Fetching contributors…
Cannot retrieve contributors at this time
253 lines (250 sloc) 11.5 KB
;; Modified by adf on Sat Nov 9 17:38:25 1996
;; Modified by adf on Sat Nov 9 16:27:39 1996
;; Modified by kam on Mon Nov 20 12:58:58 1995
;; Modified by kxm on Sat Nov 5 01:21:01 1994
;; Modified by kxm on Sat Nov 5 01:12:11 1994
;; Modified by kxm on Sat Nov 5 00:44:35 1994
;; Modified by kxm on Sat Nov 5 00:03:23 1994
;; Modified by kxm on Fri Nov 4 23:58:34 1994
;; Modified by kxm on Fri Nov 4 23:17:50 1994
;; Modified by kxm on Fri Nov 4 23:12:24 1994
;; Modified by kxm on Fri Nov 4 22:57:56 1994
;; Modified by kxm on Fri Nov 4 12:15:17 1994
;; Modified by kxm on Thu Nov 3 21:30:26 1994
;; Modified by kxm on Thu Nov 3 19:40:25 1994
;; Modified by kam on Thu Mar 18 09:56:44 1993
;; Modified by kam on Fri Mar 12 11:51:25 1993
; LOCUS HIVU455
;
; Modified by kam on Mon Jul 20 12:24:18 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
A_U455
ATGGAGCCAGTAGATCCTAACCTAGAGCCCTGGAAACACCCGGGAAGTCAGCCTACAACTGCTTGTAGCA
ACTGTTATTGTAAAGTGTGTTGCTGGCATTGCCAACTTTGCTTTCTGAAAAAAGGCTTAGGCATTTCCTA
TGGCAAGAAGAAGCGGAAACCCCGACGAGGACCTCCTCAAGGCAGTAAGGATCATCAAACTCTTATACCA
AAGCAACCCTTGCCCCAATCCCAGAGGGTCTCGGCAGGCCAGGAAGAATCGAAGAAGAAGGTGGAGAGCA
AGGCAAAGACAGATCGATTCGCT
; LOCUS HIVHXB2R
;
; Modified by kam on Mon Jul 20 12:24:18 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
B_HXB2R
ATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCA
ATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTA
TGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCA
AAGCAACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAG
AGACAGAGACAGATCCATTCGATTAG
; HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 (UG268) PROVIRAL DNA
; ENCODING ENV, TAT, VPU, REV, AND NEF GENES.
; Modified by kxm on Thu Nov 3 16:33:55 1994
; Modified by kxm on Thu Nov 3 17:45:53 1994
; Modified by kxm on Thu Nov 3 17:56:16 1994
; Modified by kxm on Thu Nov 3 18:05:51 1994
; Modified by kxm on Thu Nov 3 18:56:08 1994
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by cxc on Mon Nov 7 11:17:23 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
; Modified by adf on Sat Nov 9 17:38:25 1996
C_UG268A
%CAGGAAGTCAGCCTAAAACTCCTTGTACTAAGTGTTTTGGTAAAAAATGTAGTTATCATTGTCAAGTTT
GCTTTCTGAACAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAACGCTCCTCC
AAGCAGTGAGGATCATCAAAATCTTATATCAAAGCAACCCTTACCCCAACCCCGAGGGGACCCGACAGGC
CCGGAGAAATCGAAGAAGAAGGTGGAGAGCAAGACAGAGACAGATCCGTGAGATTAA
; LOCUS HIVELI
;
; Modified by kam on Mon Jul 20 12:24:18 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Fri Nov 4 23:17:50 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
D_ELI
ATGGATCCAGTAGATCCTAACCTAGAGCCCTGGAACCATCCAGGAAGTCAGCCTAGGACTCCTTGTAACA
AGTGTCATTGTAAAAAGTGTTGCTATCATTGCCCAGTTTGCTTCTTAAACAAAGGCTTAGGCATCTCCTA
TGGCAGGAAGAAGCGGAGACAGCGACGAGGACCTCCTCAAGGCGGTCAGGCTCATCAAGTTCCTATACCA
AAGCAACCCTCCTCCCAGCCCCGAGGGGACCCGACAGGCCCGAAGGAACAGAAGAAGAAGGTGGAGAGCG
AGGCAGAGACAGATCCGTGAGATTGCTGA
; Region 70 to 290 stored
;
; Region 70 to 290, from file bz163a.mase-nuc
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
F_BZ163A
ATGGAGCTAGTAGATCCTAACTTAGATCCCTGGAACCATCCAGGAAGCCAGCCTACAACTCCTTGTACAA
AATGCTATTGTAAACGATGTTGCTTTCATTGTCAATGGTGCTTTACAACGAAGGGCTTAGGCATCTCCTA
TGGCAGGAAGAAGCGGAAACAGCGGCACCGAACTCCTCAGAGCAGCCAGATACATCAAGATCTTGTACCA
AAGCAACCCATATCCCAAGCCCGAGGGAACCCGACAGGCCCGAAGAAATCGAAGAAGGAGGTGGAGAGCA
AGGCAGAGACAGATCCGTGAGATTAGTAG
; Modified by kam on Mon Jul 20 12:10:15 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Sat Nov 5 00:44:35 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
O_ANT70
ATGGATCCAGTAGATCCTGAGGTGCCCCCTTGGCACCACCCTGGAAGTCAGCCCCAGATCCCTTGTAATA
ATTGCTATTGCAAAAGATGCTGCTATCATTGCTATGTTTGTTTCGTAAGAAAGGGTTTGGGAATCTCCTA
TGGCAGGAAGAAGCGAGGACGACCAGCTGCTGCAAGCCATCCAGATCATAAAGATCCTGTACCAAAGCAA
TCCCCAACCATCACCAAGAGGAAGCAGGAACGCCAGGAAGAACAGGAGGAGGAGGTGGAGAAGAAGGCAG
GCCCAGGTGGATACCCTCGCCGCAAGGGTTCTTGCCACTGTTGTACACGGACCTCAGAACAA
;
; Modified by rkl on Wed Jun 30 09:36:11 1993
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Sat Nov 5 00:44:35 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
O_MVP5180
ATGGATCCAGTAGATCCTGAGATGCCCCCTTGGCATCACCCTGGGAGCAAGCCCCAAACCCCTTGTAATA
ATTGCTATTGCAAAAGATGCTGCTATCATTGCTATGTTTGTTTCACAAAGAAGGGTTTGGGAATCTCCCA
TGGCAGGAAGAAGCGAAGAAGACCAGCAGCTGCTGCAAGCTATCCAGATAATAAAGATCCTGTACCAGAG
CAATCCCTGTCCCACACCGGCAGGAAGCAGAAACGCCAGGAAGAACAGGAGAAGAAGGTGGAGAAGGAGA
CAGGCCCAAGTGGACAGCCTTGCCACCAGGATTCTTGCAACAGTTGTACACGGATCTCAGGACAATAA
; LOCUS SIVCPZ
;
; Modified by kam on Fri Jul 17 11:13:21 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Fri Nov 4 23:12:24 1994
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
CPZGAB
ATGGATCCAATAGATCCTGACCTGGAGCCCTGGAAACACCCAGGCAGTCAGCCAAGAACAGTTTGTAATA
ATTGCTATTGCAAAGCTTGTTGTTATCACTGTATATATTGCTTCACAAAAAAAGGCTTAGGAATCTCCTA
TGGCAGGAAGAAGCGAACCACAAGACGACGCACGGCTCCTGCAGGCAGTAAAAATAATCAAGATTCTATA
CCAAAGCAACCCTTATCCCAGTCCAGAGGGAACAAGGAAGGCTCGGAGAAATCGACGAAGGAGGTGGCGA
GCAAGACAGAAGCAGATCAGTGAGATTAG
;
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Fri Nov 4 23:12:24 1994
; Modified by kxm on Fri Nov 4 23:58:34 1994
; Modified by acs on Mon Nov 27 10:24:48 1995
; Modified by kam on Thu Nov 30 09:43:33 1995
; Modified by bwb on Fri Dec 1 09:03:00 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
CPZANT
ATGGACCCCGTAGACGCTGAAACACCTCCATGGTTACACCCTCCTGCTACACCAGCAACGCCATGCAATA
ACTGTTACTGTAAATGCTGTTGTTACCATTGCCCTCTCTGCTTCACAAAAAAAGGCTTGGGGATTTCCTA
TGGCAGGAAGAGAAGAGCTCGAAGGAACAGACGAACAACTGCTGAAAGCAGTGAAAATAATCAAGATCCT
GTATCAAAATCCCTACCCAAAACCAGCAGGATCCAGAGCAGCCAGAAGAAATAAGAGAAGAAGGTGGAAG
AAAAGACAGGATCAGGTGGAGGGCCTTGC
;; Modified by cxc on Thu Oct 20 14:56:54 1994
; LOCUS HIV2ROD.nuc
;
; Modified by kam on Thu Jul 29 11:47:29 1993
; Modified by cxc on Fri Oct 28 14:37:09 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
A_ROD
ATGGAGACACCCTTGAAGGCGCCAGAGAGCTCATTAAAGTCCTGCAACGAGCCCTTTTCACGCACTTCAG
AGCAGGATGTGGCCACTCAAGAATTGGCCAGACAAGGGGAGGAAATCCTCTCTCAGCTATACCGACCCCT
AGAAACATGCAATAACTCATGCTATTGTAAGCGATGCTGCTACCATTGTCAGATGTGTTTTCTAAACAAG
GGGCTCGGGATATGTTATGAACGAAAGGGCAGACGAAGAAGGACTCCAAAGAAAACTAAGACTCATCCGT
CTCCTACACCAGACAAATCCATATCCACAAGGACCGGGGACAGCCAGCCAACGAAGAAACAGAAGAAGAC
GGTGGAAGCAACGGTGGAGACAGATACTGGCCCTGGCCGA
;; Modified by bwb on Wed Sep 14 11:35:17 1994
; HIV2 (ISOLATE EHO) PROVIRUS NUCLEOCAPSID CORE PROTEIN (GAG)
; GENE, 3' END THROUGH THE 3' LTR.
; Modified by bwb on Wed Sep 14 11:35:17 1994
; Modified by bwb on Thu Sep 15 15:12:52 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
B_EHOA
ATGGAAATACCCTTGAAGGAGCAGGAGAGCTCATTAAACTCCTCCAGCGGGCACTCTTCCTCCACTTCAG
AGGGGGTTGCCAACACTCAAGGATTGGACAACCGGGGGGAGGAAATCCTCTCTCAGCTATACCGCCCTCT
TAAGGCATGCAGTAATACATGCTACTGTAAAAAATGTTCCTACCATTGCCAGCTTTGCTTTCTTAAAAAG
GGCCTGGGGATATGTTATGAACGCTCGAGAAAGAGATCTTCAAAAAGGGCTAAGACTACTACATCTTCTG
CACCAAACAACAGATCCCTATCCGCAAGGACCGGGGACAGCCAGCCAACGAAGAAACAGAAGAAGGAGGT
GGAAACAACGAGGGCTACAGATCTTGGCCCTGGCAGATCGAATACATCCACTTCCCGATTCGCCAACTGA
; LOCUS SIVMM251.nuc
;
; Modified by kam on Wed Sep 2 10:04:14 1992
; Modified by cxc on Fri Oct 28 14:37:09 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
D_MM251
ATGGAGACACCCTTGAGGGAGCAGGAGAACTCATTAGAATCCTCCAACGAGCGCTCTTCATGCATTTTAG
AGGCGGATGCAACCACTCCAGAATCGGCCAACCTGGGGGAGGAAATCCTCTCTCAACTATACCGCCCTCT
TGAGGCGTGCTATAACACATGCTATTGTAAAAAGTGTTGCTACCATTGCCAGTTTTGTTTTCTTAAAAAG
GGATTGGGGATATGTTATGAGCAGTCACGAAAGAGAAGAAGAACTCCGAAAAAGGCTAAGGCTAATACAT
CTTCTGCATCAAACAAACTCATACCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGAC
GGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGA
; LOCUS SIVSTM.nuc
;
; Modified by kam on Wed Sep 2 10:04:14 1992
; Modified by cxc on Fri Oct 28 14:37:09 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
STM_STM
ATGGAGACACCCTTGAAGGAGCAGGAGAGCTCATTAAGATCCTCCAGCGAGCCCTCTTCATGCACTTCAG
AGGCGGTTGCCGCCACTCCAGGATTGGCCAACCAGGAGGAGGAAATCCTTTGGCAACTATACCGCCCACT
AGAGGAGTGTTGTAACAAGTGCTTTTGCAAAAAATGTTGCTATCACTGCCAGCTGTGTTTTGTTACAAAA
GGTCTTGGAATAACCTATGAGCGATCAAGAAGAAGAGTTAAGAAAAAGGCTAAGACTTATCCAATTTCTG
CATCAAACAACAGATCCCTATCCACAAGGGCCAGGAACAGCCAACCAAAGAAGGAACAGAAGAAGGAGGT
GGAGACAGAGGTGGAATCAACTCCTGGCCTTGGCAAA
;; Modified by rkl on Mon Apr 19 10:38:05 1993
;; Modified by rkl on Mon Apr 19 10:30:34 1993
; LOCUS SIVAGM3
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
VER_AGM3
ATGGACAAGGGGGAGGACGAGCAGGGCGCGTACCACCAGGACTTGATTGAACAACTCAAAGCACCCCTGA
AGCGGTGTACAAACAAGTGCTATTGTAAATGTTGCTGTTATCACTGTCAGCTTTGCTTTTTACAAAAGGG
ATTAGGTGTTACCTATCATGCCCCTAGGATCAGAAGAAAGAAGATTGCTCCGCTTGATCGCTTTCCTGAA
CAAAAACAATCCATATCCACCCGTGGAAGGGACAGCCAGACAACGCAGAAGGGCCAGGAGAAGGTGGAGA
CAAGCGCAAGAACAGCTCCGAGCCTTGGCAGAAAGAATCTGGCACAGCAGAGTGGAAGAGCAACTGGTGC
AAGC
;
; LOCUS SIVAGM677
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by rkl on Mon Apr 19 10:38:05 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
GRI_AGM677
ATGGACAAGGAGGAGGAGCCCCACCCCCTCCTCCAGGACTTGCATAGGCCATTACAACCATGTACTAATA
AATGCTATTGCAAAAAATGCTGTTATCACTGTGAGCTTTGCTTCCTGCAGAAGGGCTTAGGAGTGCGTTA
TCATGTCTCTAGGAAAAGAAGAAAAACAAGCACTCAAGATAATCAAGACCCTATACGGCAGCAATCCATA
TCCACAGTTCAGCGGAACGGCCAGACAACGGAGGAGGGCAAGACAGAGGTGGAG
;
; LOCUS SIVAGMSAB
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by rkl on Mon Apr 19 10:38:05 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
SAB_SAB1C
ATGGACCAGGAGCAGGAGGCCCGCCCCCAGGTCTGGGAGGAGCTTCAGGAGGAGCTGCATCGGCCGCTCC
AGGCCTGTGATAATACTTGCTTCTGCAAAGTTTGCTGCTTTCATTGTATTCTCTGCTTCCATAAAAAGGC
CCTAGGCATTCGCTATTATGTCCCTAGGCCAAGAAGAGCTTCTAAGAAGATTTCGCATAATCAAGTTTCT
CTACACAAC
;
; LOCUS SIVSYK
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by rkl on Mon Apr 19 10:38:05 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Modified by kam on Mon Feb 5 11:31:14 1996
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
SYK_SYK
ATGTCCTCAACGGACCAGATATGCCAGACACAGAGGGTACCCCCATCCTTCTTAGAAGGAACATTCCTAG
AGAAAGGACCACCAACACCATGTAATAAATGCTTTTGCAAAAACTGTTGCTATCATTGCCAGCTTTGTTT
CCTTCAAAAGGGATTGGGAATCACTTATGCCAGACCAAGGAAGCGAGCAGCTCGCAGTATTTCTGAGGAT
GATAGCGCACCTACAGGAACCCTACCCAGGGCCGGAAGGACCCAGGCAAACCCGCAGACGAAGAAGAAGG
CAGTGGAGACAGAGAAGGACTCAACGTCTCTACCTTCAGCAGAGAATCTT