Permalink
Fetching contributors…
Cannot retrieve contributors at this time
302 lines (239 sloc) 12.7 KB
********************************************************************************
MAST - Motif Alignment and Search Tool
********************************************************************************
MAST version 3.0 (Release date: 2004/08/18 09:07:01)
For further information on how to interpret these results or to get
a copy of the MAST software please access http://meme.sdsc.edu.
********************************************************************************
********************************************************************************
REFERENCE
********************************************************************************
If you use this program in your research, please cite:
Timothy L. Bailey and Michael Gribskov,
"Combining evidence using p-values: application to sequence homology
searches", Bioinformatics, 14(48-54), 1998.
********************************************************************************
********************************************************************************
DATABASE AND MOTIFS
********************************************************************************
DATABASE INO_up800.s (nucleotide)
Last updated on Mon Aug 16 21:19:59 2004
Database contains 7 sequences, 5600 residues
Scores for positive and reverse complement strands are combined.
MOTIFS meme.INO_up800.oops.txt (nucleotide)
MOTIF WIDTH BEST POSSIBLE MATCH
----- ----- -------------------
1 12 TTCACATGCCGC
2 10 TCTGGCACAG
PAIRWISE MOTIF CORRELATIONS:
MOTIF 1
----- -----
2 0.32
No overly similar pairs (correlation > 0.60) found.
Random model letter frequencies (from non-redundant database):
A 0.281 C 0.222 G 0.229 T 0.267
********************************************************************************
********************************************************************************
SECTION I: HIGH-SCORING SEQUENCES
********************************************************************************
- Each of the following 7 sequences has E-value less than 10.
- The E-value of a sequence is the expected number of sequences
in a random database of the same size that would match the motifs as
well as the sequence does and is equal to the combined p-value of the
sequence times the number of sequences in the database.
- The combined p-value of a sequence measures the strength of the
match of the sequence to all the motifs and is calculated by
o finding the score of the single best match of each motif
to the sequence (best matches may overlap),
o calculating the sequence p-value of each score,
o forming the product of the p-values,
o taking the p-value of the product.
- The sequence p-value of a score is defined as the
probability of a random sequence of the same length containing
some match with as good or better a score.
- The score for the match of a position in a sequence to a motif
is computed by by summing the appropriate entry from each column of
the position-dependent scoring matrix that represents the motif.
- Sequences shorter than one or more of the motifs are skipped.
- The table is sorted by increasing E-value.
********************************************************************************
SEQUENCE NAME DESCRIPTION E-VALUE LENGTH
------------- ----------- -------- ------
ACC1 sequence of the region up... 6.1e-05 800
CHO1 sequence of the region up... 0.00016 800
INO1 sequence of the region up... 0.00019 800
FAS1 sequence of the region up... 0.00022 800
OPI3 sequence of the region up... 0.00092 800
CHO2 sequence of the region up... 0.0029 800
FAS2 sequence of the region up... 0.0093 800
********************************************************************************
********************************************************************************
SECTION II: MOTIF DIAGRAMS
********************************************************************************
- The ordering and spacing of all non-overlapping motif occurrences
are shown for each high-scoring sequence listed in Section I.
- A motif occurrence is defined as a position in the sequence whose
match to the motif has POSITION p-value less than 0.0001.
- The POSITION p-value of a match is the probability of
a single random subsequence of the length of the motif
scoring at least as well as the observed match.
- For each sequence, all motif occurrences are shown unless there
are overlaps. In that case, a motif occurrence is shown only if its
p-value is less than the product of the p-values of the other
(lower-numbered) motif occurrences that it overlaps.
- The table also shows the E-value of each sequence.
- Spacers and motif occurences are indicated by
o -d- `d' residues separate the end of the preceding motif
occurrence and the start of the following motif occurrence
o [sn] occurrence of motif `n' with p-value less than 0.0001.
A minus sign indicates that the occurrence is on the
reverse complement strand.
********************************************************************************
SEQUENCE NAME E-VALUE MOTIF DIAGRAM
------------- -------- -------------
ACC1 6.1e-05 82_[+1]_137_[+2]_559
CHO1 0.00016 152_[+2]_396_[-2]_42_[+1]_17_
[+1]_149
INO1 0.00019 282_[-2]_327_[-1]_55_[+1]_102
FAS1 0.00022 43_[+2]_41_[+1]_694
OPI3 0.00092 185_[-2]_144_[+1]_449
CHO2 0.0029 353_[+1]_47_[-2]_378
FAS2 0.0093 184_[-2]_372_[+1]_222
********************************************************************************
********************************************************************************
SECTION III: ANNOTATED SEQUENCES
********************************************************************************
- The positions and p-values of the non-overlapping motif occurrences
are shown above the actual sequence for each of the high-scoring
sequences from Section I.
- A motif occurrence is defined as a position in the sequence whose
match to the motif has POSITION p-value less than 0.0001 as
defined in Section II.
- For each sequence, the first line specifies the name of the sequence.
- The second (and possibly more) lines give a description of the
sequence.
- Following the description line(s) is a line giving the length,
combined p-value, and E-value of the sequence as defined in Section I.
- The next line reproduces the motif diagram from Section II.
- The entire sequence is printed on the following lines.
- Motif occurrences are indicated directly above their positions in the
sequence on lines showing
o the motif number of the occurrence (a minus sign indicates that
the occurrence is on the reverse complement strand),
o the position p-value of the occurrence,
o the best possible match to the motif (or its reverse complement), and
o columns whose match to the motif has a positive score (indicated
by a plus sign).
********************************************************************************
ACC1
sequence of the region upstream from YNR016C
LENGTH = 800 COMBINED P-VALUE = 8.78e-06 E-VALUE = 6.1e-05
DIAGRAM: 82_[+1]_137_[+2]_559
[+1]
3.1e-07
TTCACATGCCGC
++++++++++ +
76 TAAAATCTTCACATGGCCCGGCCGCGCGCGCGTTGTGCCAACAAGTCGCAGTCGAAATTCAACCGCTCATTGCCA
[+2]
7.4e-07
TCTGGCACAG
++++++++++
226 TCGTATTCTGGCACAGTATAGCCTAGCACAATCACTGTCACAATTGTTATCGGTTCTACAATTGTTCTGCTCTCT
CHO1
sequence of the region upstream from YER026C
LENGTH = 800 COMBINED P-VALUE = 2.30e-05 E-VALUE = 0.00016
DIAGRAM: 152_[+2]_396_[-2]_42_[+1]_17_[+1]_149
[+2]
3.9e-05
TCTGGCACAG
++++++ +
151 CGTCTGGCGCCCTTCCCATTCCGAACCATGTTATATTGAACCATCTGGCGACAAGCAGTATTAAGCATAATACAT
[-2]
7.4e-07
CTGTGCCAGA
++++++++++
526 CAATCCCCACTCCTTCTCAATGTGTGCAGACTTCTGTGCCAGACACTGAATATATATCAGTAATTGGTCAAAATC
[+1] [+1]
8.7e-07 2.2e-05
TTCACATGCCGC TTCACATGCCGC
++++++ +++ + +++++++++ +
601 ACTTTGAACGTTCACACGGCACCCTCACGCCTTTGAGCTTTCACATGGACCCATCTAAAGATGAAGATCCGTATT
INO1
sequence of the region upstream from YJL153C
LENGTH = 800 COMBINED P-VALUE = 2.71e-05 E-VALUE = 0.00019
DIAGRAM: 282_[-2]_327_[-1]_55_[+1]_102
[-2]
1.8e-05
CTGTGCCAGA
+++ +++ ++
226 ACGTTGTATATGAAACGAGTAGTGAACGTTCGTACGATCTTTCACGCAGACATGCGACTGCGCCCGCCGTAGACC
[-1]
4.2e-08
GCGGCATGTGAA
++++++++++++
601 TGCGCTTCGGCGGCTAAATGCGGCATGTGAAAAGTATTGTCTATTTTATCTTCATCCTTCTTTCCCAGAATATTG
[+1]
1.3e-05
TTCACATGCCGC
+++++++++ ++
676 AACTTATTTAATTCACATGGAGCAGAGAAAGCGCACCTCTGCGTTGGCGGCAATGTTAATTTGAGACGTATATAA
FAS1
sequence of the region upstream from YKL182W
LENGTH = 800 COMBINED P-VALUE = 3.19e-05 E-VALUE = 0.00022
DIAGRAM: 43_[+2]_41_[+1]_694
[+2]
2.2e-05
TCTGGCACAG
++ +++++ +
1 CCGGGTTATAGCAGCGTCTGCTCCGCATCACGATACACGAGGTGCAGGCACGGTTCACTACTCCCCTGGCCTCCA
[+1]
4.2e-08
TTCACATGCCGC
++++++++++++
76 ACAAACGACGGCCAAAAACTTCACATGCCGCCCAGCCAAGCATAATTACGCAACAGCGATCTTTCCGTCGCACAA
OPI3
sequence of the region upstream from YJR073C
LENGTH = 800 COMBINED P-VALUE = 1.32e-04 E-VALUE = 0.00092
DIAGRAM: 185_[-2]_144_[+1]_449
[-2]
7.4e-07
CTGTGCCAGA
++++++++++
151 GTTAATCTGATCAACGCTACGCCGATGACAACGGTCTGTGCCAGATCTGGTTTTCCCCACTTATTTGCTACTTCC
[+1]
5.8e-06
TTCACATGCCGC
++++ ++ ++ +
301 AACTCCGTCAGGTCTTCCACGTGGAACTGCCAAGCCTCCTTCAGATCGCTCTTGTCGACCGTCTCCAAGAGATCC
CHO2
sequence of the region upstream from YGR157W
LENGTH = 800 COMBINED P-VALUE = 4.18e-04 E-VALUE = 0.0029
DIAGRAM: 353_[+1]_47_[-2]_378
[+1]
5.2e-07
TTCACATGCCGC
+++ ++++++++
301 ATATATATTTTTGCCTTGGTTTAAATTGGTCAAGACAGTCAATTGCCACACTTTTCTCATGCCGCATTCATTATT
[-2]
2.9e-05
CTGTGCCAGA
+ +++++++
376 CGCGAAGTTTTCCACACAAAACTGTGAAAATGAACGGCGATGCCAGAAACGGCAAAACCTCAAATGTTAGATAAC
FAS2
sequence of the region upstream from YPL231W
LENGTH = 800 COMBINED P-VALUE = 1.33e-03 E-VALUE = 0.0093
DIAGRAM: 184_[-2]_372_[+1]_222
[-2]
2.9e-05
CTGTGCCAGA
++++++++
151 AACAGGGTGTCGGTCATACCGATAAAGCCGTCAAGAGTGCCAGAAAAGCAAGAAAGAACAAGATTAGATGTTGGT
[+1]
1.9e-06
TTCACATGCCGC
+++++++++ +
526 GCTTAGCAAAATCCAACCATTTTTTTTTTATCTCCCGCGTTTTCACATGCTACCTCATTCGCCTCGTAACGTTAC
********************************************************************************
CPU: pmgm2
Time 0.030000 secs.
mast meme.INO_up800.oops.txt -text -stdout