Skip to content
This repository
Fetching contributors…

Octocat-spinner-32-eaf2f5

Cannot retrieve contributors at this time

file 170 lines (141 sloc) 5.789 kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169
#!/usr/bin/env python
"""Tests for Primer-based programs in the Emboss suite.
"""
# standard library
import sys
import os

# PyUnit
import unittest

# local stuff
from Bio.Emboss.Primer import Primer3Parser, PrimerSearchParser
from Bio.Emboss.Primer import PrimerSearchInputRecord

def run_tests(argv):
    test_suite = testing_suite()
    runner = unittest.TextTestRunner(sys.stdout, verbosity = 2)
    runner.run(test_suite)

def testing_suite():
    """Generate the suite of tests.
"""
    test_suite = unittest.TestSuite()

    test_loader = unittest.TestLoader()
    test_loader.testMethodPrefix = 't_'
    tests = [Primer3ParseTest, PrimersearchParseTest,
             PrimerSearchInputTest]
    
    for test in tests:
        cur_suite = test_loader.loadTestsFromTestCase(test)
        test_suite.addTest(cur_suite)

    return test_suite

class Primer3ParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.primer3"),
           os.path.join("Emboss", "cds_forward.primer3"),
           os.path.join("Emboss", "cds_reverse.primer3"),
           os.path.join("Emboss", "short.primer3"),
           os.path.join("Emboss", "internal_oligo.primer3")
           ]

    def t_simple_parse(self):
        """Make sure that we can parse all primer3 files.
"""
        parser = Primer3Parser(debug_level = 0)
        for file in self.test_files:
            h = open(file, "r")
            parser.parse(h)
            h.close()

    def t_indepth_regular_parse(self):
        """Make sure we get the data from normal primer3 files okay.
"""
        regular_file = self.test_files[0]
        parser = Primer3Parser()
        h = open(regular_file, "r")
        primer_info = parser.parse(h)
        h.close()

        assert len(primer_info.primers) == 5, \
          "Wrong number of primers: %s" % len(primer_info.primers)

        assert primer_info.primers[1].forward_seq \
          == "CCGGTTTCTCTGGTTGAAAA"
        assert primer_info.primers[2].reverse_seq == \
          "TCACATTCCCAAATGTAGATCG"
        assert primer_info.primers[0].size == 218
        assert primer_info.primers[3].forward_start == 112
        assert primer_info.primers[3].forward_length == 20
        assert primer_info.primers[3].forward_tm == 59.57
        assert primer_info.primers[3].forward_gc == 45.00

        assert primer_info.primers[4].reverse_start == 304
        assert primer_info.primers[4].reverse_length == 22
        assert primer_info.primers[4].reverse_tm == 59.61
        assert primer_info.primers[4].reverse_gc == 40.91

    def t_in_depth_single_parse(self):
        """Make sure we get info right from a single primer find.
"""
        file = self.test_files[1]
        parser = Primer3Parser()
        h = open(file, "r")
        primer_info = parser.parse(h)
        h.close()

        assert len(primer_info.primers) == 5
        assert primer_info.primers[1].reverse_seq == ""

        assert primer_info.primers[3].forward_seq == "TGTGATTGCTTGAGCTGGAC"
        assert primer_info.primers[3].forward_start == 253

    def t_internal_oligo_single_parse(self):
        ''' Make sure we can parse an internal oligo file correctly '''
        # these files are generated when designing hybridization probes.
        file = self.test_files[4]
        parser = Primer3Parser()
        h = open(file, "r")
        primer_info = parser.parse(h)
        h.close()

        assert len(primer_info.primers) == 5
        assert primer_info.primers[0].internal_length == 22
        assert primer_info.primers[1].internal_seq == 'TTGCGCTTTAGTTTGAATTGAA'
        assert primer_info.primers[2].internal_tm == 58.62
        assert primer_info.primers[3].internal_start == 16
        assert primer_info.primers[4].internal_gc == 35.00


class PrimersearchParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.psearch")]

    def t_simple_parse(self):
        """Make sure that we can parse all primersearch files.
"""
        parser = PrimerSearchParser(debug_level = 0)
        for file in self.test_files:
            h = open(file, "r")
            parser.parse(h)
            h.close()

    def t_in_depth_normal_parse(self):
        """Make sure the output from a simple primersearch file is correct.
"""
        file = self.test_files[0]
        parser = PrimerSearchParser()
        h = open(file, "r")
        amp_info = parser.parse(h)
        h.close()

        assert len(amp_info.amplifiers.keys()) == 1
        assert "Test" in amp_info.amplifiers.keys()
        assert len(amp_info.amplifiers["Test"]) == 1

        assert amp_info.amplifiers["Test"][0].length == 218
        assert amp_info.amplifiers["Test"][0].hit_info == \
          "AC074298 AC074298 \n" + \
          "\tTelomere associated sequence for Arabidopsis thaliana " + \
          "TEL1N from chromosome I, complete sequence.\n" + \
          "\tCCGGTTTCTCTGGTTGAAAA hits forward strand at 114 with " + \
          "0 mismatches\n" + \
          "\tTCACATTCCCAAATGTAGATCG hits reverse strand at [114] with " + \
          "0 mismatches"

class PrimerSearchInputTest(unittest.TestCase):
    """Test creating input files for primersearch.
"""
    def setUp(self):
        pass

    def t_primer_representation(self):
        """Make sure we can output primer information correctly.
"""
        p_info = PrimerSearchInputRecord()
        p_info.add_primer_set("Test", "GATC", "CATG")
        p_info.add_primer_set("Test2", "AATA", "TTAT")

        output = str(p_info)
        assert output == "Test GATC CATG\n" + \
                         "Test2 AATA TTAT\n"

if __name__ == "__main__":
    sys.exit(run_tests(sys.argv))
Something went wrong with that request. Please try again.