Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

165 lines (102 sloc) 5.571 kb
# EPRIMER3 PRIMERS classify/specific_primers.eprimer3
# Start Len Tm GC% Sequence
# primer_0377 sequences/draft_stitched.fasta
1 PRODUCT SIZE: 102
FORWARD PRIMER 1749301 20 59.88 45.00 AAACCTCGCATTTGCTGACT
REVERSE PRIMER 1749383 20 59.88 45.00 TTCAGGTTGTGCTTGAAACG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0274 sequences/draft_stitched.fasta
2 PRODUCT SIZE: 103
FORWARD PRIMER 2463143 20 59.98 50.00 AGCTGACCTATGCCGAAGAA
REVERSE PRIMER 2463226 20 59.87 50.00 GCAGTGTCAATGCGACCTAA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0579 sequences/draft_stitched.fasta
3 PRODUCT SIZE: 102
FORWARD PRIMER 2463144 20 59.84 55.00 GCTGACCTATGCCGAAGAAC
REVERSE PRIMER 2463226 20 59.87 50.00 GCAGTGTCAATGCGACCTAA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0681 sequences/draft_stitched.fasta
4 PRODUCT SIZE: 105
FORWARD PRIMER 1716620 20 59.98 50.00 AGATCTGAGCGGTAGGCAAA
REVERSE PRIMER 1716705 20 59.86 50.00 CAGTGAATCCGTTCGTAGCA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0244 sequences/draft_stitched.fasta
5 PRODUCT SIZE: 101
FORWARD PRIMER 1749302 20 59.88 45.00 AACCTCGCATTTGCTGACTT
REVERSE PRIMER 1749383 20 59.88 45.00 TTCAGGTTGTGCTTGAAACG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0099 sequences/draft_stitched.fasta
6 PRODUCT SIZE: 99
FORWARD PRIMER 2451789 20 59.92 45.00 CATCAATGCCGATGTATTGC
REVERSE PRIMER 2451868 20 59.91 50.00 TCGAAACACGACAACTACGC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0095 sequences/draft_stitched.fasta
7 PRODUCT SIZE: 96
FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
REVERSE PRIMER 1743282 20 59.99 50.00 CTTGTTCCCTTCAGCAAAGC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0399 sequences/draft_stitched.fasta
8 PRODUCT SIZE: 98
FORWARD PRIMER 2469970 20 59.83 45.00 GTCCGGCATTTATTGTTCGT
REVERSE PRIMER 2470048 20 59.93 45.00 GAAACCGCGATTATCCGTTA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0022 sequences/draft_stitched.fasta
9 PRODUCT SIZE: 98
FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
REVERSE PRIMER 1743284 20 59.99 45.00 AGCTTGTTCCCTTCAGCAAA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0354 sequences/draft_stitched.fasta
10 PRODUCT SIZE: 103
FORWARD PRIMER 1764327 20 59.85 45.00 ATCACTGGCCGCTTTAAGAA
REVERSE PRIMER 1764410 20 59.98 45.00 CTTTCGAATACAGCGCATCA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0075 sequences/draft_stitched.fasta
11 PRODUCT SIZE: 100
FORWARD PRIMER 1755369 20 59.84 50.00 GACAACGTCAATGCAGGAGA
REVERSE PRIMER 1755449 20 59.96 50.00 GCCCGGTTAACGTCTCAATA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0610 sequences/draft_stitched.fasta
12 PRODUCT SIZE: 98
FORWARD PRIMER 1733877 20 59.87 50.00 AGAATGTCCGTGAGCGAGTT
REVERSE PRIMER 1733955 20 59.83 45.00 TTGATATGCACCGAGCTTTG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0442 sequences/draft_stitched.fasta
13 PRODUCT SIZE: 100
FORWARD PRIMER 1747595 20 59.83 50.00 GCACGGACAGATAATGCAGA
REVERSE PRIMER 1747675 20 59.82 45.00 GGCATCTTTCGCGAATTTAG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0223 sequences/draft_stitched.fasta
14 PRODUCT SIZE: 102
FORWARD PRIMER 1764327 20 59.85 45.00 ATCACTGGCCGCTTTAAGAA
REVERSE PRIMER 1764409 20 59.98 45.00 TTTCGAATACAGCGCATCAG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0049 sequences/draft_stitched.fasta
15 PRODUCT SIZE: 97
FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
REVERSE PRIMER 1743283 20 59.99 50.00 GCTTGTTCCCTTCAGCAAAG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0547 sequences/draft_stitched.fasta
16 PRODUCT SIZE: 99
FORWARD PRIMER 2463143 20 59.98 50.00 AGCTGACCTATGCCGAAGAA
REVERSE PRIMER 2463222 20 59.69 45.00 TGTCAATGCGACCTAATTGC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0712 sequences/draft_stitched.fasta
17 PRODUCT SIZE: 100
FORWARD PRIMER 2450861 20 59.72 45.00 CAGTAACGCCGAATGCAATA
REVERSE PRIMER 2450941 20 59.86 50.00 GTTTCAACCCGGCAGTGTAT
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0576 sequences/draft_stitched.fasta
18 PRODUCT SIZE: 101
FORWARD PRIMER 4323538 20 59.92 45.00 TCACCCATGGCTTCACATTA
REVERSE PRIMER 4323619 20 59.74 55.00 AACCCACACACCGGCTATAC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0676 sequences/draft_stitched.fasta
19 PRODUCT SIZE: 93
FORWARD PRIMER 1740378 20 59.96 50.00 CTGGGATTTGCTCCGTATGT
REVERSE PRIMER 1740451 20 59.99 50.00 ATATACGCAACCCGCAGAAC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0408 sequences/draft_stitched.fasta
20 PRODUCT SIZE: 104
FORWARD PRIMER 1757556 20 59.99 50.00 AACTCCAGTGGCGTATTTGG
REVERSE PRIMER 1757640 20 59.86 50.00 ATCTGCGAATGTGTCTGACG
INTERNAL OLIGO 0 0 0.00 0.00
Jump to Line
Something went wrong with that request. Please try again.