Skip to content
This repository
Fetching contributors…

Octocat-spinner-32-eaf2f5

Cannot retrieve contributors at this time

file 337 lines (112 sloc) 7.2 kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336

# EPRIMER3 RESULTS FOR NirK00001

# Start Len Tm GC% Sequence

     FORWARD PRIMER 8882 20 60.00 50.00 GCAAACTGAAAAGCGGACTC


     FORWARD PRIMER 2467 20 60.00 50.00 GGGACGTACTTTCGCACAAT


     FORWARD PRIMER 1458 20 60.00 55.00 GTCTTATGCGTGGTGGAGGT


     FORWARD PRIMER 9314 20 59.99 50.00 GTACATCAACATCCGCAACG


     FORWARD PRIMER 9313 20 59.99 50.00 CGTACATCAACATCCGCAAC




# EPRIMER3 RESULTS FOR NirK00002

# Start Len Tm GC% Sequence

     FORWARD PRIMER 3429 20 59.99 50.00 GGAAGTGCTTCTCGTTTTCG


     FORWARD PRIMER 1522 20 60.01 55.00 TACAGAGCGTCACGGATGAG


     FORWARD PRIMER 9692 20 59.99 50.00 TTGTCATCGTGCTCTTCGTC


     FORWARD PRIMER 9626 20 59.99 55.00 GACTCCAACCTCAGCTTTCG


     FORWARD PRIMER 3026 20 59.99 55.00 GGCACGAAGAAGGACAGAAG




# EPRIMER3 RESULTS FOR NirK00003

# Start Len Tm GC% Sequence

     FORWARD PRIMER 2688 20 59.99 50.00 GAGCAGGAAAAAGCTTGTGG


     FORWARD PRIMER 2710 20 59.99 55.00 CTCTGACCCTGCTCGAAAAC


     FORWARD PRIMER 8144 20 59.99 50.00 TACTCAACACCCGGCACATA


     FORWARD PRIMER 8418 20 60.01 50.00 AAGGTGGTTCGTGTTTCGTC


     FORWARD PRIMER 8417 20 60.01 50.00 GAAGGTGGTTCGTGTTTCGT




# EPRIMER3 RESULTS FOR NirK00004

# Start Len Tm GC% Sequence

     FORWARD PRIMER 5168 20 60.00 50.00 GTCGTATTCAACGGCAAGGT


     FORWARD PRIMER 7441 20 59.99 50.00 GACGTCGAGCAGATGAAACA


     FORWARD PRIMER 7445 20 59.98 50.00 TCGAGCAGATGAAACAGGTG


     FORWARD PRIMER 5963 20 60.02 50.00 ATGCTGCATCAAGTCAGTGC


     FORWARD PRIMER 2750 20 59.97 55.00 TTACCTGACACCGGGAGAAC




# EPRIMER3 RESULTS FOR NirK00005

# Start Len Tm GC% Sequence

     FORWARD PRIMER 9667 20 60.00 50.00 ACCTTCGCGTCATGTTTACC


     FORWARD PRIMER 3542 20 60.00 50.00 GTTGCGGTATCGAAGTGGTT


     FORWARD PRIMER 6535 20 60.01 60.00 CTGACAGAGCGGGTAGAAGG


     FORWARD PRIMER 2130 20 59.99 50.00 CGCCAAACCACAGAGGTAAT


     FORWARD PRIMER 3642 20 60.01 55.00 TCGTGATGAGCAGGACGTAG




# EPRIMER3 RESULTS FOR NirK00006

# Start Len Tm GC% Sequence

     FORWARD PRIMER 3183 20 60.00 50.00 CACAAACTTGTGACGGATGG


     FORWARD PRIMER 2333 20 60.01 50.00 TCATCGTAATAGCGCACAGC


     FORWARD PRIMER 896 20 59.99 55.00 AGGGTGACTGGCAGGTATTG


     FORWARD PRIMER 7499 20 59.99 45.00 TGCACATCAGCAGGAAAAAG


     FORWARD PRIMER 177 20 59.99 55.00 GCAAGGCCATAGAGCTGAAC




# EPRIMER3 RESULTS FOR NirK00007

# Start Len Tm GC% Sequence

     FORWARD PRIMER 1710 20 60.00 50.00 CCTTCCAGATTGATGGAGGA


     FORWARD PRIMER 3695 20 59.99 55.00 ACGGTCTGGTTACGATCCTG


     FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC


     FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA


     FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC




# EPRIMER3 RESULTS FOR NirK00008

# Start Len Tm GC% Sequence

     FORWARD PRIMER 1711 20 60.00 50.00 CCTTCCAGATTGATGGAGGA


     FORWARD PRIMER 3696 20 59.99 55.00 ACGGTCTGGTTACGATCCTG


     FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC


     FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA


     FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC




# EPRIMER3 RESULTS FOR NirK00009

# Start Len Tm GC% Sequence

     FORWARD PRIMER 1711 20 60.00 50.00 CCTTCCAGATTGATGGAGGA


     FORWARD PRIMER 3696 20 59.99 55.00 ACGGTCTGGTTACGATCCTG


     FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC


     FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA


     FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC




# EPRIMER3 RESULTS FOR NirK00010

# Start Len Tm GC% Sequence

     FORWARD PRIMER 3183 20 60.00 50.00 CACAAACTTGTGACGGATGG


     FORWARD PRIMER 896 20 59.99 55.00 AGGGTGACTGGCAGGTATTG


     FORWARD PRIMER 7389 20 59.99 45.00 TGCACATCAGCAGGAAAAAG


     FORWARD PRIMER 177 20 59.99 55.00 GCAAGGCCATAGAGCTGAAC


     FORWARD PRIMER 4939 20 60.02 55.00 TGTCTATCACTGCGCACCTC




# EPRIMER3 RESULTS FOR NirK00011

# Start Len Tm GC% Sequence

     FORWARD PRIMER 9096 20 60.00 55.00 GACAACTTCTTCGCCGAGAC


     FORWARD PRIMER 4778 20 60.01 45.00 AACAACACCATGCCTCACAA


     FORWARD PRIMER 7330 20 60.01 45.00 CGTCAATCGTAAAGCTGCAA


     FORWARD PRIMER 3785 20 60.02 45.00 AAATTCGTGCTGAGCTTCGT


     FORWARD PRIMER 9188 20 59.97 55.00 CCGCAACTTCTCCTATCTCG




# EPRIMER3 RESULTS FOR NirK00012

# Start Len Tm GC% Sequence

     FORWARD PRIMER 1336 20 59.99 50.00 CCAGCCTGAAAGCAAGAAAC


     FORWARD PRIMER 2867 20 60.02 55.00 GGCACGTGCAGATAGAGTGA


     FORWARD PRIMER 9952 20 60.02 50.00 AACAGGCAGCTGTTCGATCT


     FORWARD PRIMER 7634 20 59.98 55.00 CGCTCGAGAAATACGAGGTC


     FORWARD PRIMER 4641 20 59.94 55.00 CACGATCGAGGAGAAGAAGG




# EPRIMER3 RESULTS FOR NirK00013

# Start Len Tm GC% Sequence

     FORWARD PRIMER 7492 20 60.00 55.00 GGCAGAAACTTCTGGTCTGC


     FORWARD PRIMER 8959 20 59.99 50.00 TCTTCACGCATGTCGAGTTC


     FORWARD PRIMER 4780 20 59.99 50.00 GAGTTCACGCTCACGATCAA


     FORWARD PRIMER 8201 20 59.99 55.00 GAGGTGAAGAAACCGAGCAG


     FORWARD PRIMER 4479 20 60.01 50.00 CTCCGCTACAAATGCTGTGA




# EPRIMER3 RESULTS FOR NirK00014

# Start Len Tm GC% Sequence

     FORWARD PRIMER 5270 20 59.99 50.00 TTGATCGTGAGCGTGAACTC


     FORWARD PRIMER 1849 20 59.99 55.00 CTGCTCGGTTTCTTCACCTC


     FORWARD PRIMER 8508 20 60.01 45.00 TCGGTTCATCGAAATCCTTC


     FORWARD PRIMER 8991 20 59.98 50.00 AATCCCATTCGGGATAGGTC


     FORWARD PRIMER 2803 20 59.98 55.00 CTTCAAGACGCTGGCCTATC




# EPRIMER3 RESULTS FOR NirK00015

# Start Len Tm GC% Sequence

     FORWARD PRIMER 5078 20 60.00 55.00 ATCGGCGAGCAGGACTACTA


     FORWARD PRIMER 4026 20 60.00 55.00 GCCTTCTGCAACTTCCTCAC


     FORWARD PRIMER 251 20 60.01 55.00 CTTTCGCCTCGGTGACTTAG


     FORWARD PRIMER 460 20 59.99 40.00 TTGTTGCGAATGAAGCTTTG


     FORWARD PRIMER 423 20 59.99 50.00 ACTCAAGAGGCTCACCGAAA




# EPRIMER3 RESULTS FOR NirK00016

# Start Len Tm GC% Sequence

     FORWARD PRIMER 6133 20 59.99 45.00 TGCTTGAAAATGACGCACTC


     FORWARD PRIMER 136 20 59.99 60.00 CTCGCTGGCTAGGTCATAGG


     FORWARD PRIMER 195 20 59.99 45.00 TATCGCACCAAACACGGTAA


     FORWARD PRIMER 4937 20 59.99 55.00 CGATTACCCTCACCGTCACT


     FORWARD PRIMER 6802 20 60.01 50.00 TATCGCAACCACTGAGCAAG



Something went wrong with that request. Please try again.