Permalink
Fetching contributors…
Cannot retrieve contributors at this time
3549 lines (3545 sloc) 134 KB
<?xml version="1.0"?>
<!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "NCBI_BlastOutput.dtd">
<BlastOutput>
<BlastOutput_program>blastn</BlastOutput_program>
<BlastOutput_version>BLASTN 2.2.27+</BlastOutput_version>
<BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&amp;auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), &quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search programs&quot;, Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
<BlastOutput_db>refseq_rna</BlastOutput_db>
<BlastOutput_query-ID>42291</BlastOutput_query-ID>
<BlastOutput_query-def>mystery_seq</BlastOutput_query-def>
<BlastOutput_query-len>61</BlastOutput_query-len>
<BlastOutput_param>
<Parameters>
<Parameters_expect>10</Parameters_expect>
<Parameters_sc-match>2</Parameters_sc-match>
<Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
<Parameters_gap-open>5</Parameters_gap-open>
<Parameters_gap-extend>2</Parameters_gap-extend>
<Parameters_filter>L;m;</Parameters_filter>
</Parameters>
</BlastOutput_param>
<BlastOutput_iterations>
<Iteration>
<Iteration_iter-num>1</Iteration_iter-num>
<Iteration_query-ID>42291</Iteration_query-ID>
<Iteration_query-def>mystery_seq</Iteration_query-def>
<Iteration_query-len>61</Iteration_query-len>
<Iteration_hits>
<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gi|262205317|ref|NR_030195.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520b (MIR520B), microRNA</Hit_def>
<Hit_accession>NR_030195</Hit_accession>
<Hit_len>61</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>111.292</Hsp_bit-score>
<Hsp_score>122</Hsp_score>
<Hsp_evalue>4.91307e-23</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>1</Hsp_hit-from>
<Hsp_hit-to>61</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>61</Hsp_identity>
<Hsp_positive>61</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>2</Hit_num>
<Hit_id>gi|301171311|ref|NR_035856.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520b (MIR520B), microRNA</Hit_def>
<Hit_accession>NR_035856</Hit_accession>
<Hit_len>60</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>109.488</Hsp_bit-score>
<Hsp_score>120</Hsp_score>
<Hsp_evalue>1.71483e-22</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>1</Hsp_hit-from>
<Hsp_hit-to>60</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>60</Hsp_identity>
<Hsp_positive>60</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_hseq>
<Hsp_midline>||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>3</Hit_num>
<Hit_id>gi|270133242|ref|NR_032573.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-519a (MIR519A), microRNA</Hit_def>
<Hit_accession>NR_032573</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>102.275</Hsp_bit-score>
<Hsp_score>112</Hsp_score>
<Hsp_evalue>2.54503e-20</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>59</Hsp_identity>
<Hsp_positive>59</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTGGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>4</Hit_num>
<Hit_id>gi|301171322|ref|NR_035857.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520c (MIR520C), microRNA</Hit_def>
<Hit_accession>NR_035857</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>100.472</Hsp_bit-score>
<Hsp_score>110</Hsp_score>
<Hsp_evalue>8.88303e-20</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>58</Hsp_identity>
<Hsp_positive>58</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAGAGGGAAGCACTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>55.3874</Hsp_bit-score>
<Hsp_score>60</Hsp_score>
<Hsp_evalue>3.31332e-06</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>73</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAAAAGGAAGCACTTTCTTTTCTTTCAGACAACAGAAAGTGCTTCCCTCTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| | |||||| |||||| || | | | | || ||||||||||||| | ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>5</Hit_num>
<Hit_id>gi|301171267|ref|NR_035851.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-519b (MIR519B), microRNA</Hit_def>
<Hit_accession>NR_035851</Hit_accession>
<Hit_len>80</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>100.472</Hsp_bit-score>
<Hsp_score>110</Hsp_score>
<Hsp_evalue>8.88303e-20</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>10</Hsp_hit-from>
<Hsp_hit-to>69</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>58</Hsp_identity>
<Hsp_positive>58</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCATCCTTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>6</Hit_num>
<Hit_id>gi|262205330|ref|NR_030198.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520c (MIR520C), microRNA</Hit_def>
<Hit_accession>NR_030198</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>100.472</Hsp_bit-score>
<Hsp_score>110</Hsp_score>
<Hsp_evalue>8.88303e-20</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>15</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>58</Hsp_identity>
<Hsp_positive>58</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAGAGGGAAGCACTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>55.3874</Hsp_bit-score>
<Hsp_score>60</Hsp_score>
<Hsp_evalue>3.31332e-06</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>74</Hsp_hit-from>
<Hsp_hit-to>15</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAAAAGGAAGCACTTTCTTTTCTTTCAGACAACAGAAAGTGCTTCCCTCTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| | |||||| |||||| || | | | | || ||||||||||||| | ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>7</Hit_num>
<Hit_id>gi|262205302|ref|NR_030191.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 519b (MIR519B), microRNA</Hit_def>
<Hit_accession>NR_030191</Hit_accession>
<Hit_len>81</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>100.472</Hsp_bit-score>
<Hsp_score>110</Hsp_score>
<Hsp_evalue>8.88303e-20</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>11</Hsp_hit-from>
<Hsp_hit-to>70</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>58</Hsp_identity>
<Hsp_positive>58</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCATCCTTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>8</Hit_num>
<Hit_id>gi|301171259|ref|NR_035850.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-519a (MIR519A), microRNA</Hit_def>
<Hit_accession>NR_035850</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>98.6682</Hsp_bit-score>
<Hsp_score>108</Hsp_score>
<Hsp_evalue>3.10048e-19</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>57</Hsp_identity>
<Hsp_positive>57</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAGGAAAGTGCATCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>9</Hit_num>
<Hit_id>gi|262205451|ref|NR_030222.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 519a-2 (MIR519A2), microRNA</Hit_def>
<Hit_accession>NR_030222</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>98.6682</Hsp_bit-score>
<Hsp_score>108</Hsp_score>
<Hsp_evalue>3.10048e-19</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>57</Hsp_identity>
<Hsp_positive>57</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAGGAAAGTGCATCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>10</Hit_num>
<Hit_id>gi|301171447|ref|NR_035871.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-526b (MIR526B), microRNA</Hit_def>
<Hit_accession>NR_035871</Hit_accession>
<Hit_len>82</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>95.0615</Hsp_bit-score>
<Hsp_score>104</Hsp_score>
<Hsp_evalue>3.77716e-18</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>11</Hsp_hit-from>
<Hsp_hit-to>70</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>57</Hsp_identity>
<Hsp_positive>57</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTTGAGGGAAGCACTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_hseq>
<Hsp_midline>|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>49.9773</Hsp_bit-score>
<Hsp_score>54</Hsp_score>
<Hsp_evalue>0.000140886</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>70</Hsp_hit-from>
<Hsp_hit-to>11</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>47</Hsp_identity>
<Hsp_positive>47</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAAGGAAGCACTTTCTTTTCTTTCAGACAACAGAAAGTGCTTCCCTCAAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || ||||||||||||| | ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>11</Hit_num>
<Hit_id>gi|301171276|ref|NR_035852.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-519c (MIR519C), microRNA</Hit_def>
<Hit_accession>NR_035852</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>95.0615</Hsp_bit-score>
<Hsp_score>104</Hsp_score>
<Hsp_evalue>3.77716e-18</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>57</Hsp_identity>
<Hsp_positive>57</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCATCTTTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>12</Hit_num>
<Hit_id>gi|262205290|ref|NR_030188.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 519c (MIR519C), microRNA</Hit_def>
<Hit_accession>NR_030188</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>95.0615</Hsp_bit-score>
<Hsp_score>104</Hsp_score>
<Hsp_evalue>3.77716e-18</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>57</Hsp_identity>
<Hsp_positive>57</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCATCTTTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>13</Hit_num>
<Hit_id>gi|301171354|ref|NR_035860.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520f (MIR520F), microRNA</Hit_def>
<Hit_accession>NR_035860</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>93.2581</Hsp_bit-score>
<Hsp_score>102</Hsp_score>
<Hsp_evalue>1.31836e-17</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>57</Hsp_identity>
<Hsp_positive>57</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAAAGGGAAGCGCTTTCTGTGGTCAGAAAGAAAAGCAAGTGCTTCCTTTTAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||| ||| |||||||||| ||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>14</Hit_num>
<Hit_id>gi|262205281|ref|NR_030186.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520f (MIR520F), microRNA</Hit_def>
<Hit_accession>NR_030186</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>93.2581</Hsp_bit-score>
<Hsp_score>102</Hsp_score>
<Hsp_evalue>1.31836e-17</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>57</Hsp_identity>
<Hsp_positive>57</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAAAGGGAAGCGCTTTCTGTGGTCAGAAAGAAAAGCAAGTGCTTCCTTTTAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||| ||| |||||||||| ||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>15</Hit_num>
<Hit_id>gi|262205298|ref|NR_030190.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 526b (MIR526B), microRNA</Hit_def>
<Hit_accession>NR_030190</Hit_accession>
<Hit_len>83</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>91.4547</Hsp_bit-score>
<Hsp_score>100</Hsp_score>
<Hsp_evalue>4.60152e-17</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>56</Hsp_identity>
<Hsp_positive>56</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTTGAGGGAAGCACTTTCTGTTGTCTGAAAGAAGAGAAAGTGCTTCCTTTTAGAGG</Hsp_hseq>
<Hsp_midline>|||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>49.9773</Hsp_bit-score>
<Hsp_score>54</Hsp_score>
<Hsp_evalue>0.000140886</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>71</Hsp_hit-from>
<Hsp_hit-to>12</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>47</Hsp_identity>
<Hsp_positive>47</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAAGGAAGCACTTTCTCTTCTTTCAGACAACAGAAAGTGCTTCCCTCAAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || ||||||||||||| | ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>16</Hit_num>
<Hit_id>gi|301171394|ref|NR_035865.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-522 (MIR522), microRNA</Hit_def>
<Hit_accession>NR_035865</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>89.6514</Hsp_bit-score>
<Hsp_score>98</Hsp_score>
<Hsp_evalue>1.60609e-16</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>55</Hsp_identity>
<Hsp_positive>55</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAATGGTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||||||||||||||||||| || |||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>17</Hit_num>
<Hit_id>gi|262205429|ref|NR_030218.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 519a-1 (MIR519A1), microRNA</Hit_def>
<Hit_accession>NR_030218</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>89.6514</Hsp_bit-score>
<Hsp_score>98</Hsp_score>
<Hsp_evalue>1.60609e-16</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>15</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAGGAAAGTGCATCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>18</Hit_num>
<Hit_id>gi|262205423|ref|NR_030217.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 522 (MIR522), microRNA</Hit_def>
<Hit_accession>NR_030217</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>89.6514</Hsp_bit-score>
<Hsp_score>98</Hsp_score>
<Hsp_evalue>1.60609e-16</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>55</Hsp_identity>
<Hsp_positive>55</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAATGGTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||||||||||||||||||| || |||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>19</Hit_num>
<Hit_id>gi|301171401|ref|NR_035866.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-523 (MIR523), microRNA</Hit_def>
<Hit_accession>NR_035866</Hit_accession>
<Hit_len>79</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>87.848</Hsp_bit-score>
<Hsp_score>96</Hsp_score>
<Hsp_evalue>5.6058e-16</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>6</Hsp_hit-from>
<Hsp_hit-to>66</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>56</Hsp_identity>
<Hsp_positive>56</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAACGCGCTTCCCTATAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||||||||||||||||||||||||||||| | |||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>20</Hit_num>
<Hit_id>gi|270133247|ref|NR_032574.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-519b (MIR519B), microRNA</Hit_def>
<Hit_accession>NR_032574</Hit_accession>
<Hit_len>81</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>87.848</Hsp_bit-score>
<Hsp_score>96</Hsp_score>
<Hsp_evalue>5.6058e-16</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>11</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>56</Hsp_identity>
<Hsp_positive>56</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTGGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAACGTGCATCCCTTTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| |||||||||||||||||||||||||||||||||| |||| ||| |||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>21</Hit_num>
<Hit_id>gi|262205309|ref|NR_030193.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 523 (MIR523), microRNA</Hit_def>
<Hit_accession>NR_030193</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>87.848</Hsp_bit-score>
<Hsp_score>96</Hsp_score>
<Hsp_evalue>5.6058e-16</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>56</Hsp_identity>
<Hsp_positive>56</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAACGCGCTTCCCTATAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||||||||||||||||||||||||||||| | |||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>22</Hit_num>
<Hit_id>gi|270132717|ref|NR_032716.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-526b (MIR526B), microRNA</Hit_def>
<Hit_accession>NR_032716</Hit_accession>
<Hit_len>83</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>86.0446</Hsp_bit-score>
<Hsp_score>94</Hsp_score>
<Hsp_evalue>1.95662e-15</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>55</Hsp_identity>
<Hsp_positive>55</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTTGAGGGAAGCACTTTCTGTTGTCTGAATAAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_hseq>
<Hsp_midline>|||||| |||||||| |||||||||||||||| |||||||||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>71</Hsp_hit-from>
<Hsp_hit-to>12</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAAGGAAGCACTTTCTTTTTATTCAGACAACAGAAAGTGCTTCCCTCAAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | || ||||||||||||| | ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>23</Hit_num>
<Hit_id>gi|301171437|ref|NR_035870.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-526a-2 (MIR526A-2), microRNA</Hit_def>
<Hit_accession>NR_035870</Hit_accession>
<Hit_len>68</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>84.2413</Hsp_bit-score>
<Hsp_score>92</Hsp_score>
<Hsp_evalue>6.82927e-15</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>4</Hsp_hit-from>
<Hsp_hit-to>64</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>55</Hsp_identity>
<Hsp_positive>55</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTGTTGTCTGAAAGAAAAGAACATGCATCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| ||||||||||||||||||||||||| ||| |||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>39.157</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>0.254728</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>64</Hsp_hit-from>
<Hsp_hit-to>4</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>45</Hsp_identity>
<Hsp_positive>45</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGATGCATGTTCTTTTCTTTCAGACAACAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| | ||| || |||| || | | | | || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>24</Hit_num>
<Hit_id>gi|270133306|ref|NR_032587.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-523a (MIR523A), microRNA</Hit_def>
<Hit_accession>NR_032587</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>84.2413</Hsp_bit-score>
<Hsp_score>92</Hsp_score>
<Hsp_evalue>6.82927e-15</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>55</Hsp_identity>
<Hsp_positive>55</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTGTTGTCTGGAAGAAAAGAATGCGCTTCCCTTTAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| |||||||||||||| |||||||||| | |||||| |||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>57.1907</Hsp_bit-score>
<Hsp_score>62</Hsp_score>
<Hsp_evalue>9.49283e-07</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>74</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAAAGGGAAGCGCATTCTTTTCTTCCAGACAACAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||||| |||| || | | | || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>25</Hit_num>
<Hit_id>gi|301171428|ref|NR_035869.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-526a-1 (MIR526A-1), microRNA</Hit_def>
<Hit_accession>NR_035869</Hit_accession>
<Hit_len>84</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTGTTGCTTGAAAGAAGAGAAAGCGCTTCCTTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| |||||||||| |||||||| |||||| |||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>58.9941</Hsp_bit-score>
<Hsp_score>64</Hsp_score>
<Hsp_evalue>2.71974e-07</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>71</Hsp_hit-from>
<Hsp_hit-to>12</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAAGGAAGCGCTTTCTCTTCTTTCAAGCAACAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| | ||||||||||||| || | | || || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>26</Hit_num>
<Hit_id>gi|301171211|ref|NR_035845.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-518b (MIR518B), microRNA</Hit_def>
<Hit_accession>NR_035845</Hit_accession>
<Hit_len>82</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>11</Hsp_hit-from>
<Hsp_hit-to>70</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCCAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAACAAAGCGCTCCCCTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||| | ||||||||||||||||||||||||||||||| |||| ||| || ||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>27</Hit_num>
<Hit_id>gi|301171153|ref|NR_035838.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-516a-2 (MIR516A-2), microRNA</Hit_def>
<Hit_accession>NR_035838</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>27</Hsp_hit-from>
<Hsp_hit-to>76</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||||||||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>42.7638</Hsp_bit-score>
<Hsp_score>46</Hsp_score>
<Hsp_evalue>0.0209094</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>53</Hsp_query-to>
<Hsp_hit-from>76</Hsp_hit-from>
<Hsp_hit-to>24</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>41</Hsp_identity>
<Hsp_positive>41</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>53</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTT</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGAAGCACTTTCTTTTCTTTCAGACAACAGAAAGTGCTTCTTT</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || |||||||||||| ||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>28</Hit_num>
<Hit_id>gi|301171146|ref|NR_035837.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-516a-1 (MIR516A-1), microRNA</Hit_def>
<Hit_accession>NR_035837</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>27</Hsp_hit-from>
<Hsp_hit-to>76</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||||||||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>42.7638</Hsp_bit-score>
<Hsp_score>46</Hsp_score>
<Hsp_evalue>0.0209094</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>53</Hsp_query-to>
<Hsp_hit-from>76</Hsp_hit-from>
<Hsp_hit-to>24</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>41</Hsp_identity>
<Hsp_positive>41</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>53</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTT</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGAAGCACTTTCTTTTCTTTCAGACAACAGAAAGTGCTTCTTT</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || |||||||||||| ||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>29</Hit_num>
<Hit_id>gi|270133254|ref|NR_032575.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-519c (MIR519C), microRNA</Hit_def>
<Hit_accession>NR_032575</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAAGGAAGCACTTTCTGTTGTTTGAAAGAAAAGAAAGTGCATCATTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| | |||||| ||||||||||| |||||||||||||||||| || |||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>55.3874</Hsp_bit-score>
<Hsp_score>60</Hsp_score>
<Hsp_evalue>3.31332e-06</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>73</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAATGATGCACTTTCTTTTCTTTCAAACAACAGAAAGTGCTTCCTTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| | || || |||||| || | | ||| || ||||||||||||||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>30</Hit_num>
<Hit_id>gi|262205445|ref|NR_030221.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 516a-2 (MIR516A2), microRNA</Hit_def>
<Hit_accession>NR_030221</Hit_accession>
<Hit_len>90</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>28</Hsp_hit-from>
<Hsp_hit-to>77</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||||||||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>42.7638</Hsp_bit-score>
<Hsp_score>46</Hsp_score>
<Hsp_evalue>0.0209094</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>53</Hsp_query-to>
<Hsp_hit-from>77</Hsp_hit-from>
<Hsp_hit-to>25</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>41</Hsp_identity>
<Hsp_positive>41</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>53</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTT</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGAAGCACTTTCTTTTCTTTCAGACAACAGAAAGTGCTTCTTT</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || |||||||||||| ||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>31</Hit_num>
<Hit_id>gi|262205441|ref|NR_030220.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 516a-1 (MIR516A1), microRNA</Hit_def>
<Hit_accession>NR_030220</Hit_accession>
<Hit_len>90</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>28</Hsp_hit-from>
<Hsp_hit-to>77</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||||||||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>42.7638</Hsp_bit-score>
<Hsp_score>46</Hsp_score>
<Hsp_evalue>0.0209094</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>53</Hsp_query-to>
<Hsp_hit-from>77</Hsp_hit-from>
<Hsp_hit-to>25</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>41</Hsp_identity>
<Hsp_positive>41</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>53</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTT</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGAAGCACTTTCTTTTCTTTCAGACAACAGAAAGTGCTTCTTT</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || |||||||||||| ||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>32</Hit_num>
<Hit_id>gi|262205325|ref|NR_030197.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 526a-1 (MIR526A1), microRNA</Hit_def>
<Hit_accession>NR_030197</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTGTTGCTTGAAAGAAGAGAAAGCGCTTCCTTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| |||||||||| |||||||| |||||| |||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>58.9941</Hsp_bit-score>
<Hsp_score>64</Hsp_score>
<Hsp_evalue>2.71974e-07</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>72</Hsp_hit-from>
<Hsp_hit-to>13</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAAGGAAGCGCTTTCTCTTCTTTCAAGCAACAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| | ||||||||||||| || | | || || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>33</Hit_num>
<Hit_id>gi|262205321|ref|NR_030196.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 518b (MIR518B), microRNA</Hit_def>
<Hit_accession>NR_030196</Hit_accession>
<Hit_len>83</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>82.4379</Hsp_bit-score>
<Hsp_score>90</Hsp_score>
<Hsp_evalue>2.38365e-14</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCCAGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAACAAAGCGCTCCCCTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||| | ||||||||||||||||||||||||||||||| |||| ||| || ||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>34</Hit_num>
<Hit_id>gi|301171236|ref|NR_035848.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-518e (MIR518E), microRNA</Hit_def>
<Hit_accession>NR_035848</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>80.6345</Hsp_bit-score>
<Hsp_score>88</Hsp_score>
<Hsp_evalue>8.31975e-14</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>53</Hsp_identity>
<Hsp_positive>53</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGGCTAAAAGAAAAGAAAGCGCTTCCCTTCAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||| || ||||||||||||| |||||| || ||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>48.1739</Hsp_bit-score>
<Hsp_score>52</Hsp_score>
<Hsp_evalue>0.000491741</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>71</Hsp_hit-from>
<Hsp_hit-to>13</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTGAAGGGAAGCGCTTTCTTTTCTTTTAGCCAACAGAAAGCGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||| ||||||||||||||| || | | | || |||||| |||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>35</Hit_num>
<Hit_id>gi|262205383|ref|NR_030209.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 518e (MIR518E), microRNA</Hit_def>
<Hit_accession>NR_030209</Hit_accession>
<Hit_len>88</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>80.6345</Hsp_bit-score>
<Hsp_score>88</Hsp_score>
<Hsp_evalue>8.31975e-14</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>53</Hsp_identity>
<Hsp_positive>53</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGCTTTCTGTTGGCTAAAAGAAAAGAAAGCGCTTCCCTTCAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||||||||||||| || ||||||||||||| |||||| || ||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>48.1739</Hsp_bit-score>
<Hsp_score>52</Hsp_score>
<Hsp_evalue>0.000491741</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>72</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTGAAGGGAAGCGCTTTCTTTTCTTTTAGCCAACAGAAAGCGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||| ||||||||||||||| || | | | || |||||| |||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>36</Hit_num>
<Hit_id>gi|301171342|ref|NR_035859.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520e (MIR520E), microRNA</Hit_def>
<Hit_accession>NR_035859</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>78.8312</Hsp_bit-score>
<Hsp_score>86</Hsp_score>
<Hsp_evalue>2.90388e-13</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCAAGATGGAAGCAGTTTCTGTTGTCTGAAAGGAAAGAAAGTGCTTCCTTTTTGAGGG</Hsp_hseq>
<Hsp_midline>||||| | | |||||| ||||||||||||||||| ||||||||||||||||||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>37</Hit_num>
<Hit_id>gi|262205265|ref|NR_030183.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520e (MIR520E), microRNA</Hit_def>
<Hit_accession>NR_030183</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>78.8312</Hsp_bit-score>
<Hsp_score>86</Hsp_score>
<Hsp_evalue>2.90388e-13</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCAAGATGGAAGCAGTTTCTGTTGTCTGAAAGGAAAGAAAGTGCTTCCTTTTTGAGGG</Hsp_hseq>
<Hsp_midline>||||| | | |||||| ||||||||||||||||| ||||||||||||||||||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>38</Hit_num>
<Hit_id>gi|301171247|ref|NR_035849.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-518f (MIR518F), microRNA</Hit_def>
<Hit_accession>NR_035849</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>77.0278</Hsp_bit-score>
<Hsp_score>84</Hsp_score>
<Hsp_evalue>1.01355e-12</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>53</Hsp_identity>
<Hsp_positive>53</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTCTTGTCTAAAAGAAAAGAAAGCGCTTCTCTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| |||||| |||||| ||||||||||||| ||||| ||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>58.9941</Hsp_bit-score>
<Hsp_score>64</Hsp_score>
<Hsp_evalue>2.71974e-07</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>72</Hsp_hit-from>
<Hsp_hit-to>13</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAGAGAAGCGCTTTCTTTTCTTTTAGACAAGAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| || |||||||||||| || | | | | || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>39</Hit_num>
<Hit_id>gi|270133223|ref|NR_032569.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-518c (MIR518C), microRNA</Hit_def>
<Hit_accession>NR_032569</Hit_accession>
<Hit_len>101</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>77.0278</Hsp_bit-score>
<Hsp_score>84</Hsp_score>
<Hsp_evalue>1.01355e-12</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>25</Hsp_hit-from>
<Hsp_hit-to>81</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>51</Hsp_identity>
<Hsp_positive>51</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCTGGAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAACAAAGCGCTTCTCTTTAGAG</Hsp_hseq>
<Hsp_midline>|||| ||||||||||||||||||||||||||||||| |||| ||||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>40</Hit_num>
<Hit_id>gi|262205313|ref|NR_030194.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 518f (MIR518F), microRNA</Hit_def>
<Hit_accession>NR_030194</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>77.0278</Hsp_bit-score>
<Hsp_score>84</Hsp_score>
<Hsp_evalue>1.01355e-12</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>53</Hsp_identity>
<Hsp_positive>53</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTCTTGTCTAAAAGAAAAGAAAGCGCTTCTCTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| |||||| |||||| ||||||||||||| ||||| ||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>58.9941</Hsp_bit-score>
<Hsp_score>64</Hsp_score>
<Hsp_evalue>2.71974e-07</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>73</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAGAGAAGCGCTTTCTTTTCTTTTAGACAAGAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>|||||| || |||||||||||| || | | | | || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>41</Hit_num>
<Hit_id>gi|301171225|ref|NR_035847.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-518d (MIR518D), microRNA</Hit_def>
<Hit_accession>NR_035847</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>75.2244</Hsp_bit-score>
<Hsp_score>82</Hsp_score>
<Hsp_evalue>3.53765e-12</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTGTTGTCTGAAAGAAACCAAAGCGCTTCCCTTTGGAG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| ||||||||||||||||||||| |||| |||||| ||| |||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>48.1739</Hsp_bit-score>
<Hsp_score>52</Hsp_score>
<Hsp_evalue>0.000491741</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>71</Hsp_hit-from>
<Hsp_hit-to>13</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCCAAAGGGAAGCGCTTTGGTTTCTTTCAGACAACAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>||| | ||||||||||||| || | | | | || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>42</Hit_num>
<Hit_id>gi|270133232|ref|NR_032571.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-518e (MIR518E), microRNA</Hit_def>
<Hit_accession>NR_032571</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>75.2244</Hsp_bit-score>
<Hsp_score>82</Hsp_score>
<Hsp_evalue>3.53765e-12</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCGATTTCTGTGATCTGAAAGAAAAGAAAATGGTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||||||||| ||||||| |||||||||||||||| || |||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>43</Hit_num>
<Hit_id>gi|262205392|ref|NR_030211.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 518d (MIR518D), microRNA</Hit_def>
<Hit_accession>NR_030211</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>75.2244</Hsp_bit-score>
<Hsp_score>82</Hsp_score>
<Hsp_evalue>3.53765e-12</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTGTTGTCTGAAAGAAACCAAAGCGCTTCCCTTTGGAG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| ||||||||||||||||||||| |||| |||||| ||| |||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>48.1739</Hsp_bit-score>
<Hsp_score>52</Hsp_score>
<Hsp_evalue>0.000491741</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>72</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCCAAAGGGAAGCGCTTTGGTTTCTTTCAGACAACAGAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>||| | ||||||||||||| || | | | | || ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>44</Hit_num>
<Hit_id>gi|301171300|ref|NR_035855.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520a (MIR520A), microRNA</Hit_def>
<Hit_accession>NR_035855</Hit_accession>
<Hit_len>84</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>73.4211</Hsp_bit-score>
<Hsp_score>80</Hsp_score>
<Hsp_evalue>1.23476e-11</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>58</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>69</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>51</Hsp_identity>
<Hsp_positive>51</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>58</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGA</Hsp_qseq>
<Hsp_hseq>CCCTCCAGAGGGAAGTACTTTCTGTTGTCTGAGAGAAAAGAAAGTGCTTCCCTTTGGA</Hsp_hseq>
<Hsp_midline>||||| | ||||||| ||||||||||||||| |||||||||||||||||| ||| ||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>45</Hit_num>
<Hit_id>gi|301171161|ref|NR_035839.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-516b-1 (MIR516B-1), microRNA</Hit_def>
<Hit_accession>NR_035839</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>73.4211</Hsp_bit-score>
<Hsp_score>80</Hsp_score>
<Hsp_evalue>1.23476e-11</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>27</Hsp_hit-from>
<Hsp_hit-to>76</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTTTGTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||| | ||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>40.9604</Hsp_bit-score>
<Hsp_score>44</Hsp_score>
<Hsp_evalue>0.0729808</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>50</Hsp_query-to>
<Hsp_hit-from>76</Hsp_hit-from>
<Hsp_hit-to>27</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>39</Hsp_identity>
<Hsp_positive>39</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTC</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGAAGCACTTTCTTTTCTTTCACAAAACAGAAAGTGCTTC</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || ||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>46</Hit_num>
<Hit_id>gi|270133259|ref|NR_032576.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-519d (MIR519D), microRNA</Hit_def>
<Hit_accession>NR_032576</Hit_accession>
<Hit_len>91</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>73.4211</Hsp_bit-score>
<Hsp_score>80</Hsp_score>
<Hsp_evalue>1.23476e-11</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>76</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>54</Hsp_identity>
<Hsp_positive>54</Hsp_positive>
<Hsp_gaps>4</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTT----GTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCCAAAGGGAAGCACTTTCTGTTTGTTGTCTGAGAGAAAACAAAGTGCTTCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>||||| | |||||||| ||||||||| |||||| |||||| |||||||||||||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>76</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>4</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGA---AAGAAA-AGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTAAAAGGAAGCACTTTGTTTTCTCTCAGACAACAAACAGAAAGTGCTTCCCTTTGGAGGG</Hsp_hseq>
<Hsp_midline>||||| | |||||| |||| | || ||| | || ||| ||||||||||||| ||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>47</Hit_num>
<Hit_id>gi|270133218|ref|NR_032568.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-518b (MIR518B), microRNA</Hit_def>
<Hit_accession>NR_032568</Hit_accession>
<Hit_len>83</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>73.4211</Hsp_bit-score>
<Hsp_score>80</Hsp_score>
<Hsp_evalue>1.23476e-11</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>60</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG</Hsp_qseq>
<Hsp_hseq>CCCTCCAGAGGGAAGCACTTTCTGTTGTCTGAAAGAAAGCAAAGCGCTCCCCTTTAGAGG</Hsp_hseq>
<Hsp_midline>||||| | |||||||| ||||||||||||||||||||| |||| ||| || ||||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>71</Hsp_hit-from>
<Hsp_hit-to>12</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTAAAGGGGAGCGCTTTGCTTTCTTTCAGACAACAGAAAGTGCTTCCCTCTGGAGGG</Hsp_hseq>
<Hsp_midline>|||||| |||| |||||||| || | | | | || ||||||||||||| | | |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>48</Hit_num>
<Hit_id>gi|270132725|ref|NR_032718.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-516 (MIR516), microRNA</Hit_def>
<Hit_accession>NR_032718</Hit_accession>
<Hit_len>90</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>73.4211</Hsp_bit-score>
<Hsp_score>80</Hsp_score>
<Hsp_evalue>1.23476e-11</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>28</Hsp_hit-from>
<Hsp_hit-to>77</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTTTGTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||| | ||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>40.9604</Hsp_bit-score>
<Hsp_score>44</Hsp_score>
<Hsp_evalue>0.0729808</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>50</Hsp_query-to>
<Hsp_hit-from>77</Hsp_hit-from>
<Hsp_hit-to>28</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>39</Hsp_identity>
<Hsp_positive>39</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTC</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGAAGCACTTTCTTTTCTTTCACAAAACAGAAAGTGCTTC</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || ||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>49</Hit_num>
<Hit_id>gi|262205396|ref|NR_030212.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 516b-1 (MIR516B1), microRNA</Hit_def>
<Hit_accession>NR_030212</Hit_accession>
<Hit_len>90</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>73.4211</Hsp_bit-score>
<Hsp_score>80</Hsp_score>
<Hsp_evalue>1.23476e-11</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>28</Hsp_hit-from>
<Hsp_hit-to>77</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTTTGTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||| | ||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>40.9604</Hsp_bit-score>
<Hsp_score>44</Hsp_score>
<Hsp_evalue>0.0729808</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>50</Hsp_query-to>
<Hsp_hit-from>77</Hsp_hit-from>
<Hsp_hit-to>28</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>39</Hsp_identity>
<Hsp_positive>39</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTC</Hsp_qseq>
<Hsp_hseq>CCCTCTGAAAGGAAGCACTTTCTTTTCTTTCACAAAACAGAAAGTGCTTC</Hsp_hseq>
<Hsp_midline>|||||| | |||||| |||||| || | | | | || ||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>50</Hit_num>
<Hit_id>gi|262205294|ref|NR_030189.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520a (MIR520A), microRNA</Hit_def>
<Hit_accession>NR_030189</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>73.4211</Hsp_bit-score>
<Hsp_score>80</Hsp_score>
<Hsp_evalue>1.23476e-11</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>58</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>70</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>51</Hsp_identity>
<Hsp_positive>51</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>58</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGA</Hsp_qseq>
<Hsp_hseq>CCCTCCAGAGGGAAGTACTTTCTGTTGTCTGAGAGAAAAGAAAGTGCTTCCCTTTGGA</Hsp_hseq>
<Hsp_midline>||||| | ||||||| ||||||||||||||| |||||||||||||||||| ||| ||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>51</Hit_num>
<Hit_id>gi|301171602|ref|NR_035634.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-1283 (MIR1283), microRNA</Hit_def>
<Hit_accession>NR_035634</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>53</Hsp_identity>
<Hsp_positive>53</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CTCTACA--GGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTACAAAGGAAAGCGCTTTCTGTTGTCAGAAAGAAGAGAAAGCGCTTCCCTTTTGAGGG</Hsp_hseq>
<Hsp_midline>||||||| || ||||||||||||||||| ||||||| |||||| |||||| ||| |||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>44.5672</Hsp_bit-score>
<Hsp_score>48</Hsp_score>
<Hsp_evalue>0.00599063</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>72</Hsp_hit-from>
<Hsp_hit-to>12</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGC-TTCCTTT-TAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCAAAAGGGAAGCGCTTTCTCTTCTTTCTGACAACAGAAAGCGCTTTCCTTTGTAGAG</Hsp_hseq>
<Hsp_midline>||||| | ||||||||||||||| || | | | || |||||| || ||||||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>52</Hit_num>
<Hit_id>gi|301171454|ref|NR_035872.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-527 (MIR527), microRNA</Hit_def>
<Hit_accession>NR_035872</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>21</Hsp_hit-from>
<Hsp_hit-to>67</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>44</Hsp_identity>
<Hsp_positive>44</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCCCTTTCTGTTGTCTAAAAGAAAAGAAAGTGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>|||||||| ||||||||||||| |||||||||||||||||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>53</Hit_num>
<Hit_id>gi|301171333|ref|NR_035858.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520d (MIR520D), microRNA</Hit_def>
<Hit_accession>NR_035858</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>53</Hsp_identity>
<Hsp_positive>53</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CTCTACA--GGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTACAAAGGGAAGCCCTTTCTGTTGTCTAAAAGAAAAGAAAGTGCTTCTCTTTGGTGGG</Hsp_hseq>
<Hsp_midline>||||||| ||||||| ||||||||||||| ||||||||||||||||||| ||| | |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>54</Hit_num>
<Hit_id>gi|301171291|ref|NR_035854.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-519e (MIR519E), microRNA</Hit_def>
<Hit_accession>NR_035854</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>15</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCCAAAAGGGAGCACTTTCTGTTGTCTGAAAGAAAACAAAGTGCCTCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>||| | | || ||| |||||||||||||||||||||| ||||||| |||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>55</Hit_num>
<Hit_id>gi|301171219|ref|NR_035846.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-518c (MIR518C), microRNA</Hit_def>
<Hit_accession>NR_035846</Hit_accession>
<Hit_len>100</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>24</Hsp_hit-from>
<Hsp_hit-to>80</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCTGGAGGGAAGCACTTTCTGTTGTCTGAAAGAAAACAAAGCGCTTCTCTTTAGAG</Hsp_hseq>
<Hsp_midline>|||| |||||||| |||||||||||||||||||||| |||| ||||| |||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>44.5672</Hsp_bit-score>
<Hsp_score>48</Hsp_score>
<Hsp_evalue>0.00599063</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>80</Hsp_hit-from>
<Hsp_hit-to>24</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>44</Hsp_identity>
<Hsp_positive>44</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCTAAAGAGAAGCGCTTTGTTTTCTTTCAGACAACAGAAAGTGCTTCCCTCCAGAG</Hsp_hseq>
<Hsp_midline>||||| || |||||||||| | || | | | | || ||||||||||||| | ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>56</Hit_num>
<Hit_id>gi|269847477|ref|NR_031696.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 1283-2 (MIR1283-2), microRNA</Hit_def>
<Hit_accession>NR_031696</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>4</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>51</Hsp_identity>
<Hsp_positive>51</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>58</Hsp_align-len>
<Hsp_qseq>TCTACA--GGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>TCTACAAAGGAAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAATCGCTTCCCTTTGGAG</Hsp_hseq>
<Hsp_midline>|||||| || ||||||||||||||||||||||||||||||| |||||| ||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>57</Hit_num>
<Hit_id>gi|262205435|ref|NR_030219.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 527 (MIR527), microRNA</Hit_def>
<Hit_accession>NR_030219</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>20</Hsp_hit-from>
<Hsp_hit-to>66</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>44</Hsp_identity>
<Hsp_positive>44</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCCCTTTCTGTTGTCTAAAAGAAAAGAAAGTGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>|||||||| ||||||||||||| |||||||||||||||||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>58</Hit_num>
<Hit_id>gi|262205336|ref|NR_030199.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 518c (MIR518C), microRNA</Hit_def>
<Hit_accession>NR_030199</Hit_accession>
<Hit_len>101</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>71.6177</Hsp_bit-score>
<Hsp_score>78</Hsp_score>
<Hsp_evalue>4.30974e-11</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>25</Hsp_hit-from>
<Hsp_hit-to>81</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCTGGAGGGAAGCACTTTCTGTTGTCTGAAAGAAAACAAAGCGCTTCTCTTTAGAG</Hsp_hseq>
<Hsp_midline>|||| |||||||| |||||||||||||||||||||| |||| ||||| |||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>44.5672</Hsp_bit-score>
<Hsp_score>48</Hsp_score>
<Hsp_evalue>0.00599063</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>81</Hsp_hit-from>
<Hsp_hit-to>25</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>44</Hsp_identity>
<Hsp_positive>44</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCTAAAGAGAAGCGCTTTGTTTTCTTTCAGACAACAGAAAGTGCTTCCCTCCAGAG</Hsp_hseq>
<Hsp_midline>||||| || |||||||||| | || | | | | || ||||||||||||| | ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>59</Hit_num>
<Hit_id>gi|270133264|ref|NR_032577.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-520a (MIR520A), microRNA</Hit_def>
<Hit_accession>NR_032577</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>69.8143</Hsp_bit-score>
<Hsp_score>76</Hsp_score>
<Hsp_evalue>1.50425e-10</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>58</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>70</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>58</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGA</Hsp_qseq>
<Hsp_hseq>CCCTCCAGAGGGAAGTATTTTCTGTTGTCTGAAGGAAAAGAAAGTGCTTCCCTTTGGA</Hsp_hseq>
<Hsp_midline>||||| | ||||||| ||||||||||||||| ||||||||||||||||| ||| ||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>60</Hit_num>
<Hit_id>gi|269846946|ref|NR_031573.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 1283-1 (MIR1283-1), microRNA</Hit_def>
<Hit_accession>NR_031573</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>69.8143</Hsp_bit-score>
<Hsp_score>76</Hsp_score>
<Hsp_evalue>1.50425e-10</Hsp_evalue>
<Hsp_query-from>4</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>TCTACA--GGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>TCTACAAAGGAAAGCGCTTTCTGTTGTCAGAAAGAAGAGAAAGCGCTTCCCTTTTGAGGG</Hsp_hseq>
<Hsp_midline>|||||| || ||||||||||||||||| ||||||| |||||| |||||| ||| |||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>42.7638</Hsp_bit-score>
<Hsp_score>46</Hsp_score>
<Hsp_evalue>0.0209094</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>58</Hsp_query-to>
<Hsp_hit-from>73</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>47</Hsp_identity>
<Hsp_positive>47</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGC-TTCCTTT-TAGA</Hsp_qseq>
<Hsp_hseq>CCCTCAAAAGGGAAGCGCTTTCTCTTCTTTCTGACAACAGAAAGCGCTTTCCTTTGTAGA</Hsp_hseq>
<Hsp_midline>||||| | ||||||||||||||| || | | | || |||||| || ||||||| ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>61</Hit_num>
<Hit_id>gi|262205358|ref|NR_030204.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520d (MIR520D), microRNA</Hit_def>
<Hit_accession>NR_030204</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>69.8143</Hsp_bit-score>
<Hsp_score>76</Hsp_score>
<Hsp_evalue>1.50425e-10</Hsp_evalue>
<Hsp_query-from>4</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>15</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>TCTACA--GGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>TCTACAAAGGGAAGCCCTTTCTGTTGTCTAAAAGAAAAGAAAGTGCTTCTCTTTGGTGGG</Hsp_hseq>
<Hsp_midline>|||||| ||||||| ||||||||||||| ||||||||||||||||||| ||| | |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>62</Hit_num>
<Hit_id>gi|301171206|ref|NR_035844.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-518a (MIR518A), microRNA</Hit_def>
<Hit_accession>NR_035844</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>68.0109</Hsp_bit-score>
<Hsp_score>74</Hsp_score>
<Hsp_evalue>5.25034e-10</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>21</Hsp_hit-from>
<Hsp_hit-to>67</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>43</Hsp_identity>
<Hsp_positive>43</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCCCTTTCTGTTGTCTAAAAGAAAAGAAAGCGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>|||||||| ||||||||||||| ||||||||||||| |||||| |||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>44.5672</Hsp_bit-score>
<Hsp_score>48</Hsp_score>
<Hsp_evalue>0.00599063</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>65</Hsp_hit-from>
<Hsp_hit-to>19</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>38</Hsp_identity>
<Hsp_positive>38</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCGCTTTCTTTTCTTTTAGACAACAGAAAGGGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>||||||||||||||| || | | | | || |||||| |||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>63</Hit_num>
<Hit_id>gi|301171169|ref|NR_035840.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-516b-2 (MIR516B-2), microRNA</Hit_def>
<Hit_accession>NR_035840</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>68.0109</Hsp_bit-score>
<Hsp_score>74</Hsp_score>
<Hsp_evalue>5.25034e-10</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>27</Hsp_hit-from>
<Hsp_hit-to>76</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>45</Hsp_identity>
<Hsp_positive>45</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTGTGTTTTGTGAAAGAAAAGAAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| |||| |||| | ||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>64</Hit_num>
<Hit_id>gi|262205387|ref|NR_030210.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 518a-1 (MIR518A1), microRNA</Hit_def>
<Hit_accession>NR_030210</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>68.0109</Hsp_bit-score>
<Hsp_score>74</Hsp_score>
<Hsp_evalue>5.25034e-10</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>20</Hsp_hit-from>
<Hsp_hit-to>66</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>43</Hsp_identity>
<Hsp_positive>43</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCCCTTTCTGTTGTCTGAAAGAAGAGAAAGCGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>|||||||| |||||||||||||||||||| |||||| |||||| |||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>44.5672</Hsp_bit-score>
<Hsp_score>48</Hsp_score>
<Hsp_evalue>0.00599063</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>64</Hsp_hit-from>
<Hsp_hit-to>18</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>38</Hsp_identity>
<Hsp_positive>38</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCGCTTTCTCTTCTTTCAGACAACAGAAAGGGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>||||||||||||||| || | | | | || |||||| |||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>65</Hit_num>
<Hit_id>gi|301171381|ref|NR_035863.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-521-1 (MIR521-1), microRNA</Hit_def>
<Hit_accession>NR_035863</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>66.2076</Hsp_bit-score>
<Hsp_score>72</Hsp_score>
<Hsp_evalue>1.83255e-09</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCCAAAGGGAAGAACTTTCTGTTGTCTAAAAGAAAAGAACGCACTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||| | ||||||| ||||||||||||| ||||||||||| | ||||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>66</Hit_num>
<Hit_id>gi|270133201|ref|NR_032565.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-517 (MIR517), microRNA</Hit_def>
<Hit_accession>NR_032565</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>66.2076</Hsp_bit-score>
<Hsp_score>72</Hsp_score>
<Hsp_evalue>1.83255e-09</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGATGGAAGCACTGTCTGTGGTCTAAAAGAAAAGATCGTGCATCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| | |||||| || ||||| |||| |||||||||| |||| |||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>67</Hit_num>
<Hit_id>gi|262205417|ref|NR_030216.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 521-1 (MIR521-1), microRNA</Hit_def>
<Hit_accession>NR_030216</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>66.2076</Hsp_bit-score>
<Hsp_score>72</Hsp_score>
<Hsp_evalue>1.83255e-09</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCCAAAGGGAAGAACTTTCTGTTGTCTAAAAGAAAAGAACGCACTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||| | ||||||| ||||||||||||| ||||||||||| | ||||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>68</Hit_num>
<Hit_id>gi|270133214|ref|NR_032567.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-518a (MIR518A), microRNA</Hit_def>
<Hit_accession>NR_032567</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>64.4042</Hsp_bit-score>
<Hsp_score>70</Hsp_score>
<Hsp_evalue>6.39622e-09</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>54</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>68</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>48</Hsp_identity>
<Hsp_positive>48</Hsp_positive>
<Hsp_gaps>1</Hsp_gaps>
<Hsp_align-len>55</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTC-CTTT</Hsp_qseq>
<Hsp_hseq>CCCTACAAAGGGAAGCCCTTTCTGTTGTCTAAACGAAAAGAAAGTGCTTCTCTTT</Hsp_hseq>
<Hsp_midline>|||| | |||||||| ||||||||||||| || |||||||||||||||| ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>69</Hit_num>
<Hit_id>gi|262205407|ref|NR_030214.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 517c (MIR517C), microRNA</Hit_def>
<Hit_accession>NR_030214</Hit_accession>
<Hit_len>95</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>64.4042</Hsp_bit-score>
<Hsp_score>70</Hsp_score>
<Hsp_evalue>6.39622e-09</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>19</Hsp_hit-from>
<Hsp_hit-to>75</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGATGGAAGCACTGTCTGTTGTCT--AAGAAAAGATCGTGCATCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| | |||||| || |||||||||| ||||||||| |||| |||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>70</Hit_num>
<Hit_id>gi|262205377|ref|NR_030208.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 526a-2 (MIR526A2), microRNA</Hit_def>
<Hit_accession>NR_030208</Hit_accession>
<Hit_len>65</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>64.4042</Hsp_bit-score>
<Hsp_score>70</Hsp_score>
<Hsp_evalue>6.39622e-09</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>5</Hsp_hit-from>
<Hsp_hit-to>61</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>51</Hsp_identity>
<Hsp_positive>51</Hsp_positive>
<Hsp_gaps>4</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGGGAAGCACTTTCTGTTG----AAAGAAAAGAACATGCATCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||||| |||||||| |||||||||| ||||||||||| ||| |||||| ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>71</Hit_num>
<Hit_id>gi|270133311|ref|NR_032588.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-523b (MIR523B), microRNA</Hit_def>
<Hit_accession>NR_032588</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>62.6008</Hsp_bit-score>
<Hsp_score>68</Hsp_score>
<Hsp_evalue>2.2325e-08</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>51</Hsp_identity>
<Hsp_positive>51</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCT--GAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGCGAAGCGCTTTCTGTTGGCTAGAAAAGAATAGGAAGCGCTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| || |||||||||||||||| || |||||| || ||| |||||| |||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>40.9604</Hsp_bit-score>
<Hsp_score>44</Hsp_score>
<Hsp_evalue>0.0729808</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>74</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>2</Hsp_gaps>
<Hsp_align-len>61</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAG--AAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTAAAGGGAAGCGCTTCCTATTCTTTTCTAGCCAACAGAAAGCGCTTCGCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>||||| |||||||||||| || || | | || || |||||| ||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>72</Hit_num>
<Hit_id>gi|270133297|ref|NR_032585.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-521 (MIR521), microRNA</Hit_def>
<Hit_accession>NR_032585</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>62.6008</Hsp_bit-score>
<Hsp_score>68</Hsp_score>
<Hsp_evalue>2.2325e-08</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCCAAAGGGAAGTACTTTCTGTTGTCTAAAAGAAAAGAACGCACTTCCCTTTGGAG</Hsp_hseq>
<Hsp_midline>||||| | ||||||| ||||||||||||| ||||||||||| | ||||| ||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>73</Hit_num>
<Hit_id>gi|262205401|ref|NR_030213.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 518a-2 (MIR518A2), microRNA</Hit_def>
<Hit_accession>NR_030213</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>62.6008</Hsp_bit-score>
<Hsp_score>68</Hsp_score>
<Hsp_evalue>2.2325e-08</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>22</Hsp_hit-from>
<Hsp_hit-to>68</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>42</Hsp_identity>
<Hsp_positive>42</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCCCTTTCTGTTGTCTAAAAGAAGAGAAAGCGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>|||||||| ||||||||||||| |||||| |||||| |||||| |||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>44.5672</Hsp_bit-score>
<Hsp_score>48</Hsp_score>
<Hsp_evalue>0.00599063</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>66</Hsp_hit-from>
<Hsp_hit-to>20</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>38</Hsp_identity>
<Hsp_positive>38</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>AGGGAAGCGCTTTCTCTTCTTTTAGACAACAGAAAGGGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>||||||||||||||| || | | | | || |||||| |||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>74</Hit_num>
<Hit_id>gi|301171372|ref|NR_035862.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520h (MIR520H), microRNA</Hit_def>
<Hit_accession>NR_035862</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>60.7975</Hsp_bit-score>
<Hsp_score>66</Hsp_score>
<Hsp_evalue>7.79219e-08</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTT----GTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGG-AAGCACTTTCTGTTTGTTGTCTGAGAAAAAACAAAGTGCTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||| |||| ||||||||| |||||| | |||| ||||||||||| |||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>74</Hsp_hit-from>
<Hsp_hit-to>13</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGA---AAGAAA-AGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTAAAGGGAAGCACTTTGTTTTTTCTCAGACAACAAACAGAAAGTGCTTCC-TCTAGAGGG</Hsp_hseq>
<Hsp_midline>||||| |||||||| |||| | || ||| | || ||| ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>75</Hit_num>
<Hit_id>gi|262205412|ref|NR_030215.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520h (MIR520H), microRNA</Hit_def>
<Hit_accession>NR_030215</Hit_accession>
<Hit_len>88</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>60.7975</Hsp_bit-score>
<Hsp_score>66</Hsp_score>
<Hsp_evalue>7.79219e-08</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>75</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTT----GTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGG-AAGCACTTTCTGTTTGTTGTCTGAGAAAAAACAAAGTGCTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||| |||| ||||||||| |||||| | |||| ||||||||||| |||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>75</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGA---AAGAAA-AGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTAAAGGGAAGCACTTTGTTTTTTCTCAGACAACAAACAGAAAGTGCTTCC-TCTAGAGGG</Hsp_hseq>
<Hsp_midline>||||| |||||||| |||| | || ||| | || ||| ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>76</Hit_num>
<Hit_id>gi|262205366|ref|NR_030206.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 520g (MIR520G), microRNA</Hit_def>
<Hit_accession>NR_030206</Hit_accession>
<Hit_len>90</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>60.7975</Hsp_bit-score>
<Hsp_score>66</Hsp_score>
<Hsp_evalue>7.79219e-08</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>75</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>52</Hsp_identity>
<Hsp_positive>52</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTT----GTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGG-AAGCACTTTCTGTTTGTTGTCTGAGAAAAAACAAAGTGCTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||| |||| ||||||||| |||||| | |||| ||||||||||| |||||||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>75</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>50</Hsp_identity>
<Hsp_positive>50</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGA---AAGAAA-AGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCTAAAGGGAAGCACTTTGTTTTTTCTCAGACAACAAACAGAAAGTGCTTCC-TCTAGAGGG</Hsp_hseq>
<Hsp_midline>||||| |||||||| |||| | || ||| | || ||| ||||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>77</Hit_num>
<Hit_id>gi|270132721|ref|NR_032717.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-524 (MIR524), microRNA</Hit_def>
<Hit_accession>NR_032717</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>58.9941</Hsp_bit-score>
<Hsp_score>64</Hsp_score>
<Hsp_evalue>2.71974e-07</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>55</Hsp_query-to>
<Hsp_hit-from>12</Hsp_hit-from>
<Hsp_hit-to>66</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>55</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTT</Hsp_qseq>
<Hsp_hseq>CCCTACAAAGGCAAGCACTTTCTCTTGTCTAAAAGAAAAGAAGGTGCTTCCCTTT</Hsp_hseq>
<Hsp_midline>|||| | ||| |||| |||||| |||||| ||||||||||| |||||||| |||</Hsp_midline>
</Hsp>
<Hsp>
<Hsp_num>2</Hsp_num>
<Hsp_bit-score>37.3537</Hsp_bit-score>
<Hsp_score>40</Hsp_score>
<Hsp_evalue>0.889088</Hsp_evalue>
<Hsp_query-from>9</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>64</Hsp_hit-from>
<Hsp_hit-to>12</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>40</Hsp_identity>
<Hsp_positive>40</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>53</Hsp_align-len>
<Hsp_qseq>AGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>AGGGAAGCACCTTCTTTTCTTTTAGACAAGAGAAAGTGCTTGCCTTTGTAGGG</Hsp_hseq>
<Hsp_midline>|||||||| | |||| || | | | | || ||||||||||| | ||| ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>78</Hit_num>
<Hit_id>gi|262205276|ref|NR_030185.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 519e (MIR519E), microRNA</Hit_def>
<Hit_accession>NR_030185</Hit_accession>
<Hit_len>84</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>57.1907</Hsp_bit-score>
<Hsp_score>62</Hsp_score>
<Hsp_evalue>9.49283e-07</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>16</Hsp_hit-from>
<Hsp_hit-to>69</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>47</Hsp_identity>
<Hsp_positive>47</Hsp_positive>
<Hsp_gaps>3</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCCAAAAGGGAGCACTTTCTGTT---TGAAAGAAAACAAAGTGCCTCCTTTTAGAG</Hsp_hseq>
<Hsp_midline>||| | | || ||| ||||||||| |||||||||| ||||||| |||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>79</Hit_num>
<Hit_id>gi|301171363|ref|NR_035861.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-520g (MIR520G), microRNA</Hit_def>
<Hit_accession>NR_035861</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>55.3874</Hsp_bit-score>
<Hsp_score>60</Hsp_score>
<Hsp_evalue>3.31332e-06</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>74</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>51</Hsp_identity>
<Hsp_positive>51</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTT----GTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGG-ACGCACTTTCTGTTTGTTGTCTGAGAAAAAACAAAGTGCTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||||| ||| | || ||||||||| |||||| | |||| ||||||||||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>80</Hit_num>
<Hit_id>gi|270133196|ref|NR_032564.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-516a-2 (MIR516A-2), microRNA</Hit_def>
<Hit_accession>NR_032564</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>55.3874</Hsp_bit-score>
<Hsp_score>60</Hsp_score>
<Hsp_evalue>3.31332e-06</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>28</Hsp_hit-from>
<Hsp_hit-to>76</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>43</Hsp_identity>
<Hsp_positive>43</Hsp_positive>
<Hsp_gaps>1</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTGTCT-AAAGAAAAGGAAGTGTTTCCTTCCCGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||||||| ||||||||| ||||| |||||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>81</Hit_num>
<Hit_id>gi|270133191|ref|NR_032563.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-516a-1 (MIR516A-1), microRNA</Hit_def>
<Hit_accession>NR_032563</Hit_accession>
<Hit_len>89</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>55.3874</Hsp_bit-score>
<Hsp_score>60</Hsp_score>
<Hsp_evalue>3.31332e-06</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>28</Hsp_hit-from>
<Hsp_hit-to>76</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>43</Hsp_identity>
<Hsp_positive>43</Hsp_positive>
<Hsp_gaps>1</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTCTGTTGTCT-AAAGAAAAGGAAGTGTTTCCTTCCCGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||||||| ||||||||| ||||| |||||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>82</Hit_num>
<Hit_id>gi|301171387|ref|NR_035864.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-521-2 (MIR521-2), microRNA</Hit_def>
<Hit_accession>NR_035864</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>53.584</Hsp_bit-score>
<Hsp_score>58</Hsp_score>
<Hsp_evalue>1.15646e-05</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>15</Hsp_hit-from>
<Hsp_hit-to>71</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCCAAAGGGAAGAATTTTCTCTTGTCTAAAAGAAAAGAACGCACTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||| | ||||||| ||||| |||||| ||||||||||| | ||||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>83</Hit_num>
<Hit_id>gi|262205353|ref|NR_030203.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 521-2 (MIR521-2), microRNA</Hit_def>
<Hit_accession>NR_030203</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>53.584</Hsp_bit-score>
<Hsp_score>58</Hsp_score>
<Hsp_evalue>1.15646e-05</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>16</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>46</Hsp_identity>
<Hsp_positive>46</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>57</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CTCCAAAGGGAAGAATTTTCTCTTGTCTAAAAGAAAAGAACGCACTTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||| | ||||||| ||||| |||||| ||||||||||| | ||||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>84</Hit_num>
<Hit_id>gi|270133237|ref|NR_032572.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-518f (MIR518F), microRNA</Hit_def>
<Hit_accession>NR_032572</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>49.9773</Hsp_bit-score>
<Hsp_score>54</Hsp_score>
<Hsp_evalue>0.000140886</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>73</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>47</Hsp_identity>
<Hsp_positive>47</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CCTCTGAAGGGAAGCGCTTTCTTTCCTTTCACACAAGATAAAGTGCTTCCCTCTAGAGGG</Hsp_hseq>
<Hsp_midline>||||| ||||||||||||||| | | | | | || | ||||||||||| | |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>85</Hit_num>
<Hit_id>gi|301171283|ref|NR_035853.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-519d (MIR519D), microRNA</Hit_def>
<Hit_accession>NR_035853</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>13</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>47</Hsp_identity>
<Hsp_positive>47</Hsp_positive>
<Hsp_gaps>1</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTG-TTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCCAAAGGGAAGCGCTTTCTGTTTGTTTTCTCTCAAACAAAGTGCCTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||| | |||||||||||||||| |||| | ||| ||||||| ||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>86</Hit_num>
<Hit_id>gi|270133288|ref|NR_032583.1|</Hit_id>
<Hit_def>Macaca mulatta microRNA mir-520g (MIR520G), microRNA</Hit_def>
<Hit_accession>NR_032583</Hit_accession>
<Hit_len>90</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>75</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>49</Hsp_identity>
<Hsp_positive>49</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>63</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTGTT----GTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCTAGAGA-AAGCACTTTCTGTTTGTTGTCTGAGGAAAAACAAAGTGCTTCCCTTCAGAG</Hsp_hseq>
<Hsp_midline>||||||| || |||| ||||||||| |||||| |||| ||||||||||| || ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>87</Hit_num>
<Hit_id>gi|262205371|ref|NR_030207.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 516b-2 (MIR516B2), microRNA</Hit_def>
<Hit_accession>NR_030207</Hit_accession>
<Hit_len>85</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>12</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>28</Hsp_hit-from>
<Hsp_hit-to>72</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>40</Hsp_identity>
<Hsp_positive>40</Hsp_positive>
<Hsp_gaps>5</Hsp_gaps>
<Hsp_align-len>50</Hsp_align-len>
<Hsp_qseq>GAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>GAAGCACTTTGTGTTTTGTGAAAG-----AAAGTGCTTCCTTTCAGAGGG</Hsp_hseq>
<Hsp_midline>||||| |||| |||| | |||||| |||||||||||||| ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>88</Hit_num>
<Hit_id>gi|262205349|ref|NR_030202.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 519d (MIR519D), microRNA</Hit_def>
<Hit_accession>NR_030202</Hit_accession>
<Hit_len>88</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>46.3705</Hsp_bit-score>
<Hsp_score>50</Hsp_score>
<Hsp_evalue>0.00171634</Hsp_evalue>
<Hsp_query-from>1</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>14</Hsp_hit-from>
<Hsp_hit-to>73</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>47</Hsp_identity>
<Hsp_positive>47</Hsp_positive>
<Hsp_gaps>1</Hsp_gaps>
<Hsp_align-len>60</Hsp_align-len>
<Hsp_qseq>CCCTCTACAGGGAAGCGCTTTCTG-TTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>CCCTCCAAAGGGAAGCGCTTTCTGTTTGTTTTCTCTTAAACAAAGTGCCTCCCTTTAGAG</Hsp_hseq>
<Hsp_midline>||||| | |||||||||||||||| |||| | ||| ||||||| ||| |||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>89</Hit_num>
<Hit_id>gi|301171138|ref|NR_035836.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-515-2 (MIR515-2), microRNA</Hit_def>
<Hit_accession>NR_035836</Hit_accession>
<Hit_len>82</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>39.157</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>0.254728</Hsp_evalue>
<Hsp_query-from>13</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>25</Hsp_hit-from>
<Hsp_hit-to>67</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>37</Hsp_identity>
<Hsp_positive>37</Hsp_positive>
<Hsp_gaps>4</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>AAGCACTTTCTGTTGTCTGAAAG----CAGAGTGCCTTCTTTTGGAG</Hsp_hseq>
<Hsp_midline>|||| |||||||||||||||||| | ||||| | ||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>90</Hit_num>
<Hit_id>gi|301171409|ref|NR_035867.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-524 (MIR524), microRNA</Hit_def>
<Hit_accession>NR_035867</Hit_accession>
<Hit_len>86</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>39.157</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>0.254728</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>71</Hsp_hit-from>
<Hsp_hit-to>13</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>44</Hsp_identity>
<Hsp_positive>44</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCCAAAGGGAAGCGCCTTCTTTTCCTTTGGACAAGAGAAAGTGCTTCCCTTTGTAGGG</Hsp_hseq>
<Hsp_midline>||| | |||||||||| |||| || | | || ||||||||||||| ||| ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>91</Hit_num>
<Hit_id>gi|301173375|ref|NR_035835.1|</Hit_id>
<Hit_def>Pan troglodytes microRNA mir-515-1 (MIR515-1), microRNA</Hit_def>
<Hit_accession>NR_035835</Hit_accession>
<Hit_len>82</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>39.157</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>0.254728</Hsp_evalue>
<Hsp_query-from>13</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>25</Hsp_hit-from>
<Hsp_hit-to>67</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>37</Hsp_identity>
<Hsp_positive>37</Hsp_positive>
<Hsp_gaps>4</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>AAGCACTTTCTGTTGTCTGAAAG----CAGAGTGCCTTCTTTTGGAG</Hsp_hseq>
<Hsp_midline>|||| |||||||||||||||||| | ||||| | ||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>92</Hit_num>
<Hit_id>gi|262205340|ref|NR_030200.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 524 (MIR524), microRNA</Hit_def>
<Hit_accession>NR_030200</Hit_accession>
<Hit_len>87</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>39.157</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>0.254728</Hsp_evalue>
<Hsp_query-from>3</Hsp_query-from>
<Hsp_query-to>61</Hsp_query-to>
<Hsp_hit-from>72</Hsp_hit-from>
<Hsp_hit-to>14</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>44</Hsp_identity>
<Hsp_positive>44</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>59</Hsp_align-len>
<Hsp_qseq>CTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG</Hsp_qseq>
<Hsp_hseq>CTCCAAAGGGAAGCGCCTTCTTTTCCTTTGGACAAGAGAAAGTGCTTCCCTTTGTAGGG</Hsp_hseq>
<Hsp_midline>||| | |||||||||| |||| || | | || ||||||||||||| ||| ||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>93</Hit_num>
<Hit_id>gi|262205285|ref|NR_030187.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 515-2 (MIR515-2), microRNA</Hit_def>
<Hit_accession>NR_030187</Hit_accession>
<Hit_len>83</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>39.157</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>0.254728</Hsp_evalue>
<Hsp_query-from>13</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>26</Hsp_hit-from>
<Hsp_hit-to>68</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>37</Hsp_identity>
<Hsp_positive>37</Hsp_positive>
<Hsp_gaps>4</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>AAGCACTTTCTGTTGTCTGAAAG----CAGAGTGCCTTCTTTTGGAG</Hsp_hseq>
<Hsp_midline>|||| |||||||||||||||||| | ||||| | ||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>94</Hit_num>
<Hit_id>gi|262205270|ref|NR_030184.1|</Hit_id>
<Hit_def>Homo sapiens microRNA 515-1 (MIR515-1), microRNA</Hit_def>
<Hit_accession>NR_030184</Hit_accession>
<Hit_len>83</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>39.157</Hsp_bit-score>
<Hsp_score>42</Hsp_score>
<Hsp_evalue>0.254728</Hsp_evalue>
<Hsp_query-from>13</Hsp_query-from>
<Hsp_query-to>59</Hsp_query-to>
<Hsp_hit-from>26</Hsp_hit-from>
<Hsp_hit-to>68</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>37</Hsp_identity>
<Hsp_positive>37</Hsp_positive>
<Hsp_gaps>4</Hsp_gaps>
<Hsp_align-len>47</Hsp_align-len>
<Hsp_qseq>AAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAG</Hsp_qseq>
<Hsp_hseq>AAGCACTTTCTGTTGTCTGAAAG----CAGAGTGCCTTCTTTTGGAG</Hsp_hseq>
<Hsp_midline>|||| |||||||||||||||||| | ||||| | ||||| |||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>95</Hit_num>
<Hit_id>gi|390332045|ref|XM_776818.2|</Hit_id>
<Hit_def>PREDICTED: Strongylocentrotus purpuratus TM2 domain-containing protein almondex-like, transcript variant 2 (LOC576518), mRNA</Hit_def>
<Hit_accession>XM_776818</Hit_accession>
<Hit_len>4082</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>37.3537</Hsp_bit-score>
<Hsp_score>40</Hsp_score>
<Hsp_evalue>0.889088</Hsp_evalue>
<Hsp_query-from>32</Hsp_query-from>
<Hsp_query-to>56</Hsp_query-to>
<Hsp_hit-from>2287</Hsp_hit-from>
<Hsp_hit-to>2263</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>23</Hsp_identity>
<Hsp_positive>23</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>25</Hsp_align-len>
<Hsp_qseq>AAAGAAAAGAAAGTGCTTCCTTTTA</Hsp_qseq>
<Hsp_hseq>AATGAAAAGAAAGTGCTTCATTTTA</Hsp_hseq>
<Hsp_midline>|| |||||||||||||||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>96</Hit_num>
<Hit_id>gi|390332043|ref|XM_003723358.1|</Hit_id>
<Hit_def>PREDICTED: Strongylocentrotus purpuratus TM2 domain-containing protein almondex-like, transcript variant 1 (LOC576518), mRNA</Hit_def>
<Hit_accession>XM_003723358</Hit_accession>
<Hit_len>4079</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>37.3537</Hsp_bit-score>
<Hsp_score>40</Hsp_score>
<Hsp_evalue>0.889088</Hsp_evalue>
<Hsp_query-from>32</Hsp_query-from>
<Hsp_query-to>56</Hsp_query-to>
<Hsp_hit-from>2284</Hsp_hit-from>
<Hsp_hit-to>2260</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>-1</Hsp_hit-frame>
<Hsp_identity>23</Hsp_identity>
<Hsp_positive>23</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>25</Hsp_align-len>
<Hsp_qseq>AAAGAAAAGAAAGTGCTTCCTTTTA</Hsp_qseq>
<Hsp_hseq>AATGAAAAGAAAGTGCTTCATTTTA</Hsp_hseq>
<Hsp_midline>|| |||||||||||||||| |||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>97</Hit_num>
<Hit_id>gi|356543101|ref|XM_003539954.1|</Hit_id>
<Hit_def>PREDICTED: Glycine max probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7-like (LOC100811463), mRNA</Hit_def>
<Hit_accession>XM_003539954</Hit_accession>
<Hit_len>2936</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>37.3537</Hsp_bit-score>
<Hsp_score>40</Hsp_score>
<Hsp_evalue>0.889088</Hsp_evalue>
<Hsp_query-from>30</Hsp_query-from>
<Hsp_query-to>49</Hsp_query-to>
<Hsp_hit-from>2157</Hsp_hit-from>
<Hsp_hit-to>2176</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>20</Hsp_identity>
<Hsp_positive>20</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>20</Hsp_align-len>
<Hsp_qseq>TGAAAGAAAAGAAAGTGCTT</Hsp_qseq>
<Hsp_hseq>TGAAAGAAAAGAAAGTGCTT</Hsp_hseq>
<Hsp_midline>||||||||||||||||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
<Hit>
<Hit_num>98</Hit_num>
<Hit_id>gi|356517317|ref|XM_003527287.1|</Hit_id>
<Hit_def>PREDICTED: Glycine max probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7-like (LOC100800847), mRNA</Hit_def>
<Hit_accession>XM_003527287</Hit_accession>
<Hit_len>3251</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>37.3537</Hsp_bit-score>
<Hsp_score>40</Hsp_score>
<Hsp_evalue>0.889088</Hsp_evalue>
<Hsp_query-from>30</Hsp_query-from>
<Hsp_query-to>49</Hsp_query-to>
<Hsp_hit-from>2494</