Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

170 lines (141 sloc) 5.789 kb
#!/usr/bin/env python
"""Tests for Primer-based programs in the Emboss suite.
"""
# standard library
import sys
import os
# PyUnit
import unittest
# local stuff
from Bio.Emboss.Primer import Primer3Parser, PrimerSearchParser
from Bio.Emboss.Primer import PrimerSearchInputRecord
def run_tests(argv):
test_suite = testing_suite()
runner = unittest.TextTestRunner(sys.stdout, verbosity = 2)
runner.run(test_suite)
def testing_suite():
"""Generate the suite of tests.
"""
test_suite = unittest.TestSuite()
test_loader = unittest.TestLoader()
test_loader.testMethodPrefix = 't_'
tests = [Primer3ParseTest, PrimersearchParseTest,
PrimerSearchInputTest]
for test in tests:
cur_suite = test_loader.loadTestsFromTestCase(test)
test_suite.addTest(cur_suite)
return test_suite
class Primer3ParseTest(unittest.TestCase):
def setUp(self):
self.test_files = \
[os.path.join("Emboss", "bac_find.primer3"),
os.path.join("Emboss", "cds_forward.primer3"),
os.path.join("Emboss", "cds_reverse.primer3"),
os.path.join("Emboss", "short.primer3"),
os.path.join("Emboss", "internal_oligo.primer3")
]
def t_simple_parse(self):
"""Make sure that we can parse all primer3 files.
"""
parser = Primer3Parser(debug_level = 0)
for file in self.test_files:
h = open(file, "r")
parser.parse(h)
h.close()
def t_indepth_regular_parse(self):
"""Make sure we get the data from normal primer3 files okay.
"""
regular_file = self.test_files[0]
parser = Primer3Parser()
h = open(regular_file, "r")
primer_info = parser.parse(h)
h.close()
assert len(primer_info.primers) == 5, \
"Wrong number of primers: %s" % len(primer_info.primers)
assert primer_info.primers[1].forward_seq \
== "CCGGTTTCTCTGGTTGAAAA"
assert primer_info.primers[2].reverse_seq == \
"TCACATTCCCAAATGTAGATCG"
assert primer_info.primers[0].size == 218
assert primer_info.primers[3].forward_start == 112
assert primer_info.primers[3].forward_length == 20
assert primer_info.primers[3].forward_tm == 59.57
assert primer_info.primers[3].forward_gc == 45.00
assert primer_info.primers[4].reverse_start == 304
assert primer_info.primers[4].reverse_length == 22
assert primer_info.primers[4].reverse_tm == 59.61
assert primer_info.primers[4].reverse_gc == 40.91
def t_in_depth_single_parse(self):
"""Make sure we get info right from a single primer find.
"""
file = self.test_files[1]
parser = Primer3Parser()
h = open(file, "r")
primer_info = parser.parse(h)
h.close()
assert len(primer_info.primers) == 5
assert primer_info.primers[1].reverse_seq == ""
assert primer_info.primers[3].forward_seq == "TGTGATTGCTTGAGCTGGAC"
assert primer_info.primers[3].forward_start == 253
def t_internal_oligo_single_parse(self):
''' Make sure we can parse an internal oligo file correctly '''
# these files are generated when designing hybridization probes.
file = self.test_files[4]
parser = Primer3Parser()
h = open(file, "r")
primer_info = parser.parse(h)
h.close()
assert len(primer_info.primers) == 5
assert primer_info.primers[0].internal_length == 22
assert primer_info.primers[1].internal_seq == 'TTGCGCTTTAGTTTGAATTGAA'
assert primer_info.primers[2].internal_tm == 58.62
assert primer_info.primers[3].internal_start == 16
assert primer_info.primers[4].internal_gc == 35.00
class PrimersearchParseTest(unittest.TestCase):
def setUp(self):
self.test_files = \
[os.path.join("Emboss", "bac_find.psearch")]
def t_simple_parse(self):
"""Make sure that we can parse all primersearch files.
"""
parser = PrimerSearchParser(debug_level = 0)
for file in self.test_files:
h = open(file, "r")
parser.parse(h)
h.close()
def t_in_depth_normal_parse(self):
"""Make sure the output from a simple primersearch file is correct.
"""
file = self.test_files[0]
parser = PrimerSearchParser()
h = open(file, "r")
amp_info = parser.parse(h)
h.close()
assert len(amp_info.amplifiers.keys()) == 1
assert "Test" in amp_info.amplifiers.keys()
assert len(amp_info.amplifiers["Test"]) == 1
assert amp_info.amplifiers["Test"][0].length == 218
assert amp_info.amplifiers["Test"][0].hit_info == \
"AC074298 AC074298 \n" + \
"\tTelomere associated sequence for Arabidopsis thaliana " + \
"TEL1N from chromosome I, complete sequence.\n" + \
"\tCCGGTTTCTCTGGTTGAAAA hits forward strand at 114 with " + \
"0 mismatches\n" + \
"\tTCACATTCCCAAATGTAGATCG hits reverse strand at [114] with " + \
"0 mismatches"
class PrimerSearchInputTest(unittest.TestCase):
"""Test creating input files for primersearch.
"""
def setUp(self):
pass
def t_primer_representation(self):
"""Make sure we can output primer information correctly.
"""
p_info = PrimerSearchInputRecord()
p_info.add_primer_set("Test", "GATC", "CATG")
p_info.add_primer_set("Test2", "AATA", "TTAT")
output = str(p_info)
assert output == "Test GATC CATG\n" + \
"Test2 AATA TTAT\n"
if __name__ == "__main__":
sys.exit(run_tests(sys.argv))
Jump to Line
Something went wrong with that request. Please try again.