Skip to content


Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

executable file 370 lines (350 sloc) 19.842 kb
# Revisions copyright 2009 by Peter Cock. All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
import unittest
from Bio import SeqIO
from Bio.Sequencing import Phd
class PhdTestOne(unittest.TestCase):
def setUp(self):
self.handle = open("Phd/phd1")
def tearDown(self):
def test_check_SeqIO(self):
"""Test phd1 using parser via SeqIO."""
records = SeqIO.parse(self.handle, "phd")
#Contig 1
record = next(records)
self.assertEqual(, "34_222_(80-A03-19).b.ab1")
self.assertEqual(, "34_222_(80-A03-19).b.ab1")
self.assertEqual(record.description, "34_222_(80-A03-19).b.ab1")
[9, 9, 10, 19, 22, 37, 28, 28, 24, 22])
"9 9 10 19 22 37 28 28 24 22\n")
#Contig 2
record = next(records)
self.assertEqual(, "425_103_(81-A03-19).g.ab1")
self.assertEqual(, "425_103_(81-A03-19).g.ab1")
[14, 17, 22, 10, 10, 10, 15, 8, 8, 9])
#Contig 3
record = next(records)
self.assertEqual(, '425_7_(71-A03-19).b.ab1')
self.assertEqual(, '425_7_(71-A03-19).b.ab1')
[10, 10, 10, 10, 8, 8, 6, 6, 6, 6])
# Make sure that no further records are found
self.assertRaises(StopIteration, next, records)
def test_check_record_parser(self):
"""Test phd1 file in detail."""
records = Phd.parse(self.handle)
# Record 1
record = next(records)
self.assertEqual(record.file_name, "34_222_(80-A03-19).b.ab1")
self.assertEqual(record.comments['abi_thumbprint'], 0)
self.assertEqual(record.comments['call_method'], "phred")
self.assertEqual(record.comments['chem'], "term")
self.assertEqual(record.comments['chromat_file'], "34_222_(80-A03-19).b.ab1")
self.assertEqual(record.comments['dye'], "big")
self.assertEqual(record.comments['phred_version'], "0.020425.c")
self.assertEqual(record.comments['quality_levels'], 99)
self.assertEqual(record.comments['time'], "Fri Feb 13 09:16:11 2004")
self.assertEqual(record.comments['trace_array_max_index'], 10867)
self.assertEqual(record.comments['trace_array_min_index'], 0)
self.assertAlmostEqual(record.comments['trace_peak_area_ratio'], 0.1467)
self.assertEqual(record.comments['trim'][0], 3)
self.assertEqual(record.comments['trim'][1], 391)
self.assertAlmostEqual(record.comments['trim'][2], 0.05)
center = len(record.sites)//2
self.assertEqual(record.sites[0], ('c', '9', '6'))
self.assertEqual(record.sites[1], ('t', '9', '18'))
self.assertEqual(record.sites[2], ('c', '10', '26'))
self.assertEqual(record.sites[3], ('c', '19', '38'))
self.assertEqual(record.sites[4], ('g', '22', '49'))
self.assertEqual(record.sites[5], ('t', '37', '65'))
self.assertEqual(record.sites[6], ('c', '28', '76'))
self.assertEqual(record.sites[7], ('g', '28', '87'))
self.assertEqual(record.sites[8], ('g', '24', '100'))
self.assertEqual(record.sites[9], ('a', '22', '108'))
self.assertEqual(record.sites[center-5], ('c', '11', '5259'))
self.assertEqual(record.sites[center-4], ('c', '11', '5273'))
self.assertEqual(record.sites[center-3], ('t', '9', '5286'))
self.assertEqual(record.sites[center-2], ('g', '10', '5300'))
self.assertEqual(record.sites[center-1], ('a', '10', '5316'))
self.assertEqual(record.sites[center], ('t', '8', '5323'))
self.assertEqual(record.sites[center+1], ('c', '8', '5343'))
self.assertEqual(record.sites[center+2], ('g', '8', '5352'))
self.assertEqual(record.sites[center+3], ('c', '8', '5366'))
self.assertEqual(record.sites[center+4], ('c', '8', '5378'))
self.assertEqual(record.sites[-10], ('c', '8', '10756'))
self.assertEqual(record.sites[-9], ('c', '8', '10764'))
self.assertEqual(record.sites[-8], ('a', '8', '10769'))
self.assertEqual(record.sites[-7], ('a', '8', '10788'))
self.assertEqual(record.sites[-6], ('a', '8', '10803'))
self.assertEqual(record.sites[-5], ('g', '10', '10816'))
self.assertEqual(record.sites[-4], ('c', '11', '10826'))
self.assertEqual(record.sites[-3], ('g', '11', '10840'))
self.assertEqual(record.sites[-2], ('t', '11', '10855'))
self.assertEqual(record.sites[-1], ('g', '11', '10864'))
self.assertEqual(str(record.seq)[:10], 'ctccgtcgga')
self.assertEqual(str(record.seq)[-10:], 'ccaaagcgtg')
self.assertEqual(str(record.seq_trimmed)[:10], 'cgtcggaaca')
self.assertEqual(str(record.seq_trimmed)[-10:], 'tatttcggag')
# Record 2
record = next(records)
center = len(record.sites)//2
self.assertEqual(record.file_name, "425_103_(81-A03-19).g.ab1")
self.assertEqual(record.comments['abi_thumbprint'], 0)
self.assertEqual(record.comments['call_method'], 'phred')
self.assertEqual(record.comments['chem'], 'term')
self.assertEqual(record.comments['chromat_file'], '425_103_(81-A03-19).g.ab1')
self.assertEqual(record.comments['dye'], 'big')
self.assertEqual(record.comments['phred_version'], '0.020425.c')
self.assertEqual(record.comments['quality_levels'], 99)
self.assertEqual(record.comments['time'], 'Tue Feb 17 10:31:15 2004')
self.assertEqual(record.comments['trace_array_max_index'], 10606)
self.assertEqual(record.comments['trace_array_min_index'], 0)
self.assertAlmostEqual(record.comments['trace_peak_area_ratio'], 0.0226)
self.assertEqual(record.comments['trim'][0], 10)
self.assertEqual(record.comments['trim'][1], 432)
self.assertAlmostEqual(record.comments['trim'][2], 0.05)
self.assertEqual(record.sites[0], ('c', '14', '3'))
self.assertEqual(record.sites[1], ('g', '17', '11'))
self.assertEqual(record.sites[2], ('g', '22', '23'))
self.assertEqual(record.sites[3], ('g', '10', '35'))
self.assertEqual(record.sites[4], ('a', '10', '53'))
self.assertEqual(record.sites[5], ('t', '10', '68'))
self.assertEqual(record.sites[6], ('c', '15', '75'))
self.assertEqual(record.sites[7], ('c', '8', '85'))
self.assertEqual(record.sites[8], ('c', '8', '94'))
self.assertEqual(record.sites[9], ('a', '9', '115'))
self.assertEqual(record.sites[center-5], ('c', '33', '5140'))
self.assertEqual(record.sites[center-4], ('c', '28', '5156'))
self.assertEqual(record.sites[center-3], ('g', '25', '5167'))
self.assertEqual(record.sites[center-2], ('c', '28', '5178'))
self.assertEqual(record.sites[center-1], ('c', '18', '5193'))
self.assertEqual(record.sites[center], ('a', '16', '5204'))
self.assertEqual(record.sites[center+1], ('a', '15', '5213'))
self.assertEqual(record.sites[center+2], ('a', '10', '5230'))
self.assertEqual(record.sites[center+3], ('a', '10', '5242'))
self.assertEqual(record.sites[center+4], ('t', '8', '5249'))
self.assertEqual(record.sites[-10], ('c', '8', '10489'))
self.assertEqual(record.sites[-9], ('c', '8', '10503'))
self.assertEqual(record.sites[-8], ('c', '8', '10514'))
self.assertEqual(record.sites[-7], ('a', '8', '10516'))
self.assertEqual(record.sites[-6], ('g', '8', '10530'))
self.assertEqual(record.sites[-5], ('c', '8', '10550'))
self.assertEqual(record.sites[-4], ('c', '10', '10566'))
self.assertEqual(record.sites[-3], ('a', '8', '10574'))
self.assertEqual(record.sites[-2], ('a', '7', '10584'))
self.assertEqual(record.sites[-1], ('g', '7', '10599'))
self.assertEqual(str(record.seq)[:10], 'cgggatccca')
self.assertEqual(str(record.seq)[-10:], 'cccagccaag')
self.assertEqual(str(record.seq_trimmed)[:10], 'cctgatccga')
self.assertEqual(str(record.seq_trimmed)[-10:], 'ggggccgcca')
# Record 3
record = next(records)
center = len(record.sites)//2
self.assertEqual(record.file_name, '425_7_(71-A03-19).b.ab1')
self.assertEqual(record.comments['abi_thumbprint'], 0)
self.assertEqual(record.comments['call_method'], 'phred')
self.assertEqual(record.comments['chem'], 'term')
self.assertEqual(record.comments['chromat_file'], '425_7_(71-A03-19).b.ab1')
self.assertEqual(record.comments['dye'], 'big')
self.assertEqual(record.comments['phred_version'], '0.020425.c')
self.assertEqual(record.comments['quality_levels'], 99)
self.assertEqual(record.comments['time'], 'Thu Jan 29 11:46:14 2004')
self.assertEqual(record.comments['trace_array_max_index'], 9513)
self.assertEqual(record.comments['trace_array_min_index'], 0)
self.assertAlmostEqual(record.comments['trace_peak_area_ratio'], 100.0)
self.assertEqual(record.comments['trim'][0], -1)
self.assertEqual(record.comments['trim'][1], -1)
self.assertEqual(record.comments['trim'][2], 0.05)
self.assertEqual(record.sites[0], ('a', '10', '7'))
self.assertEqual(record.sites[1], ('c', '10', '13'))
self.assertEqual(record.sites[2], ('a', '10', '21'))
self.assertEqual(record.sites[3], ('t', '10', '28'))
self.assertEqual(record.sites[4], ('a', '8', '33'))
self.assertEqual(record.sites[5], ('a', '8', '40'))
self.assertEqual(record.sites[6], ('a', '6', '50'))
self.assertEqual(record.sites[7], ('t', '6', '53'))
self.assertEqual(record.sites[8], ('c', '6', '66'))
self.assertEqual(record.sites[9], ('a', '6', '68'))
self.assertEqual(record.sites[center-5], ('a', '6', '4728'))
self.assertEqual(record.sites[center-4], ('t', '10', '4737'))
self.assertEqual(record.sites[center-3], ('a', '10', '4746'))
self.assertEqual(record.sites[center-2], ('a', '8', '4756'))
self.assertEqual(record.sites[center-1], ('t', '8', '4759'))
self.assertEqual(record.sites[center], ('t', '8', '4768'))
self.assertEqual(record.sites[center+1], ('a', '8', '4775'))
self.assertEqual(record.sites[center+2], ('g', '10', '4783'))
self.assertEqual(record.sites[center+3], ('t', '8', '4788'))
self.assertEqual(record.sites[center+4], ('g', '8', '4794'))
self.assertEqual(record.sites[-10], ('a', '8', '9445'))
self.assertEqual(record.sites[-9], ('t', '6', '9453'))
self.assertEqual(record.sites[-8], ('c', '6', '9462'))
self.assertEqual(record.sites[-7], ('t', '6', '9465'))
self.assertEqual(record.sites[-6], ('g', '6', '9478'))
self.assertEqual(record.sites[-5], ('c', '6', '9483'))
self.assertEqual(record.sites[-4], ('t', '6', '9485'))
self.assertEqual(record.sites[-3], ('t', '8', '9495'))
self.assertEqual(record.sites[-2], ('t', '3', '9504'))
self.assertEqual(record.sites[-1], ('n', '0', '9511'))
self.assertEqual(str(record.seq)[:10], 'acataaatca')
self.assertEqual(str(record.seq)[-10:], 'atctgctttn')
# Make sure that no further records are found
self.assertRaises(StopIteration, next, records)
class PhdTestTwo(unittest.TestCase):
def setUp(self):
self.handle = open("Phd/phd2")
def tearDown(self):
def test_check_SeqIO(self):
"""Test phd2 using parser via SeqIO."""
records = SeqIO.parse(self.handle, "phd")
#Contig 1
record = next(records)
self.assertEqual(, "ML4924R")
self.assertEqual(, "ML4924R")
self.assertEqual(record.description, "ML4924R")
[6, 6, 6, 8, 8, 12, 18, 16, 14, 11])
">ML4924R\n6 6 6 8 8 12 18 16 14 11\n")
# Make sure that no further records are found
self.assertRaises(StopIteration, next, records)
class PhdTest454(unittest.TestCase):
def setUp(self):
self.handle = open("Phd/phd_454")
def tearDown(self):
def test_check_SeqIO(self):
"""Test phd_454 using parser via SeqIO."""
records = SeqIO.parse(self.handle, "phd")
#Contig 1
record = next(records)
self.assertEqual(, "EBE03TV04IHLTF.77-243")
self.assertEqual(, "EBE03TV04IHLTF.77-243")
self.assertEqual(record.description, "EBE03TV04IHLTF.77-243 1")
self.assertEqual(str(record.seq), "ggggatgaaagggatctcggtggtaggtga")
[37, 37, 37, 37, 37, 37, 37, 37, 37, 37])
">EBE03TV04IHLTF.77-243 1\n"
">EBE03TV04IHLTF.77-243 1\n"
"37 37 37 37 37 37 37 37 37 37 "
"37 37 37 26 26 26 30 33 33 33\n"
"33 33 36 36 33 33 33 36 26 22\n")
"@EBE03TV04IHLTF.77-243 1\n"
"@EBE03TV04IHLTF.77-243 1\n"
# Make sure that no further records are found
self.assertRaises(StopIteration, next, records)
class PhdTestSolexa(unittest.TestCase):
def setUp(self):
self.handle = open("Phd/phd_solexa")
def tearDown(self):
def test_check_SeqIO(self):
"""Test phd2 using parser via SeqIO."""
records = SeqIO.parse(self.handle, "phd")
#Contig 1
record = next(records)
self.assertEqual(, "HWI-EAS94_4_1_1_537_446")
self.assertEqual(, "HWI-EAS94_4_1_1_537_446")
self.assertEqual(record.description, "HWI-EAS94_4_1_1_537_446 1")
[30, 30, 30, 30, 30, 30, 30, 30, 30, 30, 30,
30, 30, 30, 30, 30, 30, 30, 30, 30, 28, 23,
30, 30, 30, 30, 30, 30, 28, 22, 8, 22, 7, 15,
15, 15, 10, 10, 11, 15])
">HWI-EAS94_4_1_1_537_446 1\n"
">HWI-EAS94_4_1_1_537_446 1\n"
"30 30 30 30 30 30 30 30 30 30 "
"30 30 30 30 30 30 30 30 30 30\n"
"28 23 30 30 30 30 30 30 28 22 "
"8 22 7 15 15 15 10 10 11 15\n")
"@HWI-EAS94_4_1_1_537_446 1\n"
"@HWI-EAS94_4_1_1_537_446 1\n"
#Contig 2
record = next(records)
self.assertEqual(, "HWI-EAS94_4_1_1_602_99")
self.assertEqual(, "HWI-EAS94_4_1_1_602_99")
self.assertEqual(record.description, "HWI-EAS94_4_1_1_602_99 1")
[30, 30, 30, 30, 30, 30, 30, 30, 30, 30, 30, 30,
30, 30, 30, 30, 30, 30, 30, 30, 30, 30, 30, 30,
30, 30, 16, 30, 28, 22, 22, 22, 14, 15, 15, 5,
10, 15, 10, 5])
">HWI-EAS94_4_1_1_602_99 1\n"
">HWI-EAS94_4_1_1_602_99 1\n"
"30 30 30 30 30 30 30 30 30 30 "
"30 30 30 30 30 30 30 30 30 30\n"
"30 30 30 30 30 30 16 30 28 22 "
"22 22 14 15 15 5 10 15 10 5\n")
"@HWI-EAS94_4_1_1_602_99 1\n"
"@HWI-EAS94_4_1_1_602_99 1\n"
# Make sure that no further records are found
self.assertRaises(StopIteration, next, records)
if __name__ == "__main__":
runner = unittest.TextTestRunner(verbosity = 2)
Jump to Line
Something went wrong with that request. Please try again.