Permalink
Fetching contributors…
Cannot retrieve contributors at this time
337 lines (112 sloc) 7.03 KB
# EPRIMER3 RESULTS FOR NirK00001
# Start Len Tm GC% Sequence
FORWARD PRIMER 8882 20 60.00 50.00 GCAAACTGAAAAGCGGACTC
FORWARD PRIMER 2467 20 60.00 50.00 GGGACGTACTTTCGCACAAT
FORWARD PRIMER 1458 20 60.00 55.00 GTCTTATGCGTGGTGGAGGT
FORWARD PRIMER 9314 20 59.99 50.00 GTACATCAACATCCGCAACG
FORWARD PRIMER 9313 20 59.99 50.00 CGTACATCAACATCCGCAAC
# EPRIMER3 RESULTS FOR NirK00002
# Start Len Tm GC% Sequence
FORWARD PRIMER 3429 20 59.99 50.00 GGAAGTGCTTCTCGTTTTCG
FORWARD PRIMER 1522 20 60.01 55.00 TACAGAGCGTCACGGATGAG
FORWARD PRIMER 9692 20 59.99 50.00 TTGTCATCGTGCTCTTCGTC
FORWARD PRIMER 9626 20 59.99 55.00 GACTCCAACCTCAGCTTTCG
FORWARD PRIMER 3026 20 59.99 55.00 GGCACGAAGAAGGACAGAAG
# EPRIMER3 RESULTS FOR NirK00003
# Start Len Tm GC% Sequence
FORWARD PRIMER 2688 20 59.99 50.00 GAGCAGGAAAAAGCTTGTGG
FORWARD PRIMER 2710 20 59.99 55.00 CTCTGACCCTGCTCGAAAAC
FORWARD PRIMER 8144 20 59.99 50.00 TACTCAACACCCGGCACATA
FORWARD PRIMER 8418 20 60.01 50.00 AAGGTGGTTCGTGTTTCGTC
FORWARD PRIMER 8417 20 60.01 50.00 GAAGGTGGTTCGTGTTTCGT
# EPRIMER3 RESULTS FOR NirK00004
# Start Len Tm GC% Sequence
FORWARD PRIMER 5168 20 60.00 50.00 GTCGTATTCAACGGCAAGGT
FORWARD PRIMER 7441 20 59.99 50.00 GACGTCGAGCAGATGAAACA
FORWARD PRIMER 7445 20 59.98 50.00 TCGAGCAGATGAAACAGGTG
FORWARD PRIMER 5963 20 60.02 50.00 ATGCTGCATCAAGTCAGTGC
FORWARD PRIMER 2750 20 59.97 55.00 TTACCTGACACCGGGAGAAC
# EPRIMER3 RESULTS FOR NirK00005
# Start Len Tm GC% Sequence
FORWARD PRIMER 9667 20 60.00 50.00 ACCTTCGCGTCATGTTTACC
FORWARD PRIMER 3542 20 60.00 50.00 GTTGCGGTATCGAAGTGGTT
FORWARD PRIMER 6535 20 60.01 60.00 CTGACAGAGCGGGTAGAAGG
FORWARD PRIMER 2130 20 59.99 50.00 CGCCAAACCACAGAGGTAAT
FORWARD PRIMER 3642 20 60.01 55.00 TCGTGATGAGCAGGACGTAG
# EPRIMER3 RESULTS FOR NirK00006
# Start Len Tm GC% Sequence
FORWARD PRIMER 3183 20 60.00 50.00 CACAAACTTGTGACGGATGG
FORWARD PRIMER 2333 20 60.01 50.00 TCATCGTAATAGCGCACAGC
FORWARD PRIMER 896 20 59.99 55.00 AGGGTGACTGGCAGGTATTG
FORWARD PRIMER 7499 20 59.99 45.00 TGCACATCAGCAGGAAAAAG
FORWARD PRIMER 177 20 59.99 55.00 GCAAGGCCATAGAGCTGAAC
# EPRIMER3 RESULTS FOR NirK00007
# Start Len Tm GC% Sequence
FORWARD PRIMER 1710 20 60.00 50.00 CCTTCCAGATTGATGGAGGA
FORWARD PRIMER 3695 20 59.99 55.00 ACGGTCTGGTTACGATCCTG
FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC
FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA
FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC
# EPRIMER3 RESULTS FOR NirK00008
# Start Len Tm GC% Sequence
FORWARD PRIMER 1711 20 60.00 50.00 CCTTCCAGATTGATGGAGGA
FORWARD PRIMER 3696 20 59.99 55.00 ACGGTCTGGTTACGATCCTG
FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC
FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA
FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC
# EPRIMER3 RESULTS FOR NirK00009
# Start Len Tm GC% Sequence
FORWARD PRIMER 1711 20 60.00 50.00 CCTTCCAGATTGATGGAGGA
FORWARD PRIMER 3696 20 59.99 55.00 ACGGTCTGGTTACGATCCTG
FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC
FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA
FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC
# EPRIMER3 RESULTS FOR NirK00010
# Start Len Tm GC% Sequence
FORWARD PRIMER 3183 20 60.00 50.00 CACAAACTTGTGACGGATGG
FORWARD PRIMER 896 20 59.99 55.00 AGGGTGACTGGCAGGTATTG
FORWARD PRIMER 7389 20 59.99 45.00 TGCACATCAGCAGGAAAAAG
FORWARD PRIMER 177 20 59.99 55.00 GCAAGGCCATAGAGCTGAAC
FORWARD PRIMER 4939 20 60.02 55.00 TGTCTATCACTGCGCACCTC
# EPRIMER3 RESULTS FOR NirK00011
# Start Len Tm GC% Sequence
FORWARD PRIMER 9096 20 60.00 55.00 GACAACTTCTTCGCCGAGAC
FORWARD PRIMER 4778 20 60.01 45.00 AACAACACCATGCCTCACAA
FORWARD PRIMER 7330 20 60.01 45.00 CGTCAATCGTAAAGCTGCAA
FORWARD PRIMER 3785 20 60.02 45.00 AAATTCGTGCTGAGCTTCGT
FORWARD PRIMER 9188 20 59.97 55.00 CCGCAACTTCTCCTATCTCG
# EPRIMER3 RESULTS FOR NirK00012
# Start Len Tm GC% Sequence
FORWARD PRIMER 1336 20 59.99 50.00 CCAGCCTGAAAGCAAGAAAC
FORWARD PRIMER 2867 20 60.02 55.00 GGCACGTGCAGATAGAGTGA
FORWARD PRIMER 9952 20 60.02 50.00 AACAGGCAGCTGTTCGATCT
FORWARD PRIMER 7634 20 59.98 55.00 CGCTCGAGAAATACGAGGTC
FORWARD PRIMER 4641 20 59.94 55.00 CACGATCGAGGAGAAGAAGG
# EPRIMER3 RESULTS FOR NirK00013
# Start Len Tm GC% Sequence
FORWARD PRIMER 7492 20 60.00 55.00 GGCAGAAACTTCTGGTCTGC
FORWARD PRIMER 8959 20 59.99 50.00 TCTTCACGCATGTCGAGTTC
FORWARD PRIMER 4780 20 59.99 50.00 GAGTTCACGCTCACGATCAA
FORWARD PRIMER 8201 20 59.99 55.00 GAGGTGAAGAAACCGAGCAG
FORWARD PRIMER 4479 20 60.01 50.00 CTCCGCTACAAATGCTGTGA
# EPRIMER3 RESULTS FOR NirK00014
# Start Len Tm GC% Sequence
FORWARD PRIMER 5270 20 59.99 50.00 TTGATCGTGAGCGTGAACTC
FORWARD PRIMER 1849 20 59.99 55.00 CTGCTCGGTTTCTTCACCTC
FORWARD PRIMER 8508 20 60.01 45.00 TCGGTTCATCGAAATCCTTC
FORWARD PRIMER 8991 20 59.98 50.00 AATCCCATTCGGGATAGGTC
FORWARD PRIMER 2803 20 59.98 55.00 CTTCAAGACGCTGGCCTATC
# EPRIMER3 RESULTS FOR NirK00015
# Start Len Tm GC% Sequence
FORWARD PRIMER 5078 20 60.00 55.00 ATCGGCGAGCAGGACTACTA
FORWARD PRIMER 4026 20 60.00 55.00 GCCTTCTGCAACTTCCTCAC
FORWARD PRIMER 251 20 60.01 55.00 CTTTCGCCTCGGTGACTTAG
FORWARD PRIMER 460 20 59.99 40.00 TTGTTGCGAATGAAGCTTTG
FORWARD PRIMER 423 20 59.99 50.00 ACTCAAGAGGCTCACCGAAA
# EPRIMER3 RESULTS FOR NirK00016
# Start Len Tm GC% Sequence
FORWARD PRIMER 6133 20 59.99 45.00 TGCTTGAAAATGACGCACTC
FORWARD PRIMER 136 20 59.99 60.00 CTCGCTGGCTAGGTCATAGG
FORWARD PRIMER 195 20 59.99 45.00 TATCGCACCAAACACGGTAA
FORWARD PRIMER 4937 20 59.99 55.00 CGATTACCCTCACCGTCACT
FORWARD PRIMER 6802 20 60.01 50.00 TATCGCAACCACTGAGCAAG