Skip to content
Fetching contributors…
Cannot retrieve contributors at this time
37 lines (17 sloc) 923 Bytes
# PRIMER3 RESULTS FOR AC074298
# Start Len Tm GC% Sequence
1 PRODUCT SIZE: 218
FORWARD PRIMER 114 20 60.08 45.00 CCGGTTTCTCTGGTTGAAAA
REVERSE PRIMER 310 22 59.82 40.91 TCACATTCCCAAATGTAGATCG
2 PRODUCT SIZE: 212
FORWARD PRIMER 114 20 60.08 45.00 CCGGTTTCTCTGGTTGAAAA
REVERSE PRIMER 304 22 59.61 40.91 TCCCAAATGTAGATCGTAGCAA
3 PRODUCT SIZE: 219
FORWARD PRIMER 113 20 59.57 45.00 ACCGGTTTCTCTGGTTGAAA
REVERSE PRIMER 310 22 59.82 40.91 TCACATTCCCAAATGTAGATCG
4 PRODUCT SIZE: 220
FORWARD PRIMER 112 20 59.57 45.00 AACCGGTTTCTCTGGTTGAA
REVERSE PRIMER 310 22 59.82 40.91 TCACATTCCCAAATGTAGATCG
5 PRODUCT SIZE: 213
FORWARD PRIMER 113 20 59.57 45.00 ACCGGTTTCTCTGGTTGAAA
REVERSE PRIMER 304 22 59.61 40.91 TCCCAAATGTAGATCGTAGCAA
Jump to Line
Something went wrong with that request. Please try again.