New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Is it correct Adam file #1720

Closed
Rokshan2016 opened this Issue Sep 12, 2017 · 5 comments

Comments

Projects
2 participants
@Rokshan2016

Rokshan2016 commented Sep 12, 2017

Hi
I executed the following command

./adam-submit transformAlignments hdfs://hadoop-master:8020/user/rokshan.jahan/small.sam hdfs://hadoop-master:8020/user/rokshan.jahan/small.adam

It executed successfully. And small.adam contains following files

_common_metadata
_metadata
_processing.avro
_rgdict.avro
_seqdict.avro
_SUCCESS
part-r-00000.gz.parquet

Just want to make sure that this how the .adam looks like!

Thanks

@heuermh

This comment has been minimized.

Show comment
Hide comment
@heuermh

heuermh Sep 13, 2017

Member

That looks reasonable to me.

To confirm you can either read it back in with loadAlignments or use parquet-tools to inspect what is present on disk.

$ parquet-tools head small.adam/part-r-00000.gz.parquet 
readInFragment = 0
contigName = 1
start = 26472783
end = 26472858
mapq = 60
readName = simread:1:26472783:false
sequence = GTATAAGAGCAGCCTTATTCCTATTTATAATCAGGGTGAAACACCTGTGCCAATGCCAAGACAGGGGTGCCAAGA
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = true
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0	AS:i:75	NM:i:0

$ parquet-tools meta small.adam/part-r-00000.gz.parquet 
file:                      small.adam/part-r-00000.gz.parquet 
creator:                   parquet-mr version 1.8.2 (build c6522788629e590a53eb79874b95f6c3ff11f16c) 
extra:                     parquet.avro.schema = {"type":"record",...
file schema:               org.bdgenomics.formats.avro.AlignmentRecord 
--------------------------------------------------------------------------------
readInFragment:            OPTIONAL INT32 R:0 D:1
contigName:                OPTIONAL BINARY O:UTF8 R:0 D:1
start:                     OPTIONAL INT64 R:0 D:1
oldPosition:               OPTIONAL INT64 R:0 D:1
end:                       OPTIONAL INT64 R:0 D:1
mapq:                      OPTIONAL INT32 R:0 D:1
readName:                  OPTIONAL BINARY O:UTF8 R:0 D:1
sequence:                  OPTIONAL BINARY O:UTF8 R:0 D:1
qual:                      OPTIONAL BINARY O:UTF8 R:0 D:1
cigar:                     OPTIONAL BINARY O:UTF8 R:0 D:1
oldCigar:                  OPTIONAL BINARY O:UTF8 R:0 D:1
basesTrimmedFromStart:     OPTIONAL INT32 R:0 D:1
basesTrimmedFromEnd:       OPTIONAL INT32 R:0 D:1
readPaired:                OPTIONAL BOOLEAN R:0 D:1
properPair:                OPTIONAL BOOLEAN R:0 D:1
readMapped:                OPTIONAL BOOLEAN R:0 D:1
mateMapped:                OPTIONAL BOOLEAN R:0 D:1
failedVendorQualityChecks: OPTIONAL BOOLEAN R:0 D:1
duplicateRead:             OPTIONAL BOOLEAN R:0 D:1
readNegativeStrand:        OPTIONAL BOOLEAN R:0 D:1
mateNegativeStrand:        OPTIONAL BOOLEAN R:0 D:1
primaryAlignment:          OPTIONAL BOOLEAN R:0 D:1
secondaryAlignment:        OPTIONAL BOOLEAN R:0 D:1
supplementaryAlignment:    OPTIONAL BOOLEAN R:0 D:1
mismatchingPositions:      OPTIONAL BINARY O:UTF8 R:0 D:1
origQual:                  OPTIONAL BINARY O:UTF8 R:0 D:1
attributes:                OPTIONAL BINARY O:UTF8 R:0 D:1
recordGroupName:           OPTIONAL BINARY O:UTF8 R:0 D:1
recordGroupSample:         OPTIONAL BINARY O:UTF8 R:0 D:1
mateAlignmentStart:        OPTIONAL INT64 R:0 D:1
mateContigName:            OPTIONAL BINARY O:UTF8 R:0 D:1
inferredInsertSize:        OPTIONAL INT64 R:0 D:1

row group 1:               RC:20 TS:4114 OFFSET:4 
--------------------------------------------------------------------------------
readInFragment:             INT32 GZIP DO:0 FPO:4 SZ:98/58/0.59 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
contigName:                 BINARY GZIP DO:0 FPO:102 SZ:93/53/0.57 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
start:                      INT64 GZIP DO:0 FPO:195 SZ:180/209/1.16 VC:20 ENC:PLAIN,BIT_PACKED,RLE
oldPosition:                INT64 GZIP DO:0 FPO:375 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
end:                        INT64 GZIP DO:0 FPO:422 SZ:180/209/1.16 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mapq:                       INT32 GZIP DO:0 FPO:602 SZ:117/83/0.71 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
readName:                   BINARY GZIP DO:0 FPO:719 SZ:276/644/2.33 VC:20 ENC:PLAIN,BIT_PACKED,RLE
sequence:                   BINARY GZIP DO:0 FPO:995 SZ:733/1763/2.41 VC:20 ENC:PLAIN,BIT_PACKED,RLE
qual:                       BINARY GZIP DO:0 FPO:1728 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
cigar:                      BINARY GZIP DO:0 FPO:1775 SZ:99/59/0.60 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
oldCigar:                   BINARY GZIP DO:0 FPO:1874 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
basesTrimmedFromStart:      INT32 GZIP DO:0 FPO:1921 SZ:98/58/0.59 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
basesTrimmedFromEnd:        INT32 GZIP DO:0 FPO:2019 SZ:98/58/0.59 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
readPaired:                 BOOLEAN GZIP DO:0 FPO:2117 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
properPair:                 BOOLEAN GZIP DO:0 FPO:2171 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
readMapped:                 BOOLEAN GZIP DO:0 FPO:2225 SZ:56/36/0.64 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateMapped:                 BOOLEAN GZIP DO:0 FPO:2281 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
failedVendorQualityChecks:  BOOLEAN GZIP DO:0 FPO:2335 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
duplicateRead:              BOOLEAN GZIP DO:0 FPO:2389 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
readNegativeStrand:         BOOLEAN GZIP DO:0 FPO:2443 SZ:56/36/0.64 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateNegativeStrand:         BOOLEAN GZIP DO:0 FPO:2499 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
primaryAlignment:           BOOLEAN GZIP DO:0 FPO:2553 SZ:56/36/0.64 VC:20 ENC:PLAIN,BIT_PACKED,RLE
secondaryAlignment:         BOOLEAN GZIP DO:0 FPO:2609 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
supplementaryAlignment:     BOOLEAN GZIP DO:0 FPO:2663 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mismatchingPositions:       BINARY GZIP DO:0 FPO:2717 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
origQual:                   BINARY GZIP DO:0 FPO:2764 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
attributes:                 BINARY GZIP DO:0 FPO:2811 SZ:181/254/1.40 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
recordGroupName:            BINARY GZIP DO:0 FPO:2992 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
recordGroupSample:          BINARY GZIP DO:0 FPO:3039 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateAlignmentStart:         INT64 GZIP DO:0 FPO:3086 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateContigName:             BINARY GZIP DO:0 FPO:3133 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
inferredInsertSize:         INT64 GZIP DO:0 FPO:3180 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
Member

heuermh commented Sep 13, 2017

That looks reasonable to me.

To confirm you can either read it back in with loadAlignments or use parquet-tools to inspect what is present on disk.

$ parquet-tools head small.adam/part-r-00000.gz.parquet 
readInFragment = 0
contigName = 1
start = 26472783
end = 26472858
mapq = 60
readName = simread:1:26472783:false
sequence = GTATAAGAGCAGCCTTATTCCTATTTATAATCAGGGTGAAACACCTGTGCCAATGCCAAGACAGGGGTGCCAAGA
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = true
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0	AS:i:75	NM:i:0

$ parquet-tools meta small.adam/part-r-00000.gz.parquet 
file:                      small.adam/part-r-00000.gz.parquet 
creator:                   parquet-mr version 1.8.2 (build c6522788629e590a53eb79874b95f6c3ff11f16c) 
extra:                     parquet.avro.schema = {"type":"record",...
file schema:               org.bdgenomics.formats.avro.AlignmentRecord 
--------------------------------------------------------------------------------
readInFragment:            OPTIONAL INT32 R:0 D:1
contigName:                OPTIONAL BINARY O:UTF8 R:0 D:1
start:                     OPTIONAL INT64 R:0 D:1
oldPosition:               OPTIONAL INT64 R:0 D:1
end:                       OPTIONAL INT64 R:0 D:1
mapq:                      OPTIONAL INT32 R:0 D:1
readName:                  OPTIONAL BINARY O:UTF8 R:0 D:1
sequence:                  OPTIONAL BINARY O:UTF8 R:0 D:1
qual:                      OPTIONAL BINARY O:UTF8 R:0 D:1
cigar:                     OPTIONAL BINARY O:UTF8 R:0 D:1
oldCigar:                  OPTIONAL BINARY O:UTF8 R:0 D:1
basesTrimmedFromStart:     OPTIONAL INT32 R:0 D:1
basesTrimmedFromEnd:       OPTIONAL INT32 R:0 D:1
readPaired:                OPTIONAL BOOLEAN R:0 D:1
properPair:                OPTIONAL BOOLEAN R:0 D:1
readMapped:                OPTIONAL BOOLEAN R:0 D:1
mateMapped:                OPTIONAL BOOLEAN R:0 D:1
failedVendorQualityChecks: OPTIONAL BOOLEAN R:0 D:1
duplicateRead:             OPTIONAL BOOLEAN R:0 D:1
readNegativeStrand:        OPTIONAL BOOLEAN R:0 D:1
mateNegativeStrand:        OPTIONAL BOOLEAN R:0 D:1
primaryAlignment:          OPTIONAL BOOLEAN R:0 D:1
secondaryAlignment:        OPTIONAL BOOLEAN R:0 D:1
supplementaryAlignment:    OPTIONAL BOOLEAN R:0 D:1
mismatchingPositions:      OPTIONAL BINARY O:UTF8 R:0 D:1
origQual:                  OPTIONAL BINARY O:UTF8 R:0 D:1
attributes:                OPTIONAL BINARY O:UTF8 R:0 D:1
recordGroupName:           OPTIONAL BINARY O:UTF8 R:0 D:1
recordGroupSample:         OPTIONAL BINARY O:UTF8 R:0 D:1
mateAlignmentStart:        OPTIONAL INT64 R:0 D:1
mateContigName:            OPTIONAL BINARY O:UTF8 R:0 D:1
inferredInsertSize:        OPTIONAL INT64 R:0 D:1

row group 1:               RC:20 TS:4114 OFFSET:4 
--------------------------------------------------------------------------------
readInFragment:             INT32 GZIP DO:0 FPO:4 SZ:98/58/0.59 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
contigName:                 BINARY GZIP DO:0 FPO:102 SZ:93/53/0.57 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
start:                      INT64 GZIP DO:0 FPO:195 SZ:180/209/1.16 VC:20 ENC:PLAIN,BIT_PACKED,RLE
oldPosition:                INT64 GZIP DO:0 FPO:375 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
end:                        INT64 GZIP DO:0 FPO:422 SZ:180/209/1.16 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mapq:                       INT32 GZIP DO:0 FPO:602 SZ:117/83/0.71 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
readName:                   BINARY GZIP DO:0 FPO:719 SZ:276/644/2.33 VC:20 ENC:PLAIN,BIT_PACKED,RLE
sequence:                   BINARY GZIP DO:0 FPO:995 SZ:733/1763/2.41 VC:20 ENC:PLAIN,BIT_PACKED,RLE
qual:                       BINARY GZIP DO:0 FPO:1728 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
cigar:                      BINARY GZIP DO:0 FPO:1775 SZ:99/59/0.60 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
oldCigar:                   BINARY GZIP DO:0 FPO:1874 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
basesTrimmedFromStart:      INT32 GZIP DO:0 FPO:1921 SZ:98/58/0.59 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
basesTrimmedFromEnd:        INT32 GZIP DO:0 FPO:2019 SZ:98/58/0.59 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
readPaired:                 BOOLEAN GZIP DO:0 FPO:2117 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
properPair:                 BOOLEAN GZIP DO:0 FPO:2171 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
readMapped:                 BOOLEAN GZIP DO:0 FPO:2225 SZ:56/36/0.64 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateMapped:                 BOOLEAN GZIP DO:0 FPO:2281 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
failedVendorQualityChecks:  BOOLEAN GZIP DO:0 FPO:2335 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
duplicateRead:              BOOLEAN GZIP DO:0 FPO:2389 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
readNegativeStrand:         BOOLEAN GZIP DO:0 FPO:2443 SZ:56/36/0.64 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateNegativeStrand:         BOOLEAN GZIP DO:0 FPO:2499 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
primaryAlignment:           BOOLEAN GZIP DO:0 FPO:2553 SZ:56/36/0.64 VC:20 ENC:PLAIN,BIT_PACKED,RLE
secondaryAlignment:         BOOLEAN GZIP DO:0 FPO:2609 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
supplementaryAlignment:     BOOLEAN GZIP DO:0 FPO:2663 SZ:54/36/0.67 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mismatchingPositions:       BINARY GZIP DO:0 FPO:2717 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
origQual:                   BINARY GZIP DO:0 FPO:2764 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
attributes:                 BINARY GZIP DO:0 FPO:2811 SZ:181/254/1.40 VC:20 ENC:PLAIN_DICTIONARY,BIT_PACKED,RLE
recordGroupName:            BINARY GZIP DO:0 FPO:2992 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
recordGroupSample:          BINARY GZIP DO:0 FPO:3039 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateAlignmentStart:         INT64 GZIP DO:0 FPO:3086 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
mateContigName:             BINARY GZIP DO:0 FPO:3133 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
inferredInsertSize:         INT64 GZIP DO:0 FPO:3180 SZ:47/27/0.57 VC:20 ENC:PLAIN,BIT_PACKED,RLE
@Rokshan2016

This comment has been minimized.

Show comment
Hide comment
@Rokshan2016

Rokshan2016 Sep 13, 2017

ok, will try that

Rokshan2016 commented Sep 13, 2017

ok, will try that

@Rokshan2016

This comment has been minimized.

Show comment
Hide comment
@Rokshan2016

Rokshan2016 Sep 13, 2017

I tried & found the following , so it means it is working fine?

[rokshan.jahan@ parquet-mr]$ parquet-tools head /home/rokshan.jahan/project/small.adam/part-r-00000.gz.parquet
readInFragment = 0
contigName = 1
start = 26472783
end = 26472858
mapq = 60
readName = simread:1:26472783:false
sequence = GTATAAGAGCAGCCTTATTCCTATTTATAATCAGGGTGAAACACCTGTGCCAATGCCAAGACAGGGGTGCCAAGA
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = true
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 240997787
end = 240997862
mapq = 60
readName = simread:1:240997787:true
sequence = CTTTATTTTTATTTTTAAGGTTTTTTTTGTTTGTTTGTTTTGAGATGGAGTCTCGCTCCACCGCCCAGACTGGAG
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = false
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:39 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 189606653
end = 189606728
mapq = 60
readName = simread:1:189606653:true
sequence = TGTATCTTCCTCCCCTGCTGTATGTTTCCTGCCCTCAAACATCACACTCCACGTTCTTCAGCTTTAGGACTTGGA
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = false
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 207027738
end = 207027813
mapq = 60
readName = simread:1:207027738:true
sequence = TTTAATAAATGTTGATTGTCCTATTTAATTATTCTCAACTTTCCGATTTTATTTCCCATGTAACAGTGTTGTTTT
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = false
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 14397233
end = 14397308
mapq = 60
readName = simread:1:14397233:false
sequence = TAAAATGCCCCCATCTTCCCAGAGCTGCCAGCCCTCACAATGCCAACAGCTAAATGTACCCAAGTGTTACTGAAC
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = true
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

Rokshan2016 commented Sep 13, 2017

I tried & found the following , so it means it is working fine?

[rokshan.jahan@ parquet-mr]$ parquet-tools head /home/rokshan.jahan/project/small.adam/part-r-00000.gz.parquet
readInFragment = 0
contigName = 1
start = 26472783
end = 26472858
mapq = 60
readName = simread:1:26472783:false
sequence = GTATAAGAGCAGCCTTATTCCTATTTATAATCAGGGTGAAACACCTGTGCCAATGCCAAGACAGGGGTGCCAAGA
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = true
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 240997787
end = 240997862
mapq = 60
readName = simread:1:240997787:true
sequence = CTTTATTTTTATTTTTAAGGTTTTTTTTGTTTGTTTGTTTTGAGATGGAGTCTCGCTCCACCGCCCAGACTGGAG
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = false
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:39 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 189606653
end = 189606728
mapq = 60
readName = simread:1:189606653:true
sequence = TGTATCTTCCTCCCCTGCTGTATGTTTCCTGCCCTCAAACATCACACTCCACGTTCTTCAGCTTTAGGACTTGGA
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = false
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 207027738
end = 207027813
mapq = 60
readName = simread:1:207027738:true
sequence = TTTAATAAATGTTGATTGTCCTATTTAATTATTCTCAACTTTCCGATTTTATTTCCCATGTAACAGTGTTGTTTT
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = false
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

readInFragment = 0
contigName = 1
start = 14397233
end = 14397308
mapq = 60
readName = simread:1:14397233:false
sequence = TAAAATGCCCCCATCTTCCCAGAGCTGCCAGCCCTCACAATGCCAACAGCTAAATGTACCCAAGTGTTACTGAAC
cigar = 75M
basesTrimmedFromStart = 0
basesTrimmedFromEnd = 0
readPaired = false
properPair = false
readMapped = true
mateMapped = false
failedVendorQualityChecks = false
duplicateRead = false
readNegativeStrand = true
mateNegativeStrand = false
primaryAlignment = true
secondaryAlignment = false
supplementaryAlignment = false
attributes = XS:i:0 AS:i:75 NM:i:0

@heuermh

This comment has been minimized.

Show comment
Hide comment
@heuermh

heuermh Sep 13, 2017

Member

Yes, that looks ok!

Member

heuermh commented Sep 13, 2017

Yes, that looks ok!

@Rokshan2016

This comment has been minimized.

Show comment
Hide comment
@Rokshan2016

Rokshan2016 commented Sep 13, 2017

Thanks!

@heuermh heuermh added this to the 0.23.0 milestone Dec 7, 2017

@heuermh heuermh added this to Completed in Release 0.23.0 Jan 4, 2018

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment