Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Browse files

add a test case and stub for tests (not run yet)

svn path=/bioperl-dev/trunk/; revision=16883
  • Loading branch information...
commit b3c5eb8debd749a339f68ed01fc1758e059aae16 1 parent e287e51
cjfields authored
View
6 Bio/Tools/Primer3Redux.pm
@@ -76,6 +76,10 @@ the bugs and their resolution. Bug reports can be submitted via the web:
=head1 AUTHOR -
+ Chris Fields
+
+=head1 CONTRIBUTORS
+
Rob Edwards
redwards@utmem.edu
@@ -86,8 +90,6 @@ the bugs and their resolution. Bug reports can be submitted via the web:
bioinformatics1@dieselwurks.com
-=head1 CONTRIBUTORS
-
Brian Osborne bosborne at alum.mit.edu
=head1 APPENDIX
View
10 Bio/Tools/Run/Primer3Redux.pm
@@ -42,7 +42,7 @@ from the program primer3
-path => "/usr/bin/primer3_core");
# or after the fact you can change the program_name
- $primer3->program_name('my_suprefast_primer3');
+ $primer3->program_name('my_superfast_primer3');
unless ($primer3->executable) {
print STDERR "primer3 can not be found. Is it installed?\n";
@@ -106,8 +106,8 @@ web:
Chris Fields cjfields-at-bioperl-dot-org
-Largely refactored from the original Primer3 parser by Rob Edwards, which in
-turn was based heavily on work of Chad Matsalla
+Refactored from the original Primer3 parser by Rob Edwards, which in turn was
+based heavily on work of Chad Matsalla
bioinformatics1@dieselwurks.com
@@ -146,8 +146,8 @@ my $PROGRAMNAME;
my %PARAMS;
my @P1;
my @P2;
-# 2.0 is still in alpha (3/12/09), so fallback
-# to v1 for determining parameters
+
+# 2.0 is still in alpha (3/3/10), so fallback to v1 for determining parameters
my $DEFAULT_VERSION = '1.1.4';
BEGIN {
# $ct assigns order of parameter building
View
39 t/Tools/Run/Primer3Redux.t
@@ -0,0 +1,39 @@
+#-*-Perl-*-
+## $Id: Primer3.t 15574 2009-02-25 13:49:22Z cjfields $
+
+# tests for Bio::Tools::Run::Primer3Rerdux
+# originally written for Bio::Tools::Run::Primer3 by Rob Edwards
+
+use strict;
+use warnings;
+use Data::Dumper;
+
+BEGIN {
+ use Bio::Root::Test;
+ test_begin(-tests => 1);
+ use_ok('Bio::Tools::Run::Primer3Redux');
+}
+
+#use Bio::SeqIO;
+#
+#my ($seqio, $seq, $primer3, $args, $results, $num_results);
+#$seqio=Bio::SeqIO->new(-file => test_input_file('Primer3.fa'));
+#$seq=$seqio->next_seq;
+#
+## sequence is passed to run() now
+#ok $primer3 = Bio::Tools::Run::Primer3Redux->new();
+#
+#SKIP: {
+# test_skip(-requires_executable => $primer3,
+# -tests => 6);
+#
+# #$args = $primer3->arguments;
+# #is($$args{'PRIMER_SEQUENCE_ID'}, "(string, optional) an id. Optional. Note must be present if PRIMER_FILE_FLAG is set");
+# #ok $primer3->add_targets('PRIMER_SEQUENCE_ID'=>'test seq');
+# ok my $parser = $primer3->run($seq);
+# while (my $result = $parser->next_result) {
+# #is($results->number_of_results,5);
+# }
+# #is( $results->{input_options}->{PRIMER_SEQUENCE_ID},'test seq');
+# #like( $primer3->program_name, qr/primer3/, 'program_name');
+#}
View
4 t/data/Primer3.fa
@@ -0,0 +1,4 @@
+>Test1
+AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
+TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA
+TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
Please sign in to comment.
Something went wrong with that request. Please try again.