Skip to content
Fetching contributors…
Cannot retrieve contributors at this time
171 lines (156 sloc) 8.03 KB
# Copyright 2007-2010 by Peter Cock. All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
import os
import unittest
from Bio import SeqIO
from Bio import AlignIO
from Bio.SeqRecord import SeqRecord
from Bio.Seq import Seq, UnknownSeq
from StringIO import StringIO
from Bio import Alphabet
from Bio.Align import MultipleSeqAlignment
try:
#This is in Python 2.6+, but we need it on Python 3
from io import BytesIO
except ImportError:
BytesIO = StringIO
#List of formats including alignment only file formats we can read AND write.
#We don't care about the order
test_write_read_alignment_formats = sorted(SeqIO._FormatToWriter.keys())
for format in sorted(AlignIO._FormatToWriter):
if format not in test_write_read_alignment_formats:
test_write_read_alignment_formats.append(format)
test_write_read_alignment_formats.remove("gb") #an alias for genbank
test_write_read_alignment_formats.remove("fastq-sanger") #an alias for fastq
# This is a list of three-tuples. Each tuple contains a
# list of SeqRecord objects, a description (string), and
# a list of tuples for expected failures (each with a
# list of formats, exception type, exception message).
test_records = [
([], "zero records", {}),
([SeqRecord(Seq("CHSMAIKLSSEHNIPSGIANAL",Alphabet.generic_protein), id="Alpha"),
SeqRecord(Seq("HNGFTALEGEIHHLTHGEKVAF",Alphabet.generic_protein), id="Gamma"),
SeqRecord(Seq("DITHGVG",Alphabet.generic_protein), id="delta")],
"three peptides of different lengths", []),
([SeqRecord(Seq("CHSMAIKLSSEHNIPSGIANAL",Alphabet.generic_protein), id="Alpha"),
SeqRecord(Seq("VHGMAHPLGAFYNTPHGVANAI",Alphabet.generic_protein), id="Beta"),
SeqRecord(Seq("HNGFTALEGEIHHLTHGEKVAF",Alphabet.generic_protein), id="Gamma")],
"three proteins alignment", []),
([SeqRecord(Seq("AATAAACCTTGCTGGCCATTGTGATCCATCCA",Alphabet.generic_dna), id="X"),
SeqRecord(Seq("ACTCAACCTTGCTGGTCATTGTGACCCCAGCA",Alphabet.generic_dna), id="Y"),
SeqRecord(Seq("TTTCCTCGGAGGCCAATCTGGATCAAGACCAT",Alphabet.generic_dna), id="Z")],
"three DNA sequence alignment", []),
([SeqRecord(Seq("AATAAACCTTGCTGGCCATTGTGATCCATCCA",Alphabet.generic_dna), id="X",
name="The\nMystery\rSequece:\r\nX"),
SeqRecord(Seq("ACTCAACCTTGCTGGTCATTGTGACCCCAGCA",Alphabet.generic_dna), id="Y",
description="an%sevil\rdescription right\nhere" % os.linesep),
SeqRecord(Seq("TTTCCTCGGAGGCCAATCTGGATCAAGACCAT",Alphabet.generic_dna), id="Z")],
"3 DNA seq alignment with CR/LF in name/descr",
[(["genbank"], ValueError, r"Locus identifier 'The\nMystery\rSequece:\r\nX' is too long")]),
([SeqRecord(Seq("CHSMAIKLSSEHNIPSGIANAL",Alphabet.generic_protein), id="Alpha"),
SeqRecord(Seq("VHGMAHPLGAFYNTPHGVANAI",Alphabet.generic_protein), id="Beta"),
SeqRecord(Seq("VHGMAHPLGAFYNTPHGVANAI",Alphabet.generic_protein), id="Beta"),
SeqRecord(Seq("HNGFTALEGEIHHLTHGEKVAF",Alphabet.generic_protein), id="Gamma")],
"alignment with repeated record",
[(["stockholm"],ValueError,"Duplicate record identifier: Beta"),
(["phylip","phylip-relaxed","phylip-sequential"],ValueError,"Repeated name 'Beta' (originally 'Beta'), possibly due to truncation")]),
]
# Meddle with the annotation too:
assert test_records[4][1] == "3 DNA seq alignment with CR/LF in name/descr"
# Add a list of strings,
test_records[4][0][2].annotations["note"] = ["Note%salso" % os.linesep \
+ "\r\nhas\n evil line\rbreaks!", "Wow"]
# Add a simple string
test_records[4][0][2].annotations["comment"] = "More%sof" % os.linesep \
+ "\r\nthese\n evil line\rbreaks!"
# Add a float too:
test_records[4][0][2].annotations["weight"] = 2.5
class WriterTests(unittest.TestCase):
"""Cunning unit test where methods are added at run time."""
def check(self, records, format):
"""General test function with with a little format specific information.
This has some general expected exceptions hard coded!
"""
#TODO - Check the exception messages?
lengths = len(set(len(r) for r in records))
if not records and format in ["stockholm", "phylip", "phylip-relaxed",
"phylip-sequential", "nexus", "clustal",
"sff"]:
self.check_write_fails(records, format, ValueError,
"Must have at least one sequence")
elif lengths > 1 and format in AlignIO._FormatToWriter:
self.check_write_fails(records, format, ValueError,
"Sequences must all be the same length")
elif records and format in ["fastq", "fastq-sanger", "fastq-solexa",
"fastq-illumina", "qual", "phd"]:
self.check_write_fails(records, format, ValueError,
"No suitable quality scores found in "
"letter_annotations of SeqRecord "
"(id=%s)." % records[0].id)
elif records and format == "sff":
self.check_write_fails(records, format, ValueError,
"Missing SFF flow information")
else:
self.check_simple(records, format)
def check_simple(self, records, format):
if format in SeqIO._BinaryFormats:
handle = BytesIO()
else:
handle = StringIO()
count = SeqIO.write(records, handle, format)
self.assertEqual(count, len(records))
#Now read them back...
handle.seek(0)
new_records = list(SeqIO.parse(handle, format))
self.assertEqual(len(new_records), len(records))
for record, new_record in zip(records, new_records):
#Using compare_record(record, new_record) is too strict
if format == "nexus":
#The nexus parser will dis-ambiguate repeated record ids.
self.assertTrue(record.id == new_record.id or \
new_record.id.startswith(record.id+".copy"))
else:
self.assertEqual(record.id, new_record.id)
self.assertEqual(record.seq.tostring(), new_record.seq.tostring())
handle.close()
def check_write_fails(self, records, format, err_type, err_msg=""):
if format in SeqIO._BinaryFormats:
handle = BytesIO()
else:
handle = StringIO()
if err_msg:
try:
SeqIO.write(records, handle, format)
except err_type, err:
self.assertEqual(str(err), err_msg)
else:
self.assertRaises(err_type, SeqIO.write, records, handle, format)
handle.close()
for (records, descr, errs) in test_records:
for format in test_write_read_alignment_formats:
#Assume no errors expected...
def funct(records, format, descr):
f = lambda x : x.check(records, format)
f.__doc__ = "%s for %s" % (format, descr)
return f
setattr(WriterTests,
"test_%s_%s" % (format, descr.replace(" ","_")),
funct(records, format, descr))
#Replace the method with an error specific one?
for err_formats, err_type, err_msg in errs:
if format in err_formats:
def funct_e(records, format, descr, err_type, err_msg):
f = lambda x : x.check_write_fails(records, format,
err_type, err_msg)
f.__doc__ = "%s for %s" % (format, descr)
return f
setattr(WriterTests,
"test_%s_%s" % (format, descr.replace(" ","_")),
funct_e(records, format, descr, err_type, err_msg))
break
del funct
if __name__ == "__main__":
runner = unittest.TextTestRunner(verbosity = 2)
unittest.main(testRunner=runner)
Jump to Line
Something went wrong with that request. Please try again.