCAACGAAGAGGCAGACCCACUAGACGAUGCCGACGACGAGACGUCUAGCCUUCCGCCCUUAGAGUCAGAUGAUGAAGAACAGGACAGGGACGGAACUUCUAACCGCACACCCACUGUCGCCCCACCGGCUCCCGUAUACAGAGAUCACUCCGAAAAGAAAGAACUCCCGCAAGAUGAACAACAAGAUCAGGACCACAUUCAAGAGGCCAGGAACCAAGACAGUGACAACACCCAGCCAGAACAUUCUUUUGAGGAGAUGUAUCGCCACAUUCUAAGAUCACAGGGGCCAUUUGAUGCCGUUUUGUAUUAUCAUAUGAUGAAGGAUGAGCCUGUAGUUUUCAGUACCAGUGAUGGUAAAGAGUACACGUAUCCGGACUCCCUUGAAGAGGAAUAUCCACCAUGGCUCACUGAAAAAGAGGCCAUGAAUGAUGAGAAUAGAUUUGUUACACUGGAUGGUCAACAAUUUUAUUGGCCAGUAAUGAAUCACAGGAAUAAAUUCAUGGCAAUCCUGCAACAUCAUCAGUGAAUGAGCAUGUAAUAAUGGGAUGAUUUAAUCGACAAAUAGCUAACAUUAAAUAGUCAAGGAACGCAAACAGGAAGAAUUUUUGAUGUCUAAGGUGUGAAUUAUUAUCACAAUAAAAGUGAUUCUUAGUUUUGAAUUUAAAGCUAGCUUAUUAUUACUAGCCGUUUUUCAAAGUUCAAUUUGAGUCUUAAUGCAAAUAAGCGUUAAGCCACAGUUAUAGCCAUAAUGGUAACUCAAUAUCUUAGCCAGCGAUUUAUCUAAAUUAAAUUACAUUAUGCUUUUAUAACUUACCUACUAGCCUGCCCAACAUUUACACGAUCGUUUUAUAAUUAAGAAAAAACUAAUGAUGAAGAUUAAAACCUUCAUCAUCCUUACGUCAAUUGAAUUCUCUAGCACUAGAAGCUUAUUGUCUUCAAUGUAAAAGAAAAGCUGGCCUAACAAGAUGACAACUAGAACAAAGGGCAGGGGCCAUACUGUGGCCACGACUCAAAACGACAGAAUGCCAGGCCCUGAGCUUUCGGGCUGGAUCUCUGAGCAGCUAAUGACCGGAAGGAUUCCUGUAAACGACAUCUUCUGUGAUAUUGAGAACAAUCCAGGAUUAUGCUACGCAUCCCAAAUGCAACAAACGAAGCCAAACCCGAAGAUGCGCAACAGUCAAACCCAAACGGACCCAAUUUGCAAUCAUAGUUUUGAGGAGGUAGUACAAACAUUGGCUUCAUUGGCUACUGUUGUGCAACAACAAACCAUCGCAUCAGAAUCAUUAGAACAACGCAUUACGAGUCUUGAGAAUGGUCUAAAGCCAGUUUAUGAUAUGGCAAAAACAAUCUCCUCAUUGAACAGGGUUUGUGCUGAGAUGGUUGCAAAAUAUGAUCUUCUGGUGAUGACAACCGGUCGGGCAACAGCAACCGCUGCGGCAACUGAGGCUUAUUGGGCUGAACAUGGUCAACCACCACCUGGACCAUCACUUUAUGAAGAAAGUGCGAUUCGGGGUAAGAUUGAAUCUAGAGAUGAGACUGUCCCUCAAAGUGUUAGGGAGGCAUUCAACAAUCUAGACAGUACCACUUCACUAACUGAGGAAAAUUUUGGGAAACCUGACAUUUCGGCAAAGGAUUUGAGAAACAUUAUGUAUGAUCACUUGCCUGGUUUUGGAACUGCUUUCCACCAAUUAGUACAAGUGAUUUGUAAAUUGGGAAAAGAUAGCAAUUCAUUGGACAUUAUUCAUGCUGAGUUCCAGGCCAGCCUGGCUGAAGGAGACUCCCCUCAAUGUGCCCUAAUUCAAAUUACAAAAAGAGUUCCAAUCUUCCAAGAUGCUGCUCCACCUGUCAUCCACAUCCGCUCUCGAGGUGACAUUCCCCGAGCUUGCCAGAAGAGCUUGCGUCCAGUCCCACCAUCACCCAAGAUUGAUCGAGGUUGGGUAUGUGUUUUUCAGCUUCAAGAUGGUAAAACACUUGGACUCAAAAUUUGAGCCAAUCUCUUUUCCCUCCGAAAGAGGCAACUAAUAGCAGAGGCUUCAACUGCUGAACUAUAGGGUAUGUUACAUUAAUGAUACACUUGUGAGUAUCAGCCCUAGAUAAUAUAAGUCAAUUAAACAACCAAGAUAAAAUUGUUCAUAUCCCGCUAGCAGCUUUAAAGAUAAAUGUAAUAGGAGCUAUACCUCUGACAGUAUUAUAAUUAAUUGUUAUUAAGUAACCCAAACCAAAAAUGAUGAAGAUUAAGAAAAACCUACCUCGACUGAGAGAGUGUUUUUUCAUUAACCUUCAUCUUGUAAACGUUGAGCAAAAUUGUUAAAAAUAUGAGGCGGGUUAUAUUGCCUACUGCUCCUCCUGAAUAUAUGGAGGCCAUAUACCCUGCCAGGUCAAAUUCAACAAUUGCUAGGGGUGGCAACAGCAAUACAGGCUUCCUGACACCGGAGUCAGUCAAUGGAGACACUCCAUCGAAUCCACUCAGGCCAAUUGCUGAUGACACCAUCGACCAUGCCAGCCACACACCAGGCAGUGUGUCAUCAGCAUUCAUCCUCGAAGCUAUGGUGAAUGUCAUAUCGGGCCCCAAAGUGCUAAUGAAGCAAAUUCCAAUUUGGCUUCCUCUAGGUGUCGCUGAUCAAAAGACCUACAGCUUUGACUCAACUACGGCCGCCAUCAUGCUUGCUUCAUAUACUAUCACCCAUUUCGGCAAGGCAACCAAUCCGCUUGUCAGAGUCAAUCGGCUGGGUCCUGGAAUCCCGGAUCACCCCCUCAGGCUCCUGCGAAUUGGAAACCAGGCUUUCCUCCAGGAGUUCGUUCUUCCACCAGUCCAACUACCCCAGUAUUUCACCUUUGAUUUGACAGCACUCAAACUGAUCACUCAACCACUGCCUGCUGCAACAUGGACCGAUGACACUCCAACUGGAUCAAAUGGAGCGUUGCGUCCAGGAAUUUCAUUUCAUCCAAAACUUCGCCCCAUUCUUUUACCCAACAAAAGUGGGAAGAAGGGGAACAGUGCCGAUCUAACAUCUCCGGAGAAAAUCCAAGCAAUAAUGACUUCACUCCAGGACUUUAAGAUCGUUCCAAUUGAUCCAACCAAAAAUAUCAUGGGUAUCGAAGUGCCAGAAACUCUGGUCCACAAGCUGACCGGUAAGAAGGUGACUUCCAAAAAUGGACAACCAAUCAUCCCUGUUCUUUUGCCAAAGUACAUUGGGUUGGACCCGGUGGCUCCAGGAGACCUCACCAUGGUAAUCACACAGGAUUGUGACACGUGUCAUUCUCCUGCAAGUCUUCCAGCUGUGGUUGAGAAGUAAUUGCAAUAAUUGACUCAGAUCCAGUUUUACAGAAUCUUCUCAGGGAUAGUGAUAACAUCUUUUUAAUAAUCCGUCUACUAGAAGAGAUACUUCUAAUUGAUCAAUAUACUAAAGGUGCUUUACACCAUUGUCUCUUUUCUCUCCUAAAUGUAGAGCUUAACAAAAGACUCAUAAUAUACCUGUUUUUAAAAGAUUGAUUGAUGAAAGAUCAUGACUAAUAACAUUACAAACAAUCCUACUAUAAUCAAUACGGUGAUUCAAAUGUCAAUCUUUCUCAUUGCACAUACUCUUUGUCCUUAUCCUCAAAUUGCCUACAUGCUUACAUCUGAGGACAGCCAGUGUGACUUGGAUUGGAGAUGUGGAGGAAAAAUCGGGGCCCAUUUCUAAGUUGUUCACAAUCUAAGUACAGACAUUGCUCUUCUAAUUAAGAAAAAAUCGGCGAUGAAGAUUAAGCCGACAGUGAGCGUAAUCUUCAUCUCUCUUAGAUUAUUUGUCUUCCAGAGUAGGGGUCAUCAGGUCCUUUUCAAUUGGAUAACCAAAAUAAGCUUCACUAGAAGGAUAUUGUGAGGCGACAACACAAUGGGUGUUACAGGAAUAUUGCAGUUACCUCGUGAUCGAUUCAAGAGGACAUCAUUCUUUCUUUGGGUAAUUAUCCUUUUCCAAAGAACAUUUUCCAUCCCGCUUGGAGUUAUCCACAAUAGUACAUUACAGGUUAGUGAUGUCGACAAACUAGUUUGUCGUGACAAACUGUCAUCCACAAAUCAAUUGAGAUCAGUUGGACUGAAUCUCGAGGGGAAUGGAGUGGCAACUGACGUGCCAUCUGCGACUAAAAGAUGGGGCUUCAGGUCCGGUGUCCCACCAAAGGUGGUCAAUUAUGAAGCUGGUGAAUGGGCUGAAAACUGCUACAAUCUUGAAAUCAAAAAACCUGACGGGAGUGAGUGUCUACCAGCAGCGCCAGACGGGAUUCGGGGCUUCCCCCGGUGCCGGUAUGUGCACAAAGUAUCAGGAACGGGACCAUGUGCCGGAGACUUUGCCUUCCACAAAGAGGGUGCUUUCUUCCUGUAUGAUCGACUUGCUUCCACAGUUAUCUACCGAGGAACGACUUUCGCUGAAGGUGUCGUUGCAUUUCUGAUACUGCCCCAAGCUAAGAAGGACUUCUUCAGCUCACACCCCUUGAGAGAGCCGGUCAAUGCAACGGAGGACCCGUCGAGUGGCUAUUAUUCUACCACAAUUAGAUAUCAGGCUACCGGUUUUGGAACUAAUGAGACAGAGUACUUGUUCGAGGUUGACAAUUUGACCUACGUCCAACUUGAAUCAAGAUUCACACCACAGUUUCUGCUCCAGCUGAAUGAGACAAUAUAUGCAAGUGGGAAGAGGAGCAACACCACGGGAAAACUAAUUUGGAAGGUCAACCCCGAAAUUGAUACAACAAUCGGGGAGUGGGCCUUCAGGGAAACU-AAAAAAACCUCACUAGAAAAAUUCGCAGUGAAGAGUUGUCUUUCACAGCUGUAUCAAACGGACCCAAAAACAUCAGUGGUCAGAGUCCGGCGCGAACUUCUUCCGACCCAGAGACCAACACAACAAAUGAAGACCACAAAAUCAUGGCUUCAGAAAAUUCCUCUGCAAUGGUUCAAGUGCACAGUCAAGGAAGGAAAGCUGCAGUGUCGCAUCUGACAACCCUUGCCACAAUCUCCACGAGUCCUCAACCUCCCACAACCAAAACAGGUCCGGACAACAGCACCCAUAAUACACCCGUGUAUAAACUUGACAUCUCUGAGGCAACUCAAGUUGGACAACAUCACCGUAGAGCAGACAACGACAGCACAGCCUCCGACACUCCCCCCGCCACGACCGCAGCCGGACCCUUAAAAGCAGAGAACACCAACACGAGUAAGAGCGCUGACUCCCUGGACCUCGCCACCACGACAAGCCCCCAAAACUACAGCGAGACUGCUGGCAACAACAACACUCAUCACCAAGAUACCGGAGAAGAGAGUGCCAGCAGCGGGAAGCUAGGCUUAAUUACCAAUACUAUUGCUGGAGUAGCAGGACUGAUCACAGGCGGGAGAAGGACUCGAAGAGAAGUAAUUGUCAAUGCUCAACCCAAAUGCAACCCCAAUUUACAUUACUGGACUACUCAGGAUGAAGGUGCUGCAAUCGGAUUGGCCUGGAUACCAUAUUUCGGGCCAGCAGCCGAAGGAAUUUACACAGAGGGGCUAAUGCACAACCAAGAUGGUUUAAUCUGUGGGUUGAGGCAGCUGGCCAACGAAACGACUCAAGCUCUCCAACUGUUCCUGAGAGCCACAACUGAGCUGCGAACCUUUUCAAUCCUCAACCGUAAGGCAAUUGACUUCCUGCUGCAGCGAUGGGGUGGCACAUGCCACAUUUUGGGACCGGACUGCUGUAUCGAACCACAUGAUUGGACCAAGAACAUAACAGACAAAAUUGAUCAGAUUAUUCAUGAUUUUGUUGAUAAAACCCUUCCGGACCAGGGGGACAAUGACAAUUGGUGGACAGGAUGGAGACAAUGGAUACCGGCAGGUAUUGGAGUUACAGGUGUUAUAAUUGCAGUUAUCGCUUUAUUCUGUAUAUGCAAAUUUGUCUUUUAGUCUUUCUUCAGAUUGUUUCACGGCAAAACUCAACCUCAAAUCAAUGAAACUAGGAUUUAAUUAUAUGAAUCACUUGAAUCUAAGAUUACUUGACAAAUGAUAACAUAAUACACUGGAGCUUCAAACAUAGCCAAUGUGAUUCUAACUCCUUUAAACUCACAGUUAAUCAUAAACAAGGUUUGACAUCAAUCUAGCUAUAUCUUUAAGAAUGAUAAACUUGAUGAAGAUUAAGAAAAAGGUAAUCUUUCGAUUAUCUUUAGUCUUCAUCCUUGAUUCUACAAUCAUGACAGUUGUCUUUAAUGAAAAAGGAAAAAAGCCUUUUUAUUAAGUUGUAAUAAUCAGAUCUGCAAACCGGUAGAAUUUAGUUGUAACCUAACACACACAAAGCAUUGGUAAAAAAGUCAAUAGAAAUUUAAACAGUGAGUGCAGACAACUCUUAAAUGGAAGCUUCAUAUGAGAGAGGACGCCCCCGAGCUGCCAGACAGCAUUCAAGGGAUGGACACGACCACCAUGUUCGAGCACGAUCAUCAUCCAGAGAGAAUUAUCGAGGUGAGUACCGUCAAUCAAGGAGCGCCUCACAAGUGCGCGUUCCUACUGUAUUUCAUAAGAAGAGAGUUGAACCAUUAACAGUUCCUCCAGCACCUAAAGACAUAUGUCCGACCUUGAAAAAAGGAUUUUUGUGUGACAGUAGUUUUUGCAAAAAAGACCACCAGUUAGAAAGUUUAACUGAUAGGGAAUUACUCCUACUAAUCGCCCGUAAGACUUGUGGAUCAGUAGAACAACAAUUAAAUAUAACUGCACCCAAGGACUCGCGCUUAGCAAAUCCAACGGCUGAUGAUUUCCAGCAAGAGGAAGGUCCAAAAAUUACCUUGUUGACACUGAUCAAGACGGCAGAACACUGGGCGAGACAAGACAUCCGAACCAUAGAGGAUUCCAAAUUAAGGGCAUUGUUAACUCUAUGUGCUGUGAUGACGAGGAAAUUCUCAAAAUCCCAGCUGAGUCUUUUGUGUGAGACACACCUAAGGCGCGAAGGGCUUGGGCAAGAUCAGGCAGAACCCGUUCUCGAAGUAUAUCAACGAUUACACAGUGAUAAAGGAGGCAGUUUUGAAGCUGCACUAUGGCAACAAUGGGACCGACAAUCCCUAAUUAUGUUUAUCACUGCAUUCUUGAAUAUCGCUCUCCAGUUACCGUGUGAAAGUUCUGCUGUCGUUGUUUCAGGGUUAAGAACAUUGGUUCCUCAAUCAGAUAAUGAGGAAGCUUCAACCAACCCGGGGACAUGCUCAUGGUCUGAUGAGGGUACCCCUUAAUAAGGCUGACUAAAACACUAUAUAACCUUCUACUUGAUCACAAUACUCCGUAUACCUAUCAUCAUAUAUUUAAUCAAGACGAUAUCCUUUAAAACUUAUUCAGUACUAUAAUCACUCUCAUUUCAAAUUGAUAAGAUAUGCAUAAUUGCCUUAAUAUAUAAAGAGGUAUGAUAUAACCCAAACAUUGACCAAAGAAAAUCAUAAUCUCGUAUCGCUCGCAAUAUAACCUGCCAAGCAUACCUCUUGCACAAAGUGAUUCUUGUACACAAAUAAUGUUUGACUCUACAGGAGGUAGCAACGAUCCAUCUCAUCAAAAAAUAAGUAUUUUAUGAUUUACUAAUGAUCUCUUAAAAUAUUAAGAAAAACUGACGGAACAUAAAUUCUUUCUGCUUCAAGUUGUGGAGGAGGUCUAUGGUAUUCGCUAUUGUUAUAUUACAAUCAAUAACAAGCUUGUAAAAAUAUUGUUCUUGUUUCAGGAGGUAUAUUGUGACCGGAAAAGCUAAACUAAUGAUGAAGAUUAAUGCGGAGGUCUGAUGAGAAUAAACCUUAUUAUUCAGAUUAGGCCCCAAGAGGCAUUCUUCAUCUCCUUUUAGCAAAAUACUAUUUCAGGAUAGUCCAGCUAGUGACACGUCUUUUAGCUGUAUACCAGUUGCCCCUGAGAUACGCCACAAAAGUGUCUCUGAGCUAAAGUGGUCUGUACACAUCUCAUACAUUGUAUUAGGGGCAAUAAUAUCUAAUUGAACUUAGCCAUUUAAAAUUUAGUGCAUAAAUCUGGGCUAACUCCACCAGGUCAACUCCAUUGGCUGAAAAGAAGCCCACCUACAACGAACAUUACUUUGAGCGCCCUCACAAUUAAAAAAUAAGAGCGUCGUUCCAACAAUCGAGCGCAAGGUUACAAGGUUGAACUGAGAGUGUCUAGACAACAAAAUAUCGAUACUCCAGACACCAAGCAAGACCUGAG-AAAAAACCAUGGCCAAAGCUACGGGACGAUACAAUCUAAUAUCGCCCAAAAAGGACCUGGAGAAAGGGGUUGUCUUAAGCGACCUCUGUAACUUCUUAGUUAGUCAAACUAUUCAAGGGUGGAAAGUUUAUUGGGCUGGUAUUGAGUUUGAUGUGACUCACAAAGGAAUGGCCCUAUUGCAUAGACUGAAAACUAAUGACUUUGCCCCUGCAUGGUCAAUGACAAGGAACCUAUUUCCCCAUUUAUUUCAAAAUCCGAAUUCCACUAUUGAAUCACCGCUGUGGGCACUGAGAGUCAUCCUUGCAGCAGGGAUACAGGACCAGUUAAUUGACCAGUCUUUGAUUGAACCCUUAGCAGGAGCCCUUGGUCUGAUCUCUGAUUGGCUGCUAACAACCAACACUAACCAUUUCAACAUGCGAACACAACGUGUCAAGGAACAAUUGAGCCUAAAAAUGCUGUCGUUGAUUCGAUCCAAUAUUCUCAAGUUUAUUAACAAAUUGGAUGCUCUACAUGUCGUGAACUACAAUGGAUUAUUGAGCAGUAUUGAAAUUGGAACUCAAAAUCAUACAAUCAUCAUAACUCGAACUAACAUGGGUUUUCUGGUGGAGCUCCAAGAACCCGACAAAUCGGCAAUGAACCGCAAGAAGCCUGGGCCGGCGAAAUUUUCCCUCCUUCAUGAGUCCACACUGAAAGCAUUUACACAAGGGUCCUCGACACGAAUGCAAAGUUUAAUUCUUGAAUUCAAUAGCUCUCUUGCUAUCUAACUAAGAUGGAAUACUUCAUAUUGGGCUAACUCAUAUAUGCUGACUCAAUAGUUAACUUGACAUCUCUGCCUUCAUAAUCAGAUAUAUAAGCAUAAUAAAUAAAUACUCAUAUUUCUUGAUAAUUUGUUUAACCACAGAUAAAUCCUCACUGUAAGCCAGCUUCCAAGUUGACACCCUUACAAAAACCAGGACUCAGAAUCCCUCAAAUAAGAGAUUCCAAGACAACAUCAUAGAAUUGCUUUAUUAUAUUAAUAAGCAUUUUAUCACUAGAAAUCCAAUAUACGAAAUGGUUAAUUGUAACUAAACCCGCAGGUCAUGUGUGUUAGGUUUCACAAAUUAUAUAUAUUACUAACUCCAUACUCGUAACUAACAUUAGAUAAGUAGGUUAAGAAAAAAGCUUGAGGAAGAUUAAGAAAAACUGCUUAUUGGGUCUUUCCGUGUUUUAGAUGAAGCAGUUGACAUUCUUCCUCUUGAUAUUAAAUGGCUACACAACAUACCCAAUACCCAGACGCCAGGUUAUCAUCACCAAUUGUAUUGGACCAAUGUGACCUUGUCACUAGAGCUUGCGGGUUGUAUUCAUCAUACUCCCUUAAUCCGCAACUACGCAACUGUAAACUCCCGAAACAUAUAUACCGUUUAAAAUAUGAUGUAACUGUUACCAAGUUCUUAAGUGAUGUACCAGUGGCGACAUUGCCCAUAGAUUUCAUAGUCCCAAUUCUUCUCAAGGCACUAUCAGGCAAUGGGUUCUGUCCUGUUGAGCCGCGGUGCCAACAGUUCUUAGAUGAAAUUAUUAAGUACACAAUGCAAGAUGCUCUCUUCCUGAAAUAUUAUCUCAAAAAUGUGGGUGCUCAAGAAGACUGUGUUGAUGACCACUUUCAAGAAAAAAUCUUAUCUUCAAUUCAGGGCAAUGAAUUUUUACAUCAAAUGUUUUUCUGGUAUGACCUGGCUAUUUUAACUCGAAGGGGUAGAUUAAAUCGAGGAAACUCUAGAUCAACGUGGUUUGUUCAUGAUGAUUUAAUAGACAUCUUAGGCUAUGGGGACUAUGUUUUUUGGAAGAUCCCAAUUUCACUGUUACCACUGAACACACAAGGAAUCCCCCAUGCUGCUAUGGAUUGGUAUCAGACAUCAGUAUUCAAAGAAGCGGUUCAAGGGCAUACACACAUUGUUUCUGUUUCUACUGCCGAUGUCUUGAUAAUGUGCAAAGAUUUAAUUACAUGUCGAUUCAACACAACUCUAAUCUCAAAAAUAGCAGAGGUUGAGGACCCAGUUUGCUCUGAUUAUCCCAAUUUUAAGAUUGUGUCUAUGCUUUACCAGAGCGGAGAUUACUUACUCUCCAUAUUAGGGUCUGAUGGGUAUAAAAUCAUUAAGUUUCUCGAACCAUUGUGCUUGGCUAAAAUUCAAUUGUGCUCAAAGUACACCGAGAGGAAGGGCCGAUUCUUAACACAAAUGCAUUUAGCUGUAAAUCACACCCUGGAAGAAAUUACAGAAAUACGUGCACUAAAGCCUUCACAGGCUCACAAGAUCCGUGAAUUCCAUAGAACAUUGAUAAGGCUGGAGAUGACGCCACAACAACUUUGUGAGCUAUUUUCCAUACAAAAACACUGGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAUCCAAAAAGUUAAAAAACAUGCUACGGUGCUAAAAGCAUUACGCCCUAUCGUGAUUUUCGAGACAUAUUGUGUUUUUAAAUAUAGCAUUGCAAAACAUUAUUUUGAUAGUCAAGGAUCUUGGUACAGUGUUACCUCAGAUAGAAAUCUAACACCAGGUCUUAAUUCUUAUAUCAAAAGAAAUCAAUUCCCUCCGUUGCCAAUGAUUAAAGAACUGCUAUGGGAAUUUUACCACCUUGACCAUCCUCCACUUUUCUCAACCAAAAUUAUUAGUGACUUAAGUAUUUUUAUAAAAGACAGAGCUACUGCAGUAGAAAGGACAUGCUGGGAUGCAGUAUUCGAGCCUAAUGUUCUGGGAUAUAAUCCACCUCACAAAUUCAGUACCAAACGUGUACCGGAACAAUUUUUAGAGCAAGAAAACUUUUCUAUUGAGAAUGUUCUUUCCUACGCGCAAAAACUCGAGUAUCUACUACCACAAUAUCGGAAUUUUUCUUUCUCAUUGAAAGAGAAAGAGUUGAAUGUAGGUAGAACUUUCGGAAAAUUGCCUUAUCCGACUCGCAAUGUUCAAACACUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUUACGGAACGUGAACAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUCGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGGUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGCAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAUAUGCAUGUCAGUGAUUAUUAUAAUCCACCGCAUAACCUCACACUGGAAAAUCGAAACAACCCCCCUGAAGGGCCUAGUUCAUACAGGGGUCAUAUGGGAGGGAUUGAAGGACUGCAACAAAAACUCUGGACAAGUAUUUCAUGUGCUCAAAUUUCUUUAGUUGAAAUUAAGACUGGUUUUAAGUUGCGCUCAGCUGUGAUGGGUGACAAUCAGUGCAUUACCGUUUUAUCAGUCUUCCCCUUAGAGACUGAUGCAGACGAGCAGGAACAGAGCGCCGAGGACAAUGCAGCGAGGGUGGCCGCCAGCCUAGCAAAAGUUACAAGUGCCUGUGGAAUCUUUUUAAAACCUGAUGAAACAUUUGUACAUUCAGGUUUUAUCUAUUUUGGAAAAAAACAAUAUUUGAAUGGGGUCCAAUUGCCUCAGUCCCUUAAAACGGCUACAAGAAUGGCACCAUUGUCUGAUGCAAUUUUUGAUGAUCUUCAAGGGACCCUGGCUAGUAUAGGUACUGCUUUUGAGCGAUCCAUCUCUGAGACACGACAUAUCUUUCCUUGCAGAAUAACCGCAGCUUUCCAUACGUUCUUUUCGGUGAGAAUCUUGCAAUAUCAUCACCUCGGAUUUAAUAAAGGUUUUGACCUUGGACAGUUAACACUCGGCAAACCUCUGGAUUUCGGAACAAUAUCAUUGGCACUAGCGGUACCGCAGGUGCUUGGAGGGUUAUCCUUCUUGAAUCCUGAGAAAUGUUUCUACCGGAAUCUAGGAGAUCCAGUUACCUCAGGUUUAUUCCAGUUAAAAACUUAUCUCCGAAUGAUUGAGAUGGAUGAUUUAUUCUUACCUUUAAUUGCGAAGAACCCUGGGAACUGCACUGCCAUUGACUUUGUGCUAAAUCCUAGCGGAUUAAAUGUUCCUGGGUCGCAAGACUUAACUUCAUUUCUGCGCCAGAUUGUACGUAGGACUAUCACCCUAAGUGCGAAAAACAAACUUAUUAAUACCUUAUUUCAUGCAUCAGCUGACUUCGAAGACGAAAUGGUUUGUAAGUGGCUCUUAUCAUCAACUCCUGUUAUGAGUCGUUUCGCAGCCGAUAUAUUUUCACGCACGCCGAGCGGGAAGCGAUUGCAAAUUCUAGGAUACUUGGAAGGAACACGCACAUUAUUAGCCUCUAAGAUCAUCAACAAUAAUACAGAGACGCCGGUUUUGGACAGACUGAGGAAGAUAACAUUGCAAAGGUGGAGUCUAUGGUUUAGUUAUCUUGAUCAUUGUGAUAAUAUCCUGGCGGAGGCUUUAACCCAAAUAACUUGCACAGUUGAUUUAGCACAGAUCCUGAGGGAAUAUUCAUGGGCACAUAUUUUAGAGGGGAGACCUCUUAUUGGAGCCACACUCCCAUGUAUGAUUGAGCAAUUCAAAGUGGUUUGGCUGAAACCCUACGAACAAUGUCCGCAGUGUUCAAAUGCCAAGCAACCUGGUGGGAAACCAUUCGUGUCAGUAGCAGUCAAGAAACAUAUUGUUAGUGCAUGGCCAAAUGCAUCCCGAAUAAGCUGGACUAUCGGGGAUGGAAUCCCAUACAUUGGAUCAAGGACAGAAGAUAAGAUAGGGCAACCUGCUAUUAAACCAAAAUGUCCUUCCGCAGCCUUAAGAGAGGCCAUUGAAUUGGCGUCCCGUUUAACAUGGGUAACUCAAGGCAGUUCGAACAGUGACUUGCUAAUAAAACCAUUUUUGGAAGCACGAGUAAAUUUAAGUGUUCAAGAAAUACUUCAAAUGACCCCUUCACAUUACUCGGGAAAUAUUGUUCAUAGGUACAACGAUCAAUACAGUCCUCAUUCUUUCAUGGCCAAUCGUAUGAGUAACUCAGCAACGCGAUUGAUUGUUUCUACAAACACUUUAGGUGAGUUUUCAGGAGGUGGCCAAUCGGCACGCGACAGCAAUAUUAUUUUCCAGAAUGUUAUAAAUUAUGCAGUUGCACUGUUCGAUAUUAAAUUUAGAAACACUGAGGCUACAGAUAUCCAGUAUAAUCGUGCUCACCUUCAUCUAACUAAGUGUUGCACCCGGGAGGUACCAGCUCAGUAUUUAACAUACACAUCUACAUUGGAUUUAGAUUUAACAAGAUACCGAGAAAAUGAAUUGAUUUAUGACAAUAAUCCUCUAAAAGGAGGACUCAAUUGCAAUAUCUCAUUUGAUAACCCAUUUUUCCAAGGCAAACAGCUGAACAUUAUAGAAGAUGACCUUAUUCGACUGCCUCACUUAUCUGGAUGGGAGCUAGCUAAGACCAUCAUGCAAUCAAUUAUUUCAGAUAGCAAUAAUUCGUCUACAGACCCAAUUAGCAGUGGAGAAACAAGAUCAUUCACUACCCAUUUCUUAACUUAUCCCAAGAUAGGACUUCUGUACAGUUUUGGGGCCUUUGUAAGUUAUUAUCUUGGCAAUACAAUUCUUCGGACUAAGAAAUUAACACUUGACAAUUUUUUAUAUUACUUAACUACCCAAAUUCAUAAUCUACCACAUCGCUCAUUGCGAAUACUUAAGCCAACAUUCAAACAUGCAAGCGUUAUGUCACGAUUAAUGAGUAUUGAUCCCCAUUUUUCUAUUUACAUAGGCGGUGCUGCAGGUGACAGAGGACUCUCAGAUGCGGCCAGGUUAUUUUUGAGAACGUCCAUUUCAUCUUUUCUUACAUUUGUAAAGGAAUGGAUAAUUAAUCGCGGAACAAUUGUCCCUUUAUGGAUAGUAUAUCCAUUAGAGGGUCAAAAUCCAACACCUGUUAAUAAUUUCCUCCAUCAGAUCGUAGAACUGCUGGUGCAUGAUUCAUCAAGACACCAGGCUUUUAAAACUACCAUAAAUGAUCAUGUACAUCCUCACGACAAUCUUGUUUACACAUGUAAGAGUACAGCCAGCAAUUUCUUCCAUGCGUCAUUGGCGUACUGGAGGAGCAGGCACAGAAACAGCAACCGAAAAGACUUGACAAGAAACUCUUCAACUGGAUCAAGCACAAACAACAGUGAUGGUCAUAUUAAGAGAAGUCAAGAACAAACCACCAGAGAUCCACAUGAUGGCACUGAACGGAGUCUAGUCCUGCAAAUGAGCCAUGAAAUAAAAAGAACGACAAUUCCACAAGAGAACACGCACCAGGGUCCGUCGUUCCAGUCAUUUCUAAGUGACUCUGCUUGCGGUACAGCAAACCCAAAACUAAAUUUCGAUAGAUCGAGACACAAUGUGAAAUCUCAGGAUCAUAACUCAGCAUCCAAGAGGGAAGGUCAUCAAAUAAUCUCACAUCGUCUAGUCCUACCUUUCUUUACAUUAUCUCAAGGGACACGCCAAUUAACGUCAUCCAAUGAGUCACAAACCCAAGAUGAGAUAUCAAAGUACUUACGGCAAUUGAGAUCCGUCAUUGAUACCACAGUUUAUUGUAGGUUUACCGGUAUAGUCUCGUCCAUGCAUUACAAACUUGAUGAGGUCCUUUGGGAAAUAGAGAAUUUUAAGUCGGCUGUGACGCUGGCAGAGGGAGAAGGUGCUGGUGCCUUACUAUUGAUUCAGAAAUACCAAGUUAAGACCUUAUUUUUCAACACGCUAGCUACUGAGUCCAGUAUAGAGUCAGAAAUAGUAUCAGGAAUGACUACUCCUAGGAUGCUUCUACCUGUUAUGUCAAAAUUCCAUAAUGACCAAAUUGAGAUUAUUCUUAACAACUCAGCAAGCCAAAUAACAGACAUAACAAAUCCUACUUGGUUUAAAGACCAAAGAGCAAGGCUACCUAGGCAAGUCGAGGUUAUAACCAUGGAUGCAGAGACGACAGAGAAUAUAAACAGAUCGAAAUUGUACGAAGCUGUACAUAAAUUGAUCUUACACCAUGUUGAUCCCAGCGUAUUGAAAGCAGUGGUCCUUAAAGUCUUUCUAAGUGAUACCGAGGGUAUGUUAUGGCUAAAUGAUAAUCUAGCCCCGUUUUUUGCCACUGGGUAUUUAAUUAAGCCAAUAACGUCAAGUGCCAGGUCUAGUGAGUGGUAUCUUUGUCUGACGAACUUCUUAUCAACUACACGUAAGAUGCCACACCAAAACCAUCUCAGUUGUAAGCAGGUAAUACUUACGGCAUUGCAACUGCAAAUUCAACGGAGCCCAUACUGGCUAAGUCAUUUAACUCAGUAUGCUGACUGCGAUUUACAUUUAAGCUAUAUCCGCCUUGGUUUUCCAUCAUUAGAGAAAGUACUAUACCACAGGUAUAACCUUGUCGAUUCAAAAAGAGGUCCACUAGUCUCUGUCACUCAGCACUUAGCACAUCUUAGGGCAGAGAUUCGAGAAUUGACCAAUGAUUAUAAUCAACAGCGACAAAGUCGGACUCAAACAUAUCACUUUAUUCGUACUGCAAAAGGACGAAUCACAAAACUAGUCAAUGAUUAUUUAAAAUUCUUUCUUAUUGUACAAGCAUUAAAACAUAAUGGGACAUGGCAAGCUGAGUUUAAGAAAUUACCAGAGUUGAUUAGUGUGUGCAAUAGGUUCUAUCAUAUUAGAGAUUGUAAUUGUGAAGAACGUUUCUUAGUUCAAACCUUAUAUUUACAUAGAAUGCAGGAUUCUGAAGUUAAGCUUAUCGAAAGGCUGACAGGGCUUCUGAGUUUAUUUCCAGAUGGUCUCUACAGGUUCGAUUGAAUAACCGUGCAUAGUAUUUUGAUACUUGUAAAGGUUGGUUAUCAACAUACAGAUUAUAAAAAACUCAUAAAUUGCUCUCAUACAUCAUCUUGAUCUGAUUUCAAUAAAUAACUAUUUAGAUAACGAAAGGAGUCCUUACAUUAUACACUAUAUUUGGCCUCUCUCCCUGCGUGAUAAUCAAAAAAUUCACAAUACAGCAUGUGUGACAUAUUACUGCUGCAAUGAGUCUAACGCAACAUAAUAAACUCCGCACUCUUUAUAAUUAAGCUUUAACGAUAGGUCUGGGCUCAUAUUGUUAUUGAUAUAGUAAUGUUGUAUCAAUAUCUUGCCAGAUGGAAUAGUGCUUUGGUUGAUAACACGACUUCUUAAAACAAAACUGAUCUUUAAGAUUAAG-UUUUUUAUAAUUGUCAUUGCUUUAAUUUGUCGAUUUAAAAAUGGUGAUAGCCUUAAUCUUUGUGUAAAAUAAGAGAUUAGGUGUAAUAACUUUAACAUUUUUGUCUAGUAAGCUACUAUUCCAUUCAGAAUGAUAAAAUUAAAAGAAAAGACAUGACUGUAAAAUCAGAAAUACCUUCUUUACAAUAUAGCAGACUAGAUAAUAAUCUUCGUGUUAAUGAUAAUUAAGGCAUUGACCACGCUCAUCAGAAGGCUCACUAGAAUAAACGUUGCAAAAAGGAUCCCUGGAAAAAUGGUCGCACACAAAAAUUUAAAAAUAAAUCUAUUUCUUCUUUUUUGUGUGUCCA
;
end;
begin trees;
tree ML_tree = [&U] ('KJ660346|Makona-Kissidougou-C15|Guinea|2014-02-19':0.000105,'KJ660348|Makona-Gueckedou-C05|Guinea|2014-01-29':0.000159,('KJ660347|Makona-Gueckedou-C07|Guinea|2014-01-20':0.000053,((('KC242784|9_Luebo|DRC|2007':0.000158,'HQ613403|M-M|DRC|2007-08-31':0.0):0.000053,(('KC242790|5_Luebo|DRC|2007':0.000211,'KC242785|0_Luebo|DRC|2007':0.000159):0.000053,(('HQ613402|034-KS|DRC|2008-12-31':0.000532,('KC242788|43_Luebo|DRC|2007':0.000422,'KC242787|23_Luebo|DRC|2007':0.0):0.000053):0.0,('KC242786|1_Luebo|DRC|2007':0.000053,'KC242789|4_Luebo|DRC|2007':0.000106):0.000053):0.0):0.0):0.00932152,((('KF113529|Kelle_2|DRC|2003':0.000252,'KF113528|Kelle_1|DRC|2003':0.000746):0.00167559,('KC242800|Ilembe|Gabon|2002':0.000421,'KY471124|inoculum_strain_Gabon||Gabon|2001':0.0):0.000988):0.01137224,((('KR063671|Yambuku-Mayinga|DRC|1976-10-01':0.0,'KC242801|deRoover|DRC|1976':0.000053):0.0,('KC242791|Bonduni|DRC|1977':0.000053,'KM655246|Yambuku-Ecran|DRC|1976':0.000214):0.0):0.00454925,(((('KC242798|1Ikot|Gabon|1996':0.0,'KC242794|2Nza|Gabon|1996':0.0):0.00222768,('KC242792|Gabon|Gabon|1994':0.000795,('KC242793|1Eko|Gabon|1996':0.0,('KC242797|1Oba|Gabon|1996':0.0,'KC242795|1Mbie|Gabon|1996':0.0):0.0):0.00105948):0.000623):0.00406058,('KP271018|Lomela-Lokolia16|DRC|2014-08-20':0.0,('KM519951|Boende-Lokolia|DRC|2014':0.0,'KP271020|Lomela-Lokolia19|DRC|2014-08-20':0.000159):0.0):0.00365256):0.000552,(('KC242796|13625_Kikwit|DRC|1995':0.000053,'KC242799|13709_Kikwit|DRC|1995':0.0):0.000159,('KR824526|Zaire-199510621|DRC|1995':0.000106,('KR063672|Kikwit-807223|DRC|1995-04-01':0.0,('KU978803|Zaire-199510621|DRC|1995-04-01':0.0,'KR867676|Kikwit-9510621|DRC|1995-05-04':0.0):0.000053):0.0):0.000158):0.0033993):0.00367107):0.00535903):0.000247):0.02031253):0.0);
end;