Permalink
Switch branches/tags
tag-ensembl-stable-061 start snapshot-at-head-of-07-branch release-ensembl-06 release-06 release-06-2 release-1_01 release-1-7-1 release-1-7-0 release-1-7-0-RC6 release-1-7-0-RC5 release-1-7-0-RC4 release-1-6-zenodo release-1-6-924 release-1-6-923 release-1-6-922 release-1-6-921 release-1-6-920 release-1-6-910 release-0-9-3 release-0-9-2 release-0-9-0 release-0-7-2 release-0-7-1 release-0-7-0 release-0-05 release-0-05-1 release-0-04-4 release-0-04-3 release-0-04-2 release-0-04-1 prerelease-06 ontology-overhaul-start ontology-overhaul-end ontology-fix1 lightweight_feature join-0-04-to-0-05 gbrowse_1_65 for_gmod_0_003 bioperl-run-release-1-2-0 bioperl-release-1-6 bioperl-release-1-6-901 bioperl-release-1-6-9 bioperl-release-1-6-1 bioperl-release-1-5-2 bioperl-release-1-5-2-patch2 bioperl-release-1-5-2-patch1 bioperl-release-1-5-1 bioperl-release-1-5-1-rc4 bioperl-release-1-5-0 bioperl-release-1-5-0-rc2 bioperl-release-1-5-0-rc1 bioperl-release-1-4-0 bioperl-release-1-2-3 bioperl-release-1-2-2 bioperl-release-1-2-1 bioperl-release-1-2-0 bioperl-release-1-1-0 bioperl-release-1-0-2 bioperl-release-1-0-1 bioperl-release-1-0-0 bioperl-devel-1-3-04 bioperl-devel-1-3-03 bioperl-devel-1-3-02 bioperl-devel-1-3-01 bioperl-devel-1-1-1 bioperl-061-pre1 bioperl-06-1 bioperl-1-6-RC4 bioperl-1-6-RC3_15392 bioperl-1-6-RC3 bioperl-1-6-RC2_15306 bioperl-1-6-RC2 bioperl-1-6-RC1 bioperl-1-6-0_006 bioperl-1-6-0_005 bioperl-1-6-0_004 bioperl-1-6-0_003 bioperl-1-6-0_002 bioperl-1-6-0_001 bioperl-1-2-1-rc1 bioperl-1-0-alpha2-rc bioperl-1-0-alpha bioperl-1-0-0 before-05-to-06-trunk before-05-to-06-merge after004 after-05-06-merge after-05-06-merge-2
Nothing to show
Find file
4017a48 Jul 29, 2010
@trutane @rbuels
executable file 53 lines (34 sloc) 1.14 KB
#!/usr/bin/perl
# PROGRAM : rev_and_trans.pl
# PURPOSE : Simple driver for Bio::Seq revcom and translate
# AUTHOR : Ewan Birney birney@sanger.ac.uk
# CREATED : Tue Oct 27 1998
#
# INSTALLATION
# If you have installed bioperl using the standard
# makefile system everything should be fine and
# dandy.
#
# if not edit the use lib "...." line to point the directory
# containing your Bioperl modules.
#
use Bio::Seq;
use Bio::SeqIO;
# new sequence from raw memory...
# it is *very* important to get the type right so it
# is translated correctly.
$seq = Bio::Seq->new ( -id => "myseq",
-seq => "CGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCT",
-type => 'Dna');
$seqout = Bio::SeqIO->new('-format' => 'fasta', -fh => \*STDOUT);
# make a reverse complement sequence
$rev = $seq->revcom();
# the actual sequence is here
$actual_bases = $rev->seq();
print "Reversed sequence as a string is [$actual_bases]\n";
# we could also write it as fasta formatted output
$seqout->write_seq($rev);
# make a translation
$trans = $seq->translate();
print "Translated sequence!\n";
$seqout->write_seq($trans);