Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

25 lines (21 sloc) 0.941 kb
from Bio import Fasta
from Bio.SeqUtils import CodonUsage
import os
import sys
# first make a CAI object
X = CodonUsage.CodonAdaptationIndex()
# now generate an index from a file
if os.path.exists("./CodonUsage/HighlyExpressedGenes.txt"):
X.generate_index("./CodonUsage/HighlyExpressedGenes.txt")
elif os.path.exists("./Tests/CodonUsage/HighlyExpressedGenes.txt"):
X.generate_index("./Tests/CodonUsage/HighlyExpressedGenes.txt")
else:
print "Cannot find the file HighlyExpressedGene.txt\nMake sure you run the tests from within the Tests folder"
sys.exit()
# alternatively you could use any predefined dictionary like this:
# from CaiIndices import SharpIndex # you can save your dictionary in this file.
# X.SetCaiIndex(SharpIndex)
print "The current index used:"
X.print_index()
print "-" * 60
print "codon adaptation index for test gene: %.2f" % X.cai_for_gene("ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA")
Jump to Line
Something went wrong with that request. Please try again.