Permalink
Fetching contributors…
Cannot retrieve contributors at this time
39 lines (33 sloc) 2.42 KB
CLUSTAL W (1.81) multiple sequence alignment
gi|6273285|gb|AF191659.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAGAAAGAA
gi|6273284|gb|AF191658.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAGAAAGAA
gi|6273287|gb|AF191661.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAGAAAGAA
gi|6273286|gb|AF191660.1|AF191 TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAGAAAGAA
gi|6273290|gb|AF191664.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAGAAAGAA
gi|6273289|gb|AF191663.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAGAAAGAA
gi|6273291|gb|AF191665.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAGAAAGAA
******* **** *************************************
gi|6273285|gb|AF191659.1|AF191 TATATA----------ATATATTTCAAATTTCCTTATATACCCAAATATA
gi|6273284|gb|AF191658.1|AF191 TATATATA--------ATATATTTCAAATTTCCTTATATACCCAAATATA
gi|6273287|gb|AF191661.1|AF191 TATATA----------ATATATTTCAAATTTCCTTATATATCCAAATATA
gi|6273286|gb|AF191660.1|AF191 TATATA----------ATATATTTATAATTTCCTTATATATCCAAATATA
gi|6273290|gb|AF191664.1|AF191 TATATATATA------ATATATTTCAAATTCCCTTATATATCCAAATATA
gi|6273289|gb|AF191663.1|AF191 TATATATATA------ATATATTTCAAATTCCCTTATATATCCAAATATA
gi|6273291|gb|AF191665.1|AF191 TATATATATATATATAATATATTTCAAATTCCCTTATATATCCAAATATA
****** ******** **** ********* *********
gi|6273285|gb|AF191659.1|AF191 AAAATATCTAATAAATTAGATGAATATCAAAGAATCCATTGATTTAGTGT
gi|6273284|gb|AF191658.1|AF191 AAAATATCTAATAAATTAGATGAATATCAAAGAATCTATTGATTTAGTGT
gi|6273287|gb|AF191661.1|AF191 AAAATATCTAATAAATTAGATGAATATCAAAGAATCTATTGATTTAGTGT
gi|6273286|gb|AF191660.1|AF191 AAAATATCTAATAAATTAGATGAATATCAAAGAATCTATTGATTTAGTGT
gi|6273290|gb|AF191664.1|AF191 AAAATATCTAATAAATTAGATGAATATCAAAGAATCTATTGATTTAGTGT
gi|6273289|gb|AF191663.1|AF191 AAAATATCTAATAAATTAGATGAATATCAAAGAATCTATTGATTTAGTAT
gi|6273291|gb|AF191665.1|AF191 AAAATATCTAATAAATTAGATGAATATCAAAGAATCTATTGATTTAGTGT
************************************ *********** *
gi|6273285|gb|AF191659.1|AF191 ACCAGA
gi|6273284|gb|AF191658.1|AF191 ACCAGA
gi|6273287|gb|AF191661.1|AF191 ACCAGA
gi|6273286|gb|AF191660.1|AF191 ACCAGA
gi|6273290|gb|AF191664.1|AF191 ACCAGA
gi|6273289|gb|AF191663.1|AF191 ACCAGA
gi|6273291|gb|AF191665.1|AF191 ACCAGA
******