Permalink
Fetching contributors…
Cannot retrieve contributors at this time
165 lines (102 sloc) 5.44 KB
# EPRIMER3 PRIMERS classify/specific_primers.eprimer3
# Start Len Tm GC% Sequence
# primer_0377 sequences/draft_stitched.fasta
1 PRODUCT SIZE: 102
FORWARD PRIMER 1749301 20 59.88 45.00 AAACCTCGCATTTGCTGACT
REVERSE PRIMER 1749383 20 59.88 45.00 TTCAGGTTGTGCTTGAAACG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0274 sequences/draft_stitched.fasta
2 PRODUCT SIZE: 103
FORWARD PRIMER 2463143 20 59.98 50.00 AGCTGACCTATGCCGAAGAA
REVERSE PRIMER 2463226 20 59.87 50.00 GCAGTGTCAATGCGACCTAA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0579 sequences/draft_stitched.fasta
3 PRODUCT SIZE: 102
FORWARD PRIMER 2463144 20 59.84 55.00 GCTGACCTATGCCGAAGAAC
REVERSE PRIMER 2463226 20 59.87 50.00 GCAGTGTCAATGCGACCTAA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0681 sequences/draft_stitched.fasta
4 PRODUCT SIZE: 105
FORWARD PRIMER 1716620 20 59.98 50.00 AGATCTGAGCGGTAGGCAAA
REVERSE PRIMER 1716705 20 59.86 50.00 CAGTGAATCCGTTCGTAGCA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0244 sequences/draft_stitched.fasta
5 PRODUCT SIZE: 101
FORWARD PRIMER 1749302 20 59.88 45.00 AACCTCGCATTTGCTGACTT
REVERSE PRIMER 1749383 20 59.88 45.00 TTCAGGTTGTGCTTGAAACG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0099 sequences/draft_stitched.fasta
6 PRODUCT SIZE: 99
FORWARD PRIMER 2451789 20 59.92 45.00 CATCAATGCCGATGTATTGC
REVERSE PRIMER 2451868 20 59.91 50.00 TCGAAACACGACAACTACGC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0095 sequences/draft_stitched.fasta
7 PRODUCT SIZE: 96
FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
REVERSE PRIMER 1743282 20 59.99 50.00 CTTGTTCCCTTCAGCAAAGC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0399 sequences/draft_stitched.fasta
8 PRODUCT SIZE: 98
FORWARD PRIMER 2469970 20 59.83 45.00 GTCCGGCATTTATTGTTCGT
REVERSE PRIMER 2470048 20 59.93 45.00 GAAACCGCGATTATCCGTTA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0022 sequences/draft_stitched.fasta
9 PRODUCT SIZE: 98
FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
REVERSE PRIMER 1743284 20 59.99 45.00 AGCTTGTTCCCTTCAGCAAA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0354 sequences/draft_stitched.fasta
10 PRODUCT SIZE: 103
FORWARD PRIMER 1764327 20 59.85 45.00 ATCACTGGCCGCTTTAAGAA
REVERSE PRIMER 1764410 20 59.98 45.00 CTTTCGAATACAGCGCATCA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0075 sequences/draft_stitched.fasta
11 PRODUCT SIZE: 100
FORWARD PRIMER 1755369 20 59.84 50.00 GACAACGTCAATGCAGGAGA
REVERSE PRIMER 1755449 20 59.96 50.00 GCCCGGTTAACGTCTCAATA
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0610 sequences/draft_stitched.fasta
12 PRODUCT SIZE: 98
FORWARD PRIMER 1733877 20 59.87 50.00 AGAATGTCCGTGAGCGAGTT
REVERSE PRIMER 1733955 20 59.83 45.00 TTGATATGCACCGAGCTTTG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0442 sequences/draft_stitched.fasta
13 PRODUCT SIZE: 100
FORWARD PRIMER 1747595 20 59.83 50.00 GCACGGACAGATAATGCAGA
REVERSE PRIMER 1747675 20 59.82 45.00 GGCATCTTTCGCGAATTTAG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0223 sequences/draft_stitched.fasta
14 PRODUCT SIZE: 102
FORWARD PRIMER 1764327 20 59.85 45.00 ATCACTGGCCGCTTTAAGAA
REVERSE PRIMER 1764409 20 59.98 45.00 TTTCGAATACAGCGCATCAG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0049 sequences/draft_stitched.fasta
15 PRODUCT SIZE: 97
FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
REVERSE PRIMER 1743283 20 59.99 50.00 GCTTGTTCCCTTCAGCAAAG
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0547 sequences/draft_stitched.fasta
16 PRODUCT SIZE: 99
FORWARD PRIMER 2463143 20 59.98 50.00 AGCTGACCTATGCCGAAGAA
REVERSE PRIMER 2463222 20 59.69 45.00 TGTCAATGCGACCTAATTGC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0712 sequences/draft_stitched.fasta
17 PRODUCT SIZE: 100
FORWARD PRIMER 2450861 20 59.72 45.00 CAGTAACGCCGAATGCAATA
REVERSE PRIMER 2450941 20 59.86 50.00 GTTTCAACCCGGCAGTGTAT
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0576 sequences/draft_stitched.fasta
18 PRODUCT SIZE: 101
FORWARD PRIMER 4323538 20 59.92 45.00 TCACCCATGGCTTCACATTA
REVERSE PRIMER 4323619 20 59.74 55.00 AACCCACACACCGGCTATAC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0676 sequences/draft_stitched.fasta
19 PRODUCT SIZE: 93
FORWARD PRIMER 1740378 20 59.96 50.00 CTGGGATTTGCTCCGTATGT
REVERSE PRIMER 1740451 20 59.99 50.00 ATATACGCAACCCGCAGAAC
INTERNAL OLIGO 0 0 0.00 0.00
# primer_0408 sequences/draft_stitched.fasta
20 PRODUCT SIZE: 104
FORWARD PRIMER 1757556 20 59.99 50.00 AACTCCAGTGGCGTATTTGG
REVERSE PRIMER 1757640 20 59.86 50.00 ATCTGCGAATGTGTCTGACG
INTERNAL OLIGO 0 0 0.00 0.00