Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with
or
.
Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

441 lines (363 sloc) 14.425 kb
#!/usr/bin/env python
# Created: Wed May 29 08:07:18 2002
# thomas@cbs.dtu.dk, Cecilia.Alsmark@ebc.uu.se
# Copyright 2001 by Thomas Sicheritz-Ponten and Cecilia Alsmark.
# All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
"""Miscellaneous functions for dealing with sequences."""
import re
from Bio import SeqIO
from Bio.Seq import Seq
from Bio import Alphabet
from Bio.Alphabet import IUPAC
from Bio.Data import IUPACData, CodonTable
######################################
# DNA
######################
# {{{
def GC(seq):
"""Calculates G+C content, returns the percentage (float between 0 and 100).
Copes mixed case sequences, and with the ambiguous nucleotide S (G or C)
when counting the G and C content. The percentage is calculated against
the full length, e.g.:
>>> from Bio.SeqUtils import GC
>>> GC("ACTGN")
40.0
Note that this will return zero for an empty sequence.
"""
try:
gc = sum(map(seq.count,['G','C','g','c','S','s']))
return gc*100.0/len(seq)
except ZeroDivisionError:
return 0.0
def GC123(seq):
"""Calculates total G+C content plus first, second and third positions.
Returns a tuple of four floats (percentages between 0 and 100) for the
entire sequence, and the three codon positions. e.g.
>>> from Bio.SeqUtils import GC123
>>> GC123("ACTGTN")
(40.0, 50.0, 50.0, 0.0)
Copes with mixed case sequences, but does NOT deal with ambiguous
nucleotides.
"""
d= {}
for nt in ['A','T','G','C']:
d[nt] = [0,0,0]
for i in range(0,len(seq),3):
codon = seq[i:i+3]
if len(codon) <3: codon += ' '
for pos in range(0,3):
for nt in ['A','T','G','C']:
if codon[pos] == nt or codon[pos] == nt.lower():
d[nt][pos] += 1
gc = {}
gcall = 0
nall = 0
for i in range(0,3):
try:
n = d['G'][i] + d['C'][i] +d['T'][i] + d['A'][i]
gc[i] = (d['G'][i] + d['C'][i])*100.0/n
except:
gc[i] = 0
gcall = gcall + d['G'][i] + d['C'][i]
nall = nall + n
gcall = 100.0*gcall/nall
return gcall, gc[0], gc[1], gc[2]
def GC_skew(seq, window = 100):
"""Calculates GC skew (G-C)/(G+C) for multuple windows along the sequence.
Returns a list of ratios (floats), controlled by the length of the sequence
and the size of the window.
Does NOT look at any ambiguous nucleotides.
"""
# 8/19/03: Iddo: added lowercase
values = []
for i in range(0, len(seq), window):
s = seq[i: i + window]
g = s.count('G') + s.count('g')
c = s.count('C') + s.count('c')
skew = (g-c)/float(g+c)
values.append(skew)
return values
from math import pi, sin, cos, log
def xGC_skew(seq, window = 1000, zoom = 100,
r = 300, px = 100, py = 100):
"""Calculates and plots normal and accumulated GC skew (GRAPHICS !!!)."""
from Tkinter import Scrollbar, Canvas, BOTTOM, BOTH, ALL, \
VERTICAL, HORIZONTAL, RIGHT, LEFT, X, Y
yscroll = Scrollbar(orient = VERTICAL)
xscroll = Scrollbar(orient = HORIZONTAL)
canvas = Canvas(yscrollcommand = yscroll.set,
xscrollcommand = xscroll.set, background = 'white')
win = canvas.winfo_toplevel()
win.geometry('700x700')
yscroll.config(command = canvas.yview)
xscroll.config(command = canvas.xview)
yscroll.pack(side = RIGHT, fill = Y)
xscroll.pack(side = BOTTOM, fill = X)
canvas.pack(fill=BOTH, side = LEFT, expand = 1)
canvas.update()
X0, Y0 = r + px, r + py
x1, x2, y1, y2 = X0 - r, X0 + r, Y0 -r, Y0 + r
ty = Y0
canvas.create_text(X0, ty, text = '%s...%s (%d nt)' % (seq[:7], seq[-7:], len(seq)))
ty +=20
canvas.create_text(X0, ty, text = 'GC %3.2f%%' % (GC(seq)))
ty +=20
canvas.create_text(X0, ty, text = 'GC Skew', fill = 'blue')
ty +=20
canvas.create_text(X0, ty, text = 'Accumulated GC Skew', fill = 'magenta')
ty +=20
canvas.create_oval(x1,y1, x2, y2)
acc = 0
start = 0
for gc in GC_skew(seq, window):
r1 = r
acc+=gc
# GC skew
alpha = pi - (2*pi*start)/len(seq)
r2 = r1 - gc*zoom
x1 = X0 + r1 * sin(alpha)
y1 = Y0 + r1 * cos(alpha)
x2 = X0 + r2 * sin(alpha)
y2 = Y0 + r2 * cos(alpha)
canvas.create_line(x1,y1,x2,y2, fill = 'blue')
# accumulated GC skew
r1 = r - 50
r2 = r1 - acc
x1 = X0 + r1 * sin(alpha)
y1 = Y0 + r1 * cos(alpha)
x2 = X0 + r2 * sin(alpha)
y2 = Y0 + r2 * cos(alpha)
canvas.create_line(x1,y1,x2,y2, fill = 'magenta')
canvas.update()
start += window
canvas.configure(scrollregion = canvas.bbox(ALL))
def molecular_weight(seq):
"""Calculate the molecular weight of a DNA sequence."""
if isinstance(seq, str): seq = Seq(seq, IUPAC.unambiguous_dna)
weight_table = IUPACData.unambiguous_dna_weights
return sum(weight_table[x] for x in seq)
def nt_search(seq, subseq):
"""Search for a DNA subseq in sequence.
use ambiguous values (like N = A or T or C or G, R = A or G etc.)
searches only on forward strand
"""
pattern = ''
for nt in subseq:
value = IUPACData.ambiguous_dna_values[nt]
if len(value) == 1:
pattern += value
else:
pattern += '[%s]' % value
pos = -1
result = [pattern]
l = len(seq)
while True:
pos+=1
s = seq[pos:]
m = re.search(pattern, s)
if not m: break
pos += int(m.start(0))
result.append(pos)
return result
# }}}
######################################
# Protein
######################
# {{{
_THREECODE = {'A':'Ala', 'B':'Asx', 'C':'Cys', 'D':'Asp',
'E':'Glu', 'F':'Phe', 'G':'Gly', 'H':'His',
'I':'Ile', 'K':'Lys', 'L':'Leu', 'M':'Met',
'N':'Asn', 'P':'Pro', 'Q':'Gln', 'R':'Arg',
'S':'Ser', 'T':'Thr', 'V':'Val', 'W':'Trp',
'Y':'Tyr', 'Z':'Glx', 'X':'Xaa',
'U':'Sel', 'O':'Pyl', 'J':'Xle',
}
def seq3(seq, custom_map={'*': 'Ter'}, undef_code='Xaa'):
"""Turn a one letter code protein sequence into one with three letter codes.
The single input argument 'seq' should be a protein sequence using single
letter codes, either as a python string or as a Seq or MutableSeq object.
This function returns the amino acid sequence as a string using the three
letter amino acid codes. Output follows the IUPAC standard (including
ambiguous characters B for "Asx", J for "Xle" and X for "Xaa", and also U
for "Sel" and O for "Pyl") plus "Ter" for a terminator given as an asterisk.
Any unknown character (including possible gap characters), is changed into
'Xaa'.
e.g.
>>> from Bio.SeqUtils import seq3
>>> seq3("MAIVMGRWKGAR*")
'MetAlaIleValMetGlyArgTrpLysGlyAlaArgTer'
You can set a custom translation of the codon termination code using the
"custom_map" argument, e.g.
>>> seq3("MAIVMGRWKGAR*", custom_map={"*": "***"})
'MetAlaIleValMetGlyArgTrpLysGlyAlaArg***'
You can also set a custom translation for non-amino acid characters, such
as '-', using the "undef_code" argument, e.g.
>>> seq3("MAIVMGRWKGA--R*", undef_code='---')
'MetAlaIleValMetGlyArgTrpLysGlyAla------ArgTer'
If not given, "undef_code" defaults to "Xaa", e.g.
>>> seq3("MAIVMGRWKGA--R*")
'MetAlaIleValMetGlyArgTrpLysGlyAlaXaaXaaArgTer'
This function was inspired by BioPerl's seq3.
"""
threecode = _THREECODE
# add the given termination codon code
threecode.update(custom_map)
#We use a default of 'Xaa' for undefined letters
#Note this will map '-' to 'Xaa' which may be undesirable!
return ''.join([threecode.get(aa, undef_code) for aa in seq])
def seq1(seq, custom_map={'Ter': '*'}, undef_code='X'):
"""Turns a three-letter code protein sequence into one with single letter codes.
The single input argument 'seq' should be a protein sequence using three-
letter codes, either as a python string or as a Seq or MutableSeq object.
This function returns the amino acid sequence as a string using the three
letter amino acid codes. Output follows the IUPAC standard (including
ambiguous characters "Asx" for "B", "Xle" for "J", "Xaa" for "X", "Sel" for
"U", and "Pyl" for "O") plus "*" for a terminator given the "Ter" code.
Any unknown character (including possible gap characters), is changed into
'-'.
e.g.
>>> from Bio.SeqUtils import seq3
>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAlaArgTer")
'MAIVMGRWKGAR*'
You can set a custom translation of the codon termination code using the
"custom_map" argument, e.g.
>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAlaArg***", custom_map={"***": "*"})
'MAIVMGRWKGAR*'
You can also set a custom translation for non-amino acid characters, such
as '-', using the "undef_code" argument, e.g.
>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAla------ArgTer", undef_code='?')
'MAIVMGRWKGA??R*'
If not given, "undef_code" defaults to "X", e.g.
>>> seq1("MetAlaIleValMetGlyArgTrpLysGlyAla------ArgTer")
'MAIVMGRWKGAXXR*'
"""
# reverse map of threecode
onecode = dict([(x[1], x[0]) for x in _THREECODE.items()])
# add the given termination codon code and custom maps
onecode.update(custom_map)
seqlist = [seq[3*i:3*(i+1)] for i in range(len(seq) // 3)]
return ''.join([onecode.get(aa, undef_code) for aa in seqlist])
# }}}
######################################
# Mixed ???
######################
# {{{
def six_frame_translations(seq, genetic_code = 1):
"""Formatted string showing the 6 frame translations and GC content.
nice looking 6 frame translation with GC content - code from xbbtools
similar to DNA Striders six-frame translation
>>> from Bio.SeqUtils import six_frame_translations
>>> print six_frame_translations("AUGGCCAUUGUAAUGGGCCGCUGA")
GC_Frame: a:5 t:0 g:8 c:5
Sequence: auggccauug ... gggccgcuga, 24 nt, 54.17 %GC
<BLANKLINE>
<BLANKLINE>
1/1
G H C N G P L
W P L * W A A
M A I V M G R *
auggccauuguaaugggccgcuga 54 %
uaccgguaacauuacccggcgacu
A M T I P R Q
H G N Y H A A S
P W Q L P G S
<BLANKLINE>
<BLANKLINE>
"""
from Bio.Seq import reverse_complement, translate
anti = reverse_complement(seq)
comp = anti[::-1]
length = len(seq)
frames = {}
for i in range(0,3):
frames[i+1] = translate(seq[i:], genetic_code)
frames[-(i+1)] = translate(anti[i:], genetic_code)[::-1]
# create header
if length > 20:
short = '%s ... %s' % (seq[:10], seq[-10:])
else:
short = seq
header = 'GC_Frame: '
for nt in ['a','t','g','c']:
header += '%s:%d ' % (nt, seq.count(nt.upper()))
header += '\nSequence: %s, %d nt, %0.2f %%GC\n\n\n' % (short.lower(),length, GC(seq))
res = header
for i in range(0,length,60):
subseq = seq[i:i+60]
csubseq = comp[i:i+60]
p = i//3
res = res + '%d/%d\n' % (i+1, i/3+1)
res = res + ' ' + ' '.join(map(None,frames[3][p:p+20])) + '\n'
res = res + ' ' + ' '.join(map(None,frames[2][p:p+20])) + '\n'
res = res + ' '.join(map(None,frames[1][p:p+20])) + '\n'
# seq
res = res + subseq.lower() + '%5d %%\n' % int(GC(subseq))
res = res + csubseq.lower() + '\n'
# - frames
res = res + ' '.join(map(None,frames[-2][p:p+20])) +' \n'
res = res + ' ' + ' '.join(map(None,frames[-1][p:p+20])) + '\n'
res = res + ' ' + ' '.join(map(None,frames[-3][p:p+20])) + '\n\n'
return res
# }}}
######################################
# FASTA file utilities
######################
# {{{
def quick_FASTA_reader(file):
"""Simple FASTA reader, returning a list of string tuples (OBSOLETE).
The single argument 'file' should be the filename of a FASTA format file.
This function will open and read in the entire file, constructing a list
of all the records, each held as a tuple of strings (the sequence name or
title, and its sequence).
>>> seqs = quick_FASTA_reader("Fasta/dups.fasta")
>>> for title, sequence in seqs:
... print title, sequence
alpha ACGTA
beta CGTC
gamma CCGCC
alpha (again - this is a duplicate entry to test the indexing code) ACGTA
delta CGCGC
This function was is fast, but because it returns the data as a single in
memory list, is unsuitable for large files where an iterator approach is
preferable.
You are generally encouraged to use Bio.SeqIO.parse(handle, "fasta") which
allows you to iterate over the records one by one (avoiding having all the
records in memory at once). Using Bio.SeqIO also makes it easy to switch
between different input file formats. However, please note that rather
than simple strings, Bio.SeqIO uses SeqRecord objects for each record.
If you want to use simple strings, use the function SimpleFastaParser
added to Bio.SeqIO.FastaIO in Biopython 1.61 instead.
"""
handle = open(file)
entries = []
from Bio.SeqIO.FastaIO import SimpleFastaParser
for title, sequence in SimpleFastaParser(handle):
entries.append((title, sequence))
handle.close()
return entries
# }}}
def _test():
"""Run the module's doctests (PRIVATE)."""
import os
import doctest
if os.path.isdir(os.path.join("..","Tests")):
print "Running doctests..."
cur_dir = os.path.abspath(os.curdir)
os.chdir(os.path.join("..","Tests"))
doctest.testmod()
os.chdir(cur_dir)
del cur_dir
print "Done"
elif os.path.isdir(os.path.join("Tests")):
print "Running doctests..."
cur_dir = os.path.abspath(os.curdir)
os.chdir(os.path.join("Tests"))
doctest.testmod()
os.chdir(cur_dir)
del cur_dir
print "Done"
if __name__ == "__main__":
_test()
Jump to Line
Something went wrong with that request. Please try again.