Permalink
Fetching contributors…
Cannot retrieve contributors at this time
51 lines (30 sloc) 2.9 KB
CLUSTAL 2.0.8 multiple sequence alignment
AT3G20900.1-CDS ------------------------------------------------------------
AT3G20900.1-SEQ ATGAACAAAGTAGCGAGGAAGAACAAAACATCAGGTGAACAAAAAAAAAACTCAATCCAC 60
AT3G20900.1-CDS ------------------------------------------------------------
AT3G20900.1-SEQ ATCAAAGTTACAATAACTGACGAAGCTAAGTAGGCTAGAAATTAAAGTCATCAACCTAAT 120
AT3G20900.1-CDS ------------------------------------------------------------
AT3G20900.1-SEQ ACATAGCACTTAGAAAAAAGTGAAGCAAGAAAATATAAAATAATAAAAGGGTGGGTTATC 180
AT3G20900.1-CDS ------------------------------------------------------------
AT3G20900.1-SEQ AATTGATAGTGTAAATCATAGTTGATTTTTGATATACCCTACCACAAAAACTCAAACCGA 240
AT3G20900.1-CDS ------------------------------------------------------------
AT3G20900.1-SEQ CTTGATTCAAATCATCTCAAAAAACAAGCGCCAAAATAATGAAAAAAATAATAACAAAAA 300
AT3G20900.1-CDS ------------------------------------------------------------
AT3G20900.1-SEQ CAAACAAACCAAAATAAGAAAAAACATTACGCAAAACATAATAATTTACTCTTCGTTATT 360
AT3G20900.1-CDS ------------------------------------------------------------
AT3G20900.1-SEQ GTATTAACAAATCAAAGAGATGAATTTTGATCACCTGCTAATACTACTTTCTGTATTGAT 420
AT3G20900.1-CDS ------------------------------------------------------ATGAAC 6
AT3G20900.1-SEQ CCTATATCAAAAAAAAAAAAGATACTAATAATTAACTAAAAGTACGTTCATCGATCGTGT 480
*
AT3G20900.1-CDS AAAGTAGCGAGGAAGAACAAAACATC------AGCAAAGAAAACGATCTGTCTCCGTCGT 60
AT3G20900.1-SEQ GCGTTGACGAAGAAGAGCTCTATCTCCGGCGGAGCAAAGAAAACGATCTGTCTCCGTCGT 540
* *** ***** * * ** ****************************
AT3G20900.1-CDS AACACACAGTTTTTCGAGACCCTTTGCTTCTTCGGCGCCGGTGGACACGTCAGCATCTCC 120
AT3G20900.1-SEQ AACACACAGTTTTTCGAGACCCTTTGCTTCTTCGGCGCCGGTGGACACGTCAGCATCTCC 600
************************************************************
AT3G20900.1-CDS GGTATCCTAGACTTCTTGGCTTTCGGGGTACAACAACCGCCTGGTGACGTCAGCACCGCT 180
AT3G20900.1-SEQ GGTATCCTAGACTTCTTGGCTTTCGGGGTACAACAACCGCCTGGTGACGTCAGCACCGCT 660
************************************************************
AT3G20900.1-CDS GCTGGGGATGGAGAGGGAACAGAGTAG 207
AT3G20900.1-SEQ GCTGGGGATGGAGAGGGAACAGAGTAG 687
***************************