Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Browse files

From Paul Cantalupo (IRC: virushunter). Fixes bug #3298, adds 3 tests.

  • Loading branch information...
commit 4e947ea831537a1212cbdb3e494ded9669b7c2a9 1 parent c4aaee1
Jay Hannah jhannah authored
2  Bio/SearchIO/blast.pm
View
@@ -1272,8 +1272,8 @@ sub next_result {
last;
}
elsif (/^Query=/) {
- $self->_pushback($reportline) if $reportline;
$self->_pushback($_);
+ $self->_pushback($reportline) if $reportline;
last PARSER;
}
12 t/SearchIO/blast.t
View
@@ -8,7 +8,7 @@ BEGIN {
use lib '.';
use Bio::Root::Test;
- test_begin(-tests => 1354);
+ test_begin(-tests => 1357);
use_ok('Bio::SearchIO');
}
@@ -2201,3 +2201,13 @@ is( $hsp->start('query'), 3255 );
is( $hsp->start('sbjct'), 128516 );
is( $hsp->end('query'), 5720 );
is( $hsp->end('sbjct'), 131000 );
+
+# testing for Bug #3298
+$searchio = Bio::SearchIO->new(
+ '-format' => 'blast',
+ '-file' => test_input_file('multiresult_blastn+.bls')
+);
+
+is ($searchio->next_result->algorithm_version, '2.2.25+', "testing Bug 3298");
+is ($searchio->next_result->algorithm_version, '2.2.25+', "testing Bug 3298");
+is ($searchio->next_result->algorithm_version, '2.2.25+', "testing Bug 3298");
584 t/data/multiresult_blastn+.bls
View
@@ -0,0 +1,584 @@
+BLASTN 2.2.25+
+
+
+Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
+Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
+Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
+protein database search programs", Nucleic Acids Res. 25:3389-3402.
+
+
+
+Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
+GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
+ 14,049,258 sequences; 36,075,095,184 total letters
+
+
+
+Query= GFAVMM201BADC0
+
+Length=477
+ Score E
+Sequences producing significant alignments: (Bits) Value
+
+gi|194750627|ref|XM_001957596.1| Drosophila ananassae GF23929 (D... 42.8 2.1
+gi|118568029|gb|CP000325.1| Mycobacterium ulcerans Agy99, comple... 42.8 2.1
+gi|24395301|emb|AL928579.6| Mouse DNA sequence from clone RP23-3... 42.8 2.1
+gi|326411376|gb|CP002568.1| Polymorphum gilvum SL003B-26A1, comp... 41.0 7.4
+gi|317165637|gb|CP002447.1| Mesorhizobium ciceri biovar biserrul... 41.0 7.4
+gi|312283773|gb|AC243242.1| Panicum virgatum clone PV_ABa051-K05... 41.0 7.4
+gi|303315262|ref|XM_003067593.1| Coccidioides posadasii C735 del... 41.0 7.4
+gi|297153409|gb|CP002047.1| Streptomyces bingchenggensis BCW-1, ... 41.0 7.4
+gi|295434944|gb|CP002013.1| Burkholderia sp. CCGE1002 chromosome... 41.0 7.4
+gi|283945692|gb|CP001854.1| Conexibacter woesei DSM 14684, compl... 41.0 7.4
+gi|194346582|gb|CP001111.1| Stenotrophomonas maltophilia R551-3,... 41.0 7.4
+gi|166857509|gb|CP000926.1| Pseudomonas putida GB-1, complete ge... 41.0 7.4
+gi|148498119|gb|CP000699.1| Sphingomonas wittichii RW1, complete... 41.0 7.4
+
+
+>gi|194750627|ref|XM_001957596.1| Drosophila ananassae GF23929 (Dana\GF23929), mRNA
+Length=1641
+
+ Score = 42.8 bits (46), Expect = 2.1
+ Identities = 37/45 (83%), Gaps = 1/45 (2%)
+ Strand=Plus/Plus
+
+Query 236 ACGCCGACGACAAGCGGCGAGTCCCTTGTGGACGATCTCGGCCAC 280
+ |||||||||||||| ||||||||| || |||| |||| ||||
+Sbjct 137 ACGCCGACGACAAG-GGCGAGTCCATTTGGGACTTTCTCACCCAC 180
+
+
+>gi|118568029|gb|CP000325.1| Mycobacterium ulcerans Agy99, complete genome
+Length=5631606
+
+ Score = 42.8 bits (46), Expect = 2.1
+ Identities = 36/43 (84%), Gaps = 1/43 (2%)
+ Strand=Plus/Minus
+
+Query 69 CCATGACTGCCGGCAGAACATCGACCGGCCAG-TATGTCGGCC 110
+ ||||| ||||||||||||| |||| || || | |||| |||||
+Sbjct 890715 CCATGTCTGCCGGCAGAACTTCGAGCGACCCGATATGGCGGCC 890673
+
+
+>gi|24395301|emb|AL928579.6| Mouse DNA sequence from clone RP23-302M15 on chromosome 4, complete
+sequence
+Length=184057
+
+ Score = 42.8 bits (46), Expect = 2.1
+ Identities = 31/35 (89%), Gaps = 1/35 (2%)
+ Strand=Plus/Plus
+
+Query 437 AGCTGCAACATGAATGTGCTCGCAGATCTTCAGGA 471
+ |||||||||||| ||||||| ||||| |||| |||
+Sbjct 146437 AGCTGCAACATGGATGTGCTAGCAGA-CTTCTGGA 146470
+
+
+>gi|326411376|gb|CP002568.1| Polymorphum gilvum SL003B-26A1, complete genome
+Length=4649365
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 33/40 (83%), Gaps = 0/40 (0%)
+ Strand=Plus/Plus
+
+Query 238 GCCGACGACAAGCGGCGAGTCCCTTGTGGACGATCTCGGC 277
+ ||||||||| ||||||||||| | ||| |||| |||||
+Sbjct 2023755 GCCGACGACGCGCGGCGAGTCCGTGGTGCTCGATGTCGGC 2023794
+
+
+>gi|317165637|gb|CP002447.1| Mesorhizobium ciceri biovar biserrulae WSM1271, complete genome
+Length=6264489
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 22/22 (100%), Gaps = 0/22 (0%)
+ Strand=Plus/Plus
+
+Query 300 TTGATGCCGAGGCGGATGCCAT 321
+ ||||||||||||||||||||||
+Sbjct 4510008 TTGATGCCGAGGCGGATGCCAT 4510029
+
+
+>gi|312283773|gb|AC243242.1| Panicum virgatum clone PV_ABa051-K05, complete sequence
+Length=161398
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 28/32 (88%), Gaps = 0/32 (0%)
+ Strand=Plus/Plus
+
+Query 271 TCTCGGCCACCTGTTTGAGTGGTATTCTTTTG 302
+ ||| |||||||||||||||| ||||| || ||
+Sbjct 137850 TCTTGGCCACCTGTTTGAGTTGTATTTTTCTG 137881
+
+
+>gi|303315262|ref|XM_003067593.1| Coccidioides posadasii C735 delta SOWgp Sugar transporter family
+protein, mRNA
+Length=1947
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 31/37 (84%), Gaps = 0/37 (0%)
+ Strand=Plus/Minus
+
+Query 289 GTGGTATTCTTTTGATGCCGAGGCGGATGCCATTGCA 325
+ ||||| ||| | ||||||||||||| | ||| |||||
+Sbjct 84 GTGGTCTTCATATGATGCCGAGGCGTAAGCCTTTGCA 48
+
+
+>gi|297153409|gb|CP002047.1| Streptomyces bingchenggensis BCW-1, complete genome
+Length=11936683
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 27/30 (90%), Gaps = 0/30 (0%)
+ Strand=Plus/Plus
+
+Query 38 GTCGGCAGCGGATCTCCGAAAACCATCAAG 67
+ |||||||||||| ||||||| ||||||||
+Sbjct 3073377 GTCGGCAGCGGAACTCCGAATTCCATCAAG 3073406
+
+
+>gi|295434944|gb|CP002013.1| Burkholderia sp. CCGE1002 chromosome 1, complete sequence
+Length=3518940
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 33/40 (83%), Gaps = 0/40 (0%)
+ Strand=Plus/Minus
+
+Query 212 ATGGGCGAATCGATCACCTTCAACACGCCGACGACAAGCG 251
+ || |||||||||||| | |||||||||| | ||| ||||
+Sbjct 2243828 ATCGGCGAATCGATCGCGTTCAACACGCTGGCGATGAGCG 2243789
+
+
+>gi|283945692|gb|CP001854.1| Conexibacter woesei DSM 14684, complete genome
+Length=6359369
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 35/43 (82%), Gaps = 3/43 (6%)
+ Strand=Plus/Minus
+
+Query 101 TATGTCGGCCATGGCTTCTACAGTCCGGACATGATCGACGGCG 143
+ ||||||||||| | ||||||| ||| || || |||||||||
+Sbjct 2039361 TATGTCGGCCACGACTTCTAC---CCGAACCTGGTCGACGGCG 2039322
+
+
+>gi|194346582|gb|CP001111.1| Stenotrophomonas maltophilia R551-3, complete genome
+Length=4573969
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 32/36 (89%), Gaps = 2/36 (5%)
+ Strand=Plus/Minus
+
+Query 102 ATGTCGGCCATGGC-TTCTACAGTCCGGACATGATC 136
+ |||||||||||||| || |||| ||||||||||||
+Sbjct 3897524 ATGTCGGCCATGGCGTTGCACAG-CCGGACATGATC 3897490
+
+
+>gi|166857509|gb|CP000926.1| Pseudomonas putida GB-1, complete genome
+Length=6078430
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 35/41 (86%), Gaps = 2/41 (4%)
+ Strand=Plus/Minus
+
+Query 222 CGATCACCTTCAACACG-CCGACGACAAGCGGCGAGTCCCT 261
+ ||||||||||| ||||| ||||||| ||||| | |||| ||
+Sbjct 5087565 CGATCACCTTCGACACGTCCGACGA-AAGCGCCAAGTCGCT 5087526
+
+
+>gi|148498119|gb|CP000699.1| Sphingomonas wittichii RW1, complete genome
+Length=5382261
+
+ Score = 41.0 bits (44), Expect = 7.4
+ Identities = 32/38 (85%), Gaps = 3/38 (7%)
+ Strand=Plus/Plus
+
+Query 208 GACGATG---GGCGAATCGATCACCTTCAACACGCCGA 242
+ ||||||| |||| |||||||||||||| |||||||
+Sbjct 4265124 GACGATGTGGGGCGGCTCGATCACCTTCAAGACGCCGA 4265161
+
+
+
+Lambda K H
+ 0.634 0.408 0.912
+
+Gapped
+Lambda K H
+ 0.625 0.410 0.780
+
+Effective search space used: 15727850050068
+
+
+Query= GFAVMM201A1JOH
+
+Length=57
+ Score E
+Sequences producing significant alignments: (Bits) Value
+
+gi|22416007|emb|AL772315.4| Mouse DNA sequence from clone RP23-5... 41.0 0.42
+gi|117168385|gb|AC190175.4| Pan troglodytes BAC clone CH251-542A... 39.2 1.5
+gi|45238691|gb|AC145377.2| Pan troglodytes BAC clone RP43-11P19 ... 39.2 1.5
+gi|4926907|gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from... 39.2 1.5
+gi|31414500|emb|AL831797.4| Oryza sativa chromosome 12, . BAC OS... 39.2 1.5
+gi|158967071|gb|CP000033.3| Lactobacillus acidophilus NCFM, comp... 37.4 5.1
+
+
+>gi|22416007|emb|AL772315.4| Mouse DNA sequence from clone RP23-54A13 on chromosome 4, complete
+sequence
+Length=200266
+
+ Score = 41.0 bits (44), Expect = 0.42
+ Identities = 28/31 (91%), Gaps = 2/31 (6%)
+ Strand=Plus/Minus
+
+Query 6 CGTTCCAGTCACGATACATACCAATAACGAC 36
+ ||||||||| | ||||||||||||||||||
+Sbjct 26821 CGTTCCAGTGA--ATACATACCAATAACGAC 26793
+
+
+>gi|117168385|gb|AC190175.4| Pan troglodytes BAC clone CH251-542A7 from chromosome 7, complete
+sequence
+Length=214222
+
+ Score = 39.2 bits (42), Expect = 1.5
+ Identities = 26/29 (90%), Gaps = 0/29 (0%)
+ Strand=Plus/Minus
+
+Query 19 ATACATACCAATAACGACTTCTATATGTA 47
+ |||||||||||||| | |||||||||||
+Sbjct 166678 ATACATACCAATAAATATTTCTATATGTA 166650
+
+
+>gi|45238691|gb|AC145377.2| Pan troglodytes BAC clone RP43-11P19 from chromosome 7, complete
+sequence
+Length=194463
+
+ Score = 39.2 bits (42), Expect = 1.5
+ Identities = 26/29 (90%), Gaps = 0/29 (0%)
+ Strand=Plus/Plus
+
+Query 19 ATACATACCAATAACGACTTCTATATGTA 47
+ |||||||||||||| | |||||||||||
+Sbjct 192749 ATACATACCAATAAATATTTCTATATGTA 192777
+
+
+>gi|4926907|gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from 7, complete sequence
+Length=139949
+
+ Score = 39.2 bits (42), Expect = 1.5
+ Identities = 26/29 (90%), Gaps = 0/29 (0%)
+ Strand=Plus/Minus
+
+Query 19 ATACATACCAATAACGACTTCTATATGTA 47
+ |||||||||||||| | |||||||||||
+Sbjct 12654 ATACATACCAATAAATATTTCTATATGTA 12626
+
+
+>gi|31414500|emb|AL831797.4| Oryza sativa chromosome 12, . BAC OSJNBa0010M16 of library OSJNBa
+from chromosome 12 of cultivar Nipponbare of ssp. japonica
+of Oryza sativa (rice), complete sequence
+Length=132741
+
+ Score = 39.2 bits (42), Expect = 1.5
+ Identities = 23/24 (96%), Gaps = 0/24 (0%)
+ Strand=Plus/Plus
+
+Query 18 GATACATACCAATAACGACTTCTA 41
+ ||||||||||||||| ||||||||
+Sbjct 126346 GATACATACCAATAAAGACTTCTA 126369
+
+
+>gi|158967071|gb|CP000033.3| Lactobacillus acidophilus NCFM, complete genome
+Length=1993560
+
+ Score = 37.4 bits (40), Expect = 5.1
+ Identities = 20/20 (100%), Gaps = 0/20 (0%)
+ Strand=Plus/Minus
+
+Query 14 TCACGATACATACCAATAAC 33
+ ||||||||||||||||||||
+Sbjct 756012 TCACGATACATACCAATAAC 755993
+
+
+
+Lambda K H
+ 0.634 0.408 0.912
+
+Gapped
+Lambda K H
+ 0.625 0.410 0.780
+
+Effective search space used: 890637973200
+
+
+Query= GFAVMM201D933Z
+
+Length=119
+ Score E
+Sequences producing significant alignments: (Bits) Value
+
+gi|332189094|gb|CP002684.1| Arabidopsis thaliana chromosome 1, c... 41.0 1.4
+gi|313747610|gb|AC237431.3| Macaca mulatta Y Chr BAC RMAEX-106G5... 41.0 1.4
+gi|168693784|gb|AC213321.3| MACACA MULATTA BAC clone CH250-541A1... 41.0 1.4
+gi|8778954|gb|AC007932.3|F11A17 Arabidopsis thaliana chromosome ... 41.0 1.4
+gi|256052438|ref|XM_002569731.1| Schistosoma mansoni GTP-binding... 39.2 5.0
+gi|238867551|gb|CP001600.1| Edwardsiella ictaluri 93-146, comple... 39.2 5.0
+gi|224465197|ref|NG_009929.1| Homo sapiens like-glycosyltransfer... 39.2 5.0
+gi|147784643|emb|AM469007.2| Vitis vinifera contig VV78X098884.1... 39.2 5.0
+gi|123663234|emb|AM455601.1| Vitis vinifera, whole genome shotgu... 39.2 5.0
+gi|118344518|gb|AC192748.2| Gallus gallus BAC clone CH261-166H21... 39.2 5.0
+gi|90309320|gb|AY607844.2| Edwardsiella ictaluri transposase-lik... 39.2 5.0
+gi|55908997|gb|AC102414.8| Mus musculus chromosome 15, clone RP2... 39.2 5.0
+gi|72096292|gb|AC162857.5| Mus musculus chromosome 15, clone RP2... 39.2 5.0
+gi|22415845|emb|AL139016.8| Human DNA sequence from clone RP4-65... 39.2 5.0
+gi|6572307|emb|Z82173.2| Human DNA sequence from clone SC22CB-1D... 39.2 5.0
+gi|56410822|gb|AC140454.4| Mus musculus BAC clone RP24-163I14 fr... 39.2 5.0
+gi|38707373|emb|BX255930.3| Zebrafish DNA sequence from clone DK... 39.2 5.0
+
+
+>gi|332189094|gb|CP002684.1| Arabidopsis thaliana chromosome 1, complete sequence
+Length=30427671
+
+ Score = 41.0 bits (44), Expect = 1.4
+ Identities = 25/27 (93%), Gaps = 0/27 (0%)
+ Strand=Plus/Minus
+
+Query 70 AACAGAAACCACTACGAAAGGAAAGAA 96
+ ||||||||| ||||||||||||||||
+Sbjct 17871124 AACAGAAACTTCTACGAAAGGAAAGAA 17871098
+
+
+>gi|313747610|gb|AC237431.3| Macaca mulatta Y Chr BAC RMAEX-106G5 complete sequence
+Length=169910
+
+ Score = 41.0 bits (44), Expect = 1.4
+ Identities = 28/31 (91%), Gaps = 2/31 (6%)
+ Strand=Plus/Minus
+
+Query 75 AAACCACTACGAAAGGAAAGAAATGCCTCTA 105
+ |||||| ||||||||||| |||||||||||
+Sbjct 60448 AAACCA--ACGAAAGGAAATAAATGCCTCTA 60420
+
+
+>gi|168693784|gb|AC213321.3| MACACA MULATTA BAC clone CH250-541A11 from chromosome y, complete
+sequence
+Length=156689
+
+ Score = 41.0 bits (44), Expect = 1.4
+ Identities = 28/31 (91%), Gaps = 2/31 (6%)
+ Strand=Plus/Plus
+
+Query 75 AAACCACTACGAAAGGAAAGAAATGCCTCTA 105
+ |||||| ||||||||||| |||||||||||
+Sbjct 62327 AAACCA--ACGAAAGGAAATAAATGCCTCTA 62355
+
+
+>gi|8778954|gb|AC007932.3|F11A17 Arabidopsis thaliana chromosome 1 BAC F11A17 sequence, complete
+sequence
+Length=102078
+
+ Score = 41.0 bits (44), Expect = 1.4
+ Identities = 25/27 (93%), Gaps = 0/27 (0%)
+ Strand=Plus/Plus
+
+Query 70 AACAGAAACCACTACGAAAGGAAAGAA 96
+ ||||||||| ||||||||||||||||
+Sbjct 32940 AACAGAAACTTCTACGAAAGGAAAGAA 32966
+
+
+>gi|256052438|ref|XM_002569731.1| Schistosoma mansoni GTP-binding protein era, putative (Smp_164220)
+mRNA, complete cds
+Length=1341
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 21/21 (100%), Gaps = 0/21 (0%)
+ Strand=Plus/Minus
+
+Query 40 TTCTCTTTTCGTATTTGGAAC 60
+ |||||||||||||||||||||
+Sbjct 159 TTCTCTTTTCGTATTTGGAAC 139
+
+
+>gi|238867551|gb|CP001600.1| Edwardsiella ictaluri 93-146, complete genome
+Length=3812315
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 31/37 (84%), Gaps = 3/37 (8%)
+ Strand=Plus/Plus
+
+Query 58 AACAGCTGTTATA---ACAGAAACCACTACGAAAGGA 91
+ |||||| |||||| ||| ||||||||||| |||||
+Sbjct 1978968 AACAGCCGTTATATCCACATAAACCACTACGCAAGGA 1979004
+
+
+>gi|224465197|ref|NG_009929.1| Homo sapiens like-glycosyltransferase (LARGE), RefSeqGene on
+chromosome 22
+Length=654355
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 30/36 (84%), Gaps = 0/36 (0%)
+ Strand=Plus/Plus
+
+Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAATGCC 101
+ ||| ||||||||||| || |||||||| ||| |||
+Sbjct 603836 TTAAAACAGAAACCAAAACCAAAGGAAAAAAAAGCC 603871
+
+
+>gi|147784643|emb|AM469007.2| Vitis vinifera contig VV78X098884.11, whole genome shotgun sequence
+Length=7756
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 24/26 (93%), Gaps = 0/26 (0%)
+ Strand=Plus/Minus
+
+Query 71 ACAGAAACCACTACGAAAGGAAAGAA 96
+ ||| |||||||||| |||||||||||
+Sbjct 6827 ACAAAAACCACTACAAAAGGAAAGAA 6802
+
+
+>gi|123663234|emb|AM455601.1| Vitis vinifera, whole genome shotgun sequence, contig VV78X123660.5,
+clone ENTAV 115
+Length=34741
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 24/26 (93%), Gaps = 0/26 (0%)
+ Strand=Plus/Plus
+
+Query 71 ACAGAAACCACTACGAAAGGAAAGAA 96
+ ||| |||||||||| |||||||||||
+Sbjct 34120 ACAAAAACCACTACAAAAGGAAAGAA 34145
+
+
+>gi|118344518|gb|AC192748.2| Gallus gallus BAC clone CH261-166H21 from chromosome z, complete
+sequence
+Length=226699
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 27/31 (88%), Gaps = 0/31 (0%)
+ Strand=Plus/Plus
+
+Query 58 AACAGCTGTTATAACAGAAACCACTACGAAA 88
+ ||||||||| |||||||||||| || ||||
+Sbjct 178051 AACAGCTGTCATAACAGAAACCCATATGAAA 178081
+
+
+>gi|90309320|gb|AY607844.2| Edwardsiella ictaluri transposase-like protein gene, complete
+cds; urease operon, complete sequence; and ammonium transporter
+(amtB) and TnpA (tnpA) genes, complete cds
+Length=11426
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 31/37 (84%), Gaps = 3/37 (8%)
+ Strand=Plus/Minus
+
+Query 58 AACAGCTGTTATA---ACAGAAACCACTACGAAAGGA 91
+ |||||| |||||| ||| ||||||||||| |||||
+Sbjct 8030 AACAGCCGTTATATCCACATAAACCACTACGCAAGGA 7994
+
+
+>gi|55908997|gb|AC102414.8| Mus musculus chromosome 15, clone RP24-474D5, complete sequence
+Length=159739
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 24/26 (93%), Gaps = 0/26 (0%)
+ Strand=Plus/Plus
+
+Query 70 AACAGAAACCACTACGAAAGGAAAGA 95
+ ||||||||||||||| |||||| |||
+Sbjct 71851 AACAGAAACCACTACAAAAGGAGAGA 71876
+
+
+>gi|72096292|gb|AC162857.5| Mus musculus chromosome 15, clone RP23-333C11, complete sequence
+Length=224913
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 24/26 (93%), Gaps = 0/26 (0%)
+ Strand=Plus/Minus
+
+Query 70 AACAGAAACCACTACGAAAGGAAAGA 95
+ ||||||||||||||| |||||| |||
+Sbjct 3370 AACAGAAACCACTACAAAAGGAGAGA 3345
+
+
+>gi|22415845|emb|AL139016.8| Human DNA sequence from clone RP4-658C17 on chromosome 1p11.1-13.3,
+complete sequence
+Length=100643
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 22/23 (96%), Gaps = 0/23 (0%)
+ Strand=Plus/Plus
+
+Query 87 AAGGAAAGAAATGCCTCTANAAG 109
+ ||||||||||||||||||| |||
+Sbjct 22086 AAGGAAAGAAATGCCTCTAGAAG 22108
+
+
+>gi|6572307|emb|Z82173.2| Human DNA sequence from clone SC22CB-1D7 on chromosome 22 Contains
+a novel gene and part of the LARGE gene for like-glycosyltransferase,
+complete sequence
+Length=37731
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 30/36 (84%), Gaps = 0/36 (0%)
+ Strand=Plus/Minus
+
+Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAATGCC 101
+ ||| ||||||||||| || |||||||| ||| |||
+Sbjct 15530 TTAAAACAGAAACCAAAACCAAAGGAAAAAAAAGCC 15495
+
+
+>gi|56410822|gb|AC140454.4| Mus musculus BAC clone RP24-163I14 from 1, complete sequence
+Length=171533
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 28/32 (88%), Gaps = 4/32 (12%)
+ Strand=Plus/Plus
+
+Query 66 TTATAACAGAAACCACTACGAAAGGAAAGAAA 97
+ |||||||||||||||| ||||||||||||
+Sbjct 140248 TTATAACAGAAACCAC----AAAGGAAAGAAA 140275
+
+
+>gi|38707373|emb|BX255930.3| Zebrafish DNA sequence from clone DKEY-101K6 in linkage group
+9 Contains the 3' end of the mcm3ap gene for MCM3 minichromosome
+maintenance deficient 3 (S. cerevisiae) associated protein,
+the gene for a novel protein similar to vertebrate lanosterol
+synthase (2,3-oxidosqualene-lanosterol cyclase) (LSS),
+the gene for a novel protein similar to human and mouse leishmanolysin-like
+(metallopeptidase M8 family) (LMLN), the
+gene for a novel protein similar to vertebrate oxysterol binding
+protein-like 10 (OSBPL10), the gene for a novel protein
+similar to vertebrate transforming growth factor, beta receptor
+II (70/80kDa) (TGFBR2), the snx4 gene for sorting nexin
+4, the gene for a novel protein similar to vertebrate zinc
+finger protein 148 (ZNF148) and the 5' end of the gene for a
+novel protein similar to vertebrate solute carrier family 12
+(potassium/chloride transporters), member 8 (SLC12A8), complete
+sequence
+Length=185559
+
+ Score = 39.2 bits (42), Expect = 5.0
+ Identities = 21/21 (100%), Gaps = 0/21 (0%)
+ Strand=Plus/Plus
+
+Query 62 GCTGTTATAACAGAAACCACT 82
+ |||||||||||||||||||||
+Sbjct 124003 GCTGTTATAACAGAAACCACT 124023
+
+
+
+Lambda K H
+ 0.634 0.408 0.912
+
+Gapped
+Lambda K H
+ 0.625 0.410 0.780
+
+Effective search space used: 3062586391620
+
+
+ Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
+GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
+ Posted date: May 21, 2011 4:39 PM
+ Number of letters in database: 36,075,095,184
+ Number of sequences in database: 14,049,258
+
+
+
+Matrix: blastn matrix 2 -3
+Gap Penalties: Existence: 5, Extension: 2
Please sign in to comment.
Something went wrong with that request. Please try again.