New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Exception occurs when running tests on master #956

Closed
jpdna opened this Issue Feb 23, 2016 · 1 comment

Comments

Projects
None yet
2 participants
@jpdna
Member

jpdna commented Feb 23, 2016

On master, an exception is logged to the console when building with mvn mvn clean package
when running tests, as listed below. However, maven still reports full SUCCESS of the build.

- convert an RDD that has an bad read in it with loose validation
2016-02-23 16:17:47 WARN  MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-02-23 16:17:47 ERROR Executor:96 - Exception in task 1.0 in stage 0.0 (TID 1)
java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null})
    at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:42)
    at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:34)
    at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:57)
    at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:55)
    at scala.collection.Iterator$$anon$11.next(Iterator.scala:328)
    at org.apache.spark.util.Utils$.getIteratorSize(Utils.scala:1555)
    at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
    at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
    at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
    at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
    at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:66)
    at org.apache.spark.scheduler.Task.run(Task.scala:88)
    at org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:214)
    at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142)
    at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617)
    at java.lang.Thread.run(Thread.java:745)
Caused by: scala.MatchError: (D,Some(3)) (of class scala.Tuple2)
    at org.bdgenomics.adam.util.MdTag$.apply(MdTag.scala:71)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag$lzycompute(RichAlignmentRecord.scala:98)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag(RichAlignmentRecord.scala:96)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceBase$1(RichAlignmentRecord.scala:176)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceContext(RichAlignmentRecord.scala:192)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:213)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:211)
    at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
    at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
    at scala.collection.Iterator$class.foreach(Iterator.scala:727)
    at scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
    at scala.collection.IterableLike$class.foreach(IterableLike.scala:72)
    at scala.collection.AbstractIterable.foreach(Iterable.scala:54)
    at scala.collection.TraversableLike$class.map(TraversableLike.scala:244)
    at scala.collection.AbstractTraversable.map(Traversable.scala:105)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:211)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:200)
    at scala.collection.LinearSeqOptimized$class.foldLeft(LinearSeqOptimized.scala:111)
    at scala.collection.immutable.List.foldLeft(List.scala:84)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts$lzycompute(RichAlignmentRecord.scala:200)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts(RichAlignmentRecord.scala:198)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions$lzycompute(RichAlignmentRecord.scala:196)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions(RichAlignmentRecord.scala:196)
    at org.bdgenomics.adam.rich.DecadentRead.<init>(DecadentRead.scala:94)
    at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:38)
    ... 15 more
2016-02-23 16:17:47 WARN  TaskSetManager:71 - Lost task 1.0 in stage 0.0 (TID 1, localhost): java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null})
    at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:42)
    at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:34)
    at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:57)
    at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:55)
    at scala.collection.Iterator$$anon$11.next(Iterator.scala:328)
    at org.apache.spark.util.Utils$.getIteratorSize(Utils.scala:1555)
    at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
    at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
    at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
    at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
    at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:66)
    at org.apache.spark.scheduler.Task.run(Task.scala:88)
    at org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:214)
    at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1142)
    at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:617)
    at java.lang.Thread.run(Thread.java:745)
Caused by: scala.MatchError: (D,Some(3)) (of class scala.Tuple2)
    at org.bdgenomics.adam.util.MdTag$.apply(MdTag.scala:71)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag$lzycompute(RichAlignmentRecord.scala:98)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag(RichAlignmentRecord.scala:96)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceBase$1(RichAlignmentRecord.scala:176)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceContext(RichAlignmentRecord.scala:192)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:213)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:211)
    at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
    at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
    at scala.collection.Iterator$class.foreach(Iterator.scala:727)
    at scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
    at scala.collection.IterableLike$class.foreach(IterableLike.scala:72)
    at scala.collection.AbstractIterable.foreach(Iterable.scala:54)
    at scala.collection.TraversableLike$class.map(TraversableLike.scala:244)
    at scala.collection.AbstractTraversable.map(Traversable.scala:105)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:211)
    at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:200)
    at scala.collection.LinearSeqOptimized$class.foldLeft(LinearSeqOptimized.scala:111)
    at scala.collection.immutable.List.foldLeft(List.scala:84)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts$lzycompute(RichAlignmentRecord.scala:200)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts(RichAlignmentRecord.scala:198)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions$lzycompute(RichAlignmentRecord.scala:196)
    at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions(RichAlignmentRecord.scala:196)
    at org.bdgenomics.adam.rich.DecadentRead.<init>(DecadentRead.scala:94)
    at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:38)
    ... 15 more

@fnothaft

This comment has been minimized.

Show comment
Hide comment
@fnothaft

fnothaft Feb 23, 2016

Member

That exception gets thrown from hereabouts in a test that is checking that a requirement fires when enriching an RDD[AlignmentRecord] to RDD[DecadentRead]. This is expected behavior, but yes, it does occasionally cause one to do a doubletake.

Member

fnothaft commented Feb 23, 2016

That exception gets thrown from hereabouts in a test that is checking that a requirement fires when enriching an RDD[AlignmentRecord] to RDD[DecadentRead]. This is expected behavior, but yes, it does occasionally cause one to do a doubletake.

@fnothaft fnothaft closed this Feb 23, 2016

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment