Permalink
Fetching contributors…
Cannot retrieve contributors at this time
183 lines (150 sloc) 7.15 KB
# -*-Perl-*-
# $id$
## Bioperl Test Harness Script for Modules
use strict;
BEGIN {
use Bio::Root::Test;
test_begin(-tests => 45);
use_ok('Bio::Tools::Run::Alignment::Clustalw');
use_ok('Bio::SimpleAlign');
use_ok('Bio::AlignIO');
use_ok('Bio::SeqIO');
use_ok('File::Spec');
}
# setup input files etc
my $inputfilename = test_input_file("cysprot.fa");
ok( -e $inputfilename, 'Found input file' );
my $profile1 = test_input_file('cysprot1a.msf');
ok( -e $profile1, 'Found profile1 file' );
my $profile2 = test_input_file('cysprot1b.msf');
ok( -e $profile2, 'Found profile2 file' );
my $outfile = test_output_file();
# setup global objects that are to be used in more than one test
# Also test they were initialised correctly
my @params = ('ktuple' => 2, 'quiet' => 1);
my $factory = Bio::Tools::Run::Alignment::Clustalw->new(@params);
isa_ok( $factory, 'Bio::Tools::Run::Alignment::Clustalw');
$factory->outfile($outfile);
# test default factory values
is( $factory->program_dir, $ENV{'CLUSTALDIR'}, 'program_dir returned correct default' );
is( $factory->error_string, '', 'error_string returned correct default' );
is( $factory->outfile_name, 'mlc', 'outfile_name returned correct default' );
is( $factory->bootstrap, undef, 'bootstrap returned correct default' );
# Now onto the nitty gritty tests of the modules methods
is( $factory->program_name(), 'clustalw', 'Correct exe default name' );
SKIP: {
test_skip(-requires_executable => $factory,
-tests => 19);
# test all factory methods dependent on finding the executable
# TODO: isnt( $factory->program_dir, undef,'Found program in an ENV variable' );
my $ver = $factory->version || 0;
# remove last bit
$ver =~ s{^(\d+\.\d+)\.\d+}{$1};
# clustalw2 isn't supported yet.
if ($ver < 1.8) {
diag("ClustalW version $ver not supported");
skip("ClustalW version $ver not supported", 19);
}
ok( $ver, "Supported program version $ver" );
# test execution using filename
my $aln = $factory->align($inputfilename);
# now test the factory error methods etc
is( $factory->error_string, '', 'No error occured' );
isnt( $factory->outfile_name, undef, 'outfile_name returned something' );
# now test its output
isa_ok( $aln, 'Bio::SimpleAlign');
is( $aln->num_sequences, 7, 'Correct number of seqs returned' );
is $aln->score, 16047, 'Score';
# test execution using an array of Seq objects
my $str = Bio::SeqIO->new('-file' => $inputfilename, '-format' => 'Fasta');
my @seq_array =();
while ( my $seq = $str->next_seq() ) {
push (@seq_array, $seq) ;
}
$aln = $factory->align(\@seq_array);
# now test its output
isa_ok( $aln, 'Bio::SimpleAlign');
is( $aln->num_sequences, 7,'Correct number of seqs returned' );
# Use this alignment to fully test the methods
{
my $i=1;
for my $seq ( $aln->each_seq ) {
last if( $seq->display_id =~ /CATH_HUMAN/ );
$i++;
}
is( $aln->get_seq_by_pos($i)->get_nse, 'CATH_HUMAN/1-335', 'Got correct sequence by position' );
}
# test doing a bootstrap tree
my $tree = $factory->tree($aln);
isa_ok( $tree, 'Bio::Tree::Tree' );
# now test doing profile alignments
$aln = $factory->profile_align($profile1,$profile2);
isa_ok( $aln, 'Bio::SimpleAlign' );
is( $aln->num_sequences, 7,'Correct number of seqs returned' );
# test the run method
($aln, $tree) = $factory->run(\@seq_array);
isa_ok($aln, 'Bio::SimpleAlign');
isa_ok($tree, 'Bio::Tree::Tree');
($aln, $tree) = $factory->run($inputfilename);
isa_ok($aln, 'Bio::SimpleAlign');
isa_ok($tree, 'Bio::Tree::Tree');
# test the footprint method
my @seqs = (Bio::Seq->new(-seq => 'AACCTGGCCAATTGGCCAATTGGGCGTACGTACGT', -id => 'rabbit'),
Bio::Seq->new(-seq => 'ACCCTGGCCAATTGGCCAATTGTAAGTACGTACGT', -id => 'marmot'),
Bio::Seq->new(-seq => 'AAGCTGGCCAATTGGCCAATTAGACTTACGTACGT', -id => 'chimp'),
Bio::Seq->new(-seq => 'AACATGGCCAATTGGCCAATCGGACGTACGTCCGT', -id => 'human'),
Bio::Seq->new(-seq => 'AACCGGGCCAATTGGCCAAGTGGACGTACGTATGT', -id => 'cebus'),
Bio::Seq->new(-seq => 'AACCTAGCCAATTGGCCACTTGGACGTACGTACAT', -id => 'gorilla'),
Bio::Seq->new(-seq => 'AACCTGCCCAATTGGCCGATTGGACGTACGTACGC', -id => 'orangutan'),
Bio::Seq->new(-seq => 'AACCTGGGCAATTGGCAAATTGGACGTACGTACGT', -id => 'baboon'),
Bio::Seq->new(-seq => 'AACCTGGCTAATTGGTCAATTGGACGTACGTACGT', -id => 'rhesus'),
Bio::Seq->new(-seq => 'AACCTGGCCGATTGGCCAATTGGACGTACGTACGT', -id => 'squirrelmonkey'));
my @results = $factory->footprint(\@seqs);
@results = map { $_->consensus_string } @results;
is_deeply(\@results, [qw(ATTGG TACGT)], 'footprinting worked');
SKIP: {
# TODO: Is this needed, or should min version be bumped to > 1.82. Discuss with module author
# keeping this to be compatible with older t/Clustalw.t
skip("clustalw 1.81 & 1.82 contain a profile align bug", 2) unless $ver > 1.82;
my $str1 = Bio::AlignIO->new(-file=> $profile1);
my $aln1 = $str1->next_aln();
my $str2 = Bio::AlignIO->new(-file=> $profile2);
my $aln2 = $str2->next_aln();
$aln = $factory->profile_align($aln1,$aln2);
is($aln->get_seq_by_pos(2)->get_nse, 'CATH_HUMAN/1-335', 'Got correct sequence by position');
$str2 = Bio::SeqIO->new(-file=> test_input_file("cysprot1b.fa"));
my $seq = $str2->next_seq();
$aln = $factory->profile_align($aln1,$seq);
is($aln->get_seq_by_pos(2)->get_nse, 'CATH_HUMAN/1-335', 'Got correct sequence by position');
}
}
# TODO: Test factory methods that change parameters
#TODO: {
# local $TODO = "program_name setting not finished";
# $factory->program_name('something_silly');
# is( $factory->program_name, 'something_silly', 'Set and got program_name correctly' );
#}
$factory->ktuple(4);
is( $factory->ktuple, 4, 'Set and got ktuple correctly' );
$factory->topdiags(10);
is( $factory->topdiags, 10, 'Set and got topdiags correctly' );
$factory->window(10);
is( $factory->window, 10, 'Set and got window correctly' );
$factory->pairgap(10);
is( $factory->pairgap, 10, 'Set and got pairgap correctly' );
$factory->fixedgap(20);
is( $factory->fixedgap, 20, 'Set and got fixedgap correctly' );
$factory->floatgap(16);
is( $factory->floatgap, 16, 'Set and got floatgap correctly' );
$factory->matrix('PAM250');
is( $factory->matrix, 'PAM250', 'Set and got matrix correctly' );
$factory->type('protein');
is( $factory->type, 'protein', 'Set and got type correctly' );
$factory->output('PIR');
is( $factory->output, 'PIR', 'Set and got output correctly' );
$factory->outfile('odd_name.out');
is( $factory->outfile, 'odd_name.out', 'Set and got outfile correctly' );
$factory->quiet(0);
is( $factory->quiet, 0, 'set and got quiet correctly' );
$factory->bootstrap(100);
is( $factory->bootstrap, 100, 'set and got bootstrap correctly' );