Skip to content
This repository
Fetching contributors…

Cannot retrieve contributors at this time

file 618 lines (513 sloc) 25.918 kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618
# Copyright 2008-2011 by Peter Cock.
# All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
"""Code for dealing with sequence alignments.

One of the most important things in this module is the MultipleSeqAlignment
class, used in the Bio.AlignIO module.

"""
__docformat__ = "epytext en" # Don't just use plain text in epydoc API pages!

from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio import Alphabet

#We only import this and subclass it for some limited backward compatibility.
from Bio.Align.Generic import Alignment as _Alignment


class MultipleSeqAlignment(_Alignment):
    """Represents a classical multiple sequence alignment (MSA).

By this we mean a collection of sequences (usually shown as rows) which
are all the same length (usually with gap characters for insertions or
padding). The data can then be regarded as a matrix of letters, with well
defined columns.

You would typically create an MSA by loading an alignment file with the
AlignIO module:

>>> from Bio import AlignIO
>>> align = AlignIO.read("Clustalw/opuntia.aln", "clustal")
>>> print align
SingleLetterAlphabet() alignment with 7 rows and 156 columns
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191
TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191

In some respects you can treat these objects as lists of SeqRecord objects,
each representing a row of the alignment. Iterating over an alignment gives
the SeqRecord object for each row:

>>> len(align)
7
>>> for record in align:
... print record.id, len(record)
gi|6273285|gb|AF191659.1|AF191 156
gi|6273284|gb|AF191658.1|AF191 156
gi|6273287|gb|AF191661.1|AF191 156
gi|6273286|gb|AF191660.1|AF191 156
gi|6273290|gb|AF191664.1|AF191 156
gi|6273289|gb|AF191663.1|AF191 156
gi|6273291|gb|AF191665.1|AF191 156

You can also access individual rows as SeqRecord objects via their index:

>>> print align[0].id
gi|6273285|gb|AF191659.1|AF191
>>> print align[-1].id
gi|6273291|gb|AF191665.1|AF191

And extract columns as strings:

>>> print align[:,1]
AAAAAAA

Or, take just the first ten columns as a sub-alignment:

>>> print align[:,:10]
SingleLetterAlphabet() alignment with 7 rows and 10 columns
TATACATTAA gi|6273285|gb|AF191659.1|AF191
TATACATTAA gi|6273284|gb|AF191658.1|AF191
TATACATTAA gi|6273287|gb|AF191661.1|AF191
TATACATAAA gi|6273286|gb|AF191660.1|AF191
TATACATTAA gi|6273290|gb|AF191664.1|AF191
TATACATTAA gi|6273289|gb|AF191663.1|AF191
TATACATTAA gi|6273291|gb|AF191665.1|AF191

Combining this alignment slicing with alignment addition allows you to
remove a section of the alignment. For example, taking just the first
and last ten columns:

>>> print align[:,:10] + align[:,-10:]
SingleLetterAlphabet() alignment with 7 rows and 20 columns
TATACATTAAGTGTACCAGA gi|6273285|gb|AF191659.1|AF191
TATACATTAAGTGTACCAGA gi|6273284|gb|AF191658.1|AF191
TATACATTAAGTGTACCAGA gi|6273287|gb|AF191661.1|AF191
TATACATAAAGTGTACCAGA gi|6273286|gb|AF191660.1|AF191
TATACATTAAGTGTACCAGA gi|6273290|gb|AF191664.1|AF191
TATACATTAAGTATACCAGA gi|6273289|gb|AF191663.1|AF191
TATACATTAAGTGTACCAGA gi|6273291|gb|AF191665.1|AF191

Note - This object is intended to replace the existing Alignment object
defined in module Bio.Align.Generic but is not fully backwards compatible
with it.

Note - This object does NOT attempt to model the kind of alignments used
in next generation sequencing with multiple sequencing reads which are
much shorter than the alignment, and where there is usually a consensus or
reference sequence with special status.
"""

    def __init__(self, records, alphabet=None):
        """Initialize a new MultipleSeqAlignment object.

Arguments:
- records - A list (or iterator) of SeqRecord objects, whose
sequences are all the same length. This may be an be an
empty list.
- alphabet - The alphabet for the whole alignment, typically a gapped
alphabet, which should be a super-set of the individual
record alphabets. If omitted, a consensus alphabet is
used.

You would normally load a MSA from a file using Bio.AlignIO, but you
can do this from a list of SeqRecord objects too:

>>> from Bio.Alphabet import generic_dna
>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha")
>>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta")
>>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma")
>>> align = MultipleSeqAlignment([a, b, c])
>>> print align
DNAAlphabet() alignment with 3 rows and 7 columns
AAAACGT Alpha
AAA-CGT Beta
AAAAGGT Gamma

NOTE - The older Bio.Align.Generic.Alignment class only accepted a
single argument, an alphabet. This is still supported via a backwards
compatible "hack" so as not to disrupt existing scripts and users, but
is deprecated and will be removed in a future release.
"""
        if isinstance(records, Alphabet.Alphabet) \
        or isinstance(records, Alphabet.AlphabetEncoder):
            if alphabet is None:
                #TODO - Remove this backwards compatible mode!
                alphabet = records
                records = []
                import warnings
                warnings.warn("Invalid records argument: While the old "
                              "Bio.Align.Generic.Alignment class only "
                              "accepted a single argument (the alphabet), the "
                              "newer Bio.Align.MultipleSeqAlignment class "
                              "expects a list/iterator of SeqRecord objects "
                              "(which can be an empty list) and an optional "
                              "alphabet argument")
            else :
                raise ValueError("Invalid records argument")
        if alphabet is not None :
            if not (isinstance(alphabet, Alphabet.Alphabet)
            or isinstance(alphabet, Alphabet.AlphabetEncoder)):
                raise ValueError("Invalid alphabet argument")
            self._alphabet = alphabet
        else :
            #Default while we add sequences, will take a consensus later
            self._alphabet = Alphabet.single_letter_alphabet

        self._records = []
        if records:
            self.extend(records)
            if alphabet is None:
                #No alphabet was given, take a consensus alphabet
                self._alphabet = Alphabet._consensus_alphabet(rec.seq.alphabet for
                                                              rec in self._records
                                                              if rec.seq is not None)

    def extend(self, records):
        """Add more SeqRecord objects to the alignment as rows.

They must all have the same length as the original alignment, and have
alphabets compatible with the alignment's alphabet. For example,

>>> from Bio.Alphabet import generic_dna
>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> from Bio.Align import MultipleSeqAlignment
>>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha")
>>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta")
>>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma")
>>> d = SeqRecord(Seq("AAAACGT", generic_dna), id="Delta")
>>> e = SeqRecord(Seq("AAA-GGT", generic_dna), id="Epsilon")

First we create a small alignment (three rows):

>>> align = MultipleSeqAlignment([a, b, c])
>>> print align
DNAAlphabet() alignment with 3 rows and 7 columns
AAAACGT Alpha
AAA-CGT Beta
AAAAGGT Gamma

Now we can extend this alignment with another two rows:

>>> align.extend([d, e])
>>> print align
DNAAlphabet() alignment with 5 rows and 7 columns
AAAACGT Alpha
AAA-CGT Beta
AAAAGGT Gamma
AAAACGT Delta
AAA-GGT Epsilon

Because the alignment object allows iteration over the rows as
SeqRecords, you can use the extend method with a second alignment
(provided its sequences have the same length as the original alignment).
"""
        if len(self):
            #Use the standard method to get the length
            expected_length = self.get_alignment_length()
        else:
            #Take the first record's length
            records = iter(records) # records arg could be list or iterator
            try:
                rec = records.next()
            except StopIteration:
                #Special case, no records
                return
            expected_length = len(rec)
            self._append(rec, expected_length)
            #Now continue to the rest of the records as usual

        for rec in records:
            self._append(rec, expected_length)

    def append(self, record):
        """Add one more SeqRecord object to the alignment as a new row.

This must have the same length as the original alignment (unless this is
the first record), and have an alphabet compatible with the alignment's
alphabet.

>>> from Bio import AlignIO
>>> align = AlignIO.read("Clustalw/opuntia.aln", "clustal")
>>> print align
SingleLetterAlphabet() alignment with 7 rows and 156 columns
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191
TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191
>>> len(align)
7

We'll now construct a dummy record to append as an example:

>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> dummy = SeqRecord(Seq("N"*156), id="dummy")

Now append this to the alignment,

>>> align.append(dummy)
>>> print align
SingleLetterAlphabet() alignment with 8 rows and 156 columns
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191
TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191
TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191
TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...NNN dummy
>>> len(align)
8

"""
        if self._records:
            self._append(record, self.get_alignment_length())
        else:
            self._append(record)

    def _append(self, record, expected_length=None):
        """Helper function (PRIVATE)."""
        if not isinstance(record, SeqRecord):
            raise TypeError("New sequence is not a SeqRecord object")

        #Currently the get_alignment_length() call is expensive, so we need
        #to avoid calling it repeatedly for __init__ and extend, hence this
        #private _append method
        if expected_length is not None and len(record) != expected_length:
            #TODO - Use the following more helpful error, but update unit tests
            #raise ValueError("New sequence is not of length %i" \
            # % self.get_alignment_length())
            raise ValueError("Sequences must all be the same length")

        #Using not self.alphabet.contains(record.seq.alphabet) needs fixing
        #for AlphabetEncoders (e.g. gapped versus ungapped).
        if not Alphabet._check_type_compatible([self._alphabet, record.seq.alphabet]):
            raise ValueError("New sequence's alphabet is incompatible")
        self._records.append(record)

    def __add__(self, other):
        """Combines to alignments with the same number of rows by adding them.

If you have two multiple sequence alignments (MSAs), there are two ways to think
about adding them - by row or by column. Using the extend method adds by row.
Using the addition operator adds by column. For example,

>>> from Bio.Alphabet import generic_dna
>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> from Bio.Align import MultipleSeqAlignment
>>> a1 = SeqRecord(Seq("AAAAC", generic_dna), id="Alpha")
>>> b1 = SeqRecord(Seq("AAA-C", generic_dna), id="Beta")
>>> c1 = SeqRecord(Seq("AAAAG", generic_dna), id="Gamma")
>>> a2 = SeqRecord(Seq("GT", generic_dna), id="Alpha")
>>> b2 = SeqRecord(Seq("GT", generic_dna), id="Beta")
>>> c2 = SeqRecord(Seq("GT", generic_dna), id="Gamma")
>>> left = MultipleSeqAlignment([a1, b1, c1])
>>> right = MultipleSeqAlignment([a2, b2, c2])

Now, let's look at these two alignments:

>>> print left
DNAAlphabet() alignment with 3 rows and 5 columns
AAAAC Alpha
AAA-C Beta
AAAAG Gamma
>>> print right
DNAAlphabet() alignment with 3 rows and 2 columns
GT Alpha
GT Beta
GT Gamma

And add them:

>>> print left + right
DNAAlphabet() alignment with 3 rows and 7 columns
AAAACGT Alpha
AAA-CGT Beta
AAAAGGT Gamma

For this to work, both alignments must have the same number of records (here
they both have 3 rows):

>>> len(left)
3
>>> len(right)
3

The individual rows are SeqRecord objects, and these can be added together. Refer
to the SeqRecord documentation for details of how the annotation is handled. This
example is a special case in that both original alignments shared the same names,
meaning when the rows are added they also get the same name.
"""
        if not isinstance(other, MultipleSeqAlignment):
            raise NotImplementedError
        if len(self) != len(other):
            raise ValueError("When adding two alignments they must have the same length"
                             " (i.e. same number or rows)")
        alpha = Alphabet._consensus_alphabet([self._alphabet, other._alphabet])
        merged = (left+right for left,right in zip(self, other))
        return MultipleSeqAlignment(merged, alpha)

    def __getitem__(self, index):
        """Access part of the alignment.

Depending on the indices, you can get a SeqRecord object
(representing a single row), a Seq object (for a single columns),
a string (for a single characters) or another alignment
(representing some part or all of the alignment).

align[r,c] gives a single character as a string
align[r] gives a row as a SeqRecord
align[r,:] gives a row as a SeqRecord
align[:,c] gives a column as a Seq (using the alignment's alphabet)

align[:] and align[:,:] give a copy of the alignment

Anything else gives a sub alignment, e.g.
align[0:2] or align[0:2,:] uses only row 0 and 1
align[:,1:3] uses only columns 1 and 2
align[0:2,1:3] uses only rows 0 & 1 and only cols 1 & 2

We'll use the following example alignment here for illustration:

>>> from Bio.Alphabet import generic_dna
>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> from Bio.Align import MultipleSeqAlignment
>>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha")
>>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta")
>>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma")
>>> d = SeqRecord(Seq("AAAACGT", generic_dna), id="Delta")
>>> e = SeqRecord(Seq("AAA-GGT", generic_dna), id="Epsilon")
>>> align = MultipleSeqAlignment([a, b, c, d, e], generic_dna)

You can access a row of the alignment as a SeqRecord using an integer
index (think of the alignment as a list of SeqRecord objects here):

>>> first_record = align[0]
>>> print first_record.id, first_record.seq
Alpha AAAACGT
>>> last_record = align[-1]
>>> print last_record.id, last_record.seq
Epsilon AAA-GGT

You can also access use python's slice notation to create a sub-alignment
containing only some of the SeqRecord objects:

>>> sub_alignment = align[2:5]
>>> print sub_alignment
DNAAlphabet() alignment with 3 rows and 7 columns
AAAAGGT Gamma
AAAACGT Delta
AAA-GGT Epsilon

This includes support for a step, i.e. align[start:end:step], which
can be used to select every second sequence:

>>> sub_alignment = align[::2]
>>> print sub_alignment
DNAAlphabet() alignment with 3 rows and 7 columns
AAAACGT Alpha
AAAAGGT Gamma
AAA-GGT Epsilon

Or to get a copy of the alignment with the rows in reverse order:

>>> rev_alignment = align[::-1]
>>> print rev_alignment
DNAAlphabet() alignment with 5 rows and 7 columns
AAA-GGT Epsilon
AAAACGT Delta
AAAAGGT Gamma
AAA-CGT Beta
AAAACGT Alpha

You can also use two indices to specify both rows and columns. Using simple
integers gives you the entry as a single character string. e.g.

>>> align[3,4]
'C'

This is equivalent to:

>>> align[3][4]
'C'

or:

>>> align[3].seq[4]
'C'

To get a single column (as a string) use this syntax:

>>> align[:,4]
'CCGCG'

Or, to get part of a column,

>>> align[1:3,4]
'CG'

However, in general you get a sub-alignment,

>>> print align[1:5,3:6]
DNAAlphabet() alignment with 4 rows and 3 columns
-CG Beta
AGG Gamma
ACG Delta
-GG Epsilon

This should all seem familiar to anyone who has used the NumPy
array or matrix objects.
"""
        if isinstance(index, int):
            #e.g. result = align[x]
            #Return a SeqRecord
            return self._records[index]
        elif isinstance(index, slice):
            #e.g. sub_align = align[i:j:k]
            return MultipleSeqAlignment(self._records[index], self._alphabet)
        elif len(index)!=2:
            raise TypeError("Invalid index type.")

        #Handle double indexing
        row_index, col_index = index
        if isinstance(row_index, int):
            #e.g. row_or_part_row = align[6, 1:4], gives a SeqRecord
            return self._records[row_index][col_index]
        elif isinstance(col_index, int):
            #e.g. col_or_part_col = align[1:5, 6], gives a string
            return "".join(rec[col_index] for rec in self._records[row_index])
        else:
            #e.g. sub_align = align[1:4, 5:7], gives another alignment
            return MultipleSeqAlignment((rec[col_index] for rec in self._records[row_index]),
                                        self._alphabet)

    def sort(self, key=None, reverse=False):
        """Sort the rows (SeqRecord objects) of the alignment in place.

This sorts the rows alphabetically using the SeqRecord object id by
default. The sorting can be controlled by supplying a key function
which must map each SeqRecord to a sort value.

This is useful if you want to add two alignments which use the same
record identifiers, but in a different order. For example,

>>> from Bio.Alphabet import generic_dna
>>> from Bio.Seq import Seq
>>> from Bio.SeqRecord import SeqRecord
>>> from Bio.Align import MultipleSeqAlignment
>>> align1 = MultipleSeqAlignment([
... SeqRecord(Seq("ACGT", generic_dna), id="Human"),
... SeqRecord(Seq("ACGG", generic_dna), id="Mouse"),
... SeqRecord(Seq("ACGC", generic_dna), id="Chicken"),
... ])
>>> align2 = MultipleSeqAlignment([
... SeqRecord(Seq("CGGT", generic_dna), id="Mouse"),
... SeqRecord(Seq("CGTT", generic_dna), id="Human"),
... SeqRecord(Seq("CGCT", generic_dna), id="Chicken"),
... ])

If you simple try and add these without sorting, you get this:

>>> print align1 + align2
DNAAlphabet() alignment with 3 rows and 8 columns
ACGTCGGT <unknown id>
ACGGCGTT <unknown id>
ACGCCGCT Chicken

Consult the SeqRecord documentation which explains why you get a
default value when annotation like the identifier doesn't match up.
However, if we sort the alignments first, then add them we get the
desired result:

>>> align1.sort()
>>> align2.sort()
>>> print align1 + align2
DNAAlphabet() alignment with 3 rows and 8 columns
ACGCCGCT Chicken
ACGTCGTT Human
ACGGCGGT Mouse

As an example using a different sort order, you could sort on the
GC content of each sequence.

>>> from Bio.SeqUtils import GC
>>> print align1
DNAAlphabet() alignment with 3 rows and 4 columns
ACGC Chicken
ACGT Human
ACGG Mouse
>>> align1.sort(key = lambda record: GC(record.seq))
>>> print align1
DNAAlphabet() alignment with 3 rows and 4 columns
ACGT Human
ACGC Chicken
ACGG Mouse

There is also a reverse argument, so if you wanted to sort by ID
but backwards:

>>> align1.sort(reverse=True)
>>> print align1
DNAAlphabet() alignment with 3 rows and 4 columns
ACGG Mouse
ACGT Human
ACGC Chicken

"""
        if key is None:
            self._records.sort(key = lambda r: r.id, reverse = reverse)
        else:
            self._records.sort(key = key, reverse = reverse)

    def get_column(self, col):
        """Returns a string containing a given column (DEPRECATED).

This is a method provided for backwards compatibility with the old
Bio.Align.Generic.Alignment object. Please use the slice notation
instead, since get_column is likely to be removed in a future release
of Biopython..
"""
        import warnings
        import Bio
        warnings.warn("This method is deprecated and is provided for backwards compatibility with the old Bio.Align.Generic.Alignment object. Please use the slice notation instead, as get_column is likely to be removed in a future release of Biopython.", Bio.BiopythonDeprecationWarning)
        return _Alignment.get_column(self, col)

    def add_sequence(self, descriptor, sequence, start = None, end = None,
                     weight = 1.0):
        """Add a sequence to the alignment (DEPRECATED).

The start, end, and weight arguments are not supported! This method
only provides limited backwards compatibility with the old
Bio.Align.Generic.Alignment object. Please use the append method with
a SeqRecord instead, since add_sequence is likely to be removed in a
future release of Biopython.
"""
        import warnings
        import Bio
        warnings.warn("The start, end, and weight arguments are not supported! This method only provides limited backwards compatibility with the old Bio.Align.Generic.Alignment object. Please use the append method with a SeqRecord instead, as the add_sequence method is likely to be removed in a future release of Biopython.", Bio.BiopythonDeprecationWarning)
        #Should we handle start/end/strand information somehow? What for?
        #TODO - Should we handle weights somehow? See also AlignInfo code...
        if start is not None or end is not None or weight != 1.0:
            raise ValueError("The add_Sequence method is obsolete, and only "
                             "provides limited backwards compatibily. The"
                             "start, end and weight arguments are not "
                             "supported.")
        self.append(SeqRecord(Seq(sequence, self._alphabet),
                              id = descriptor, description = descriptor))


if __name__ == "__main__":
    from Bio._utils import run_doctest
    run_doctest()
Something went wrong with that request. Please try again.