Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

9 lines (7 sloc) 0.321 kb
Primer name Test
Amplimer 1
Sequence: AC074298 AC074298
Telomere associated sequence for Arabidopsis thaliana TEL1N from chromosome I, complete sequence.
CCGGTTTCTCTGGTTGAAAA hits forward strand at 114 with 0 mismatches
TCACATTCCCAAATGTAGATCG hits reverse strand at [114] with 0 mismatches
Amplimer length: 218 bp
Jump to Line
Something went wrong with that request. Please try again.