Skip to content
This repository
Fetching contributors…

Octocat-spinner-32-eaf2f5

Cannot retrieve contributors at this time

file 248 lines (215 sloc) 10.315 kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247
#!/usr/bin/env python
# Copyright 2001 by Brad Chapman. All rights reserved.
# Revisions copyright 2008-2009 by Michiel de Hoon. All rights reserved.
# Revisions copyright 2010-2011 by Peter Cock. All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.

"""Tests for Primer-based programs in the Emboss suite.
"""
# standard library
import os
import unittest

# local stuff
from Bio.Emboss import PrimerSearch, Primer3


class Primer3ParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.primer3"),
           os.path.join("Emboss", "cds_forward.primer3"),
           os.path.join("Emboss", "cds_reverse.primer3"),
           os.path.join("Emboss", "short.primer3"),
           os.path.join("Emboss", "internal_oligo.primer3"),
           os.path.join("Emboss", "no_oligo.primer3"),
           ]

    def test_simple_parse(self):
        """Make sure that we can use all single target primer3 files.
"""
        for file in self.test_files:
            # First using read...
            h = open(file, "r")
            Primer3.read(h)
            h.close()
            # Now using parse...
            h = open(file, "r")
            self.assertEqual(1, len(list(Primer3.parse(h))))
            h.close()

    def test_indepth_regular_parse(self):
        """Make sure we get the data from normal primer3 files okay.
"""
        regular_file = self.test_files[0]
        h = open(regular_file, "r")
        primer_info = Primer3.read(h)
        h.close()

        self.assertEqual(len(primer_info.primers), 5)
        self.assertEqual(primer_info.comments,
                         "# PRIMER3 RESULTS FOR AC074298\n")
        self.assertEqual(primer_info.primers[1].forward_seq,
                         "CCGGTTTCTCTGGTTGAAAA")
        self.assertEqual(primer_info.primers[2].reverse_seq,
                         "TCACATTCCCAAATGTAGATCG")
        self.assertEqual(primer_info.primers[0].size, 218)
        self.assertEqual(len(primer_info.primers[0]), 218)
        self.assertEqual(primer_info.primers[3].forward_start, 112)
        self.assertEqual(primer_info.primers[3].forward_length, 20)
        self.assertEqual(primer_info.primers[3].forward_tm, 59.57)
        self.assertEqual(primer_info.primers[3].forward_gc, 45.00)
        self.assertEqual(primer_info.primers[4].reverse_start, 304)
        self.assertEqual(primer_info.primers[4].reverse_length, 22)
        self.assertEqual(primer_info.primers[4].reverse_tm, 59.61)
        self.assertEqual(primer_info.primers[4].reverse_gc, 40.91)

    def test_in_depth_single_parse(self):
        """Make sure we get info right from a single primer find.
"""
        file = self.test_files[1]
        h = open(file, "r")
        primer_info = Primer3.read(h)
        h.close()

        self.assertEqual(len(primer_info.primers), 5)
        self.assertEqual(primer_info.comments,
                         "# PRIMER3 RESULTS FOR 26964-28647#\n")
        self.assertEqual(primer_info.primers[1].reverse_seq, "")
        self.assertEqual(primer_info.primers[1].internal_seq, "")
        self.assertEqual(primer_info.primers[3].forward_seq, "TGTGATTGCTTGAGCTGGAC")
        self.assertEqual(primer_info.primers[3].internal_seq, "")
        self.assertEqual(primer_info.primers[3].forward_start, 253)

    def test_internal_oligo_single_parse(self):
        ''' Make sure we can parse an internal oligo file correctly '''
        # these files are generated when designing hybridization probes.
        file = self.test_files[4]
        h = open(file, "r")
        primer_info = Primer3.read(h)
        h.close()

        self.assertEqual(len(primer_info.primers), 5)
        self.assertEqual(primer_info.comments,
                         "# EPRIMER3 RESULTS FOR YNL138W-A\n")
        self.assertEqual(primer_info.primers[0].internal_length, 22)
        self.assertEqual(primer_info.primers[1].internal_seq,
                         'TTGCGCTTTAGTTTGAATTGAA')
        self.assertEqual(primer_info.primers[2].internal_tm, 58.62)
        self.assertEqual(primer_info.primers[3].internal_start, 16)
        self.assertEqual(primer_info.primers[4].internal_gc, 35.00)

    def test_mutli_record_fwd(self):
        """Test parsing multiple primer sets (NirK forward)"""
        h = open(os.path.join("Emboss", "NirK.primer3"))
        targets = list(Primer3.parse(h))
        h.close()

        self.assertEqual(len(targets), 16)
        for target in targets:
            self.assertEqual(len(target.primers), 5)

        self.assertEqual(targets[0].primers[0].forward_seq,
                         "GCAAACTGAAAAGCGGACTC")
        self.assertEqual(targets[0].primers[1].forward_seq,
                         "GGGACGTACTTTCGCACAAT")
        self.assertEqual(targets[0].primers[2].forward_seq,
                         "GTCTTATGCGTGGTGGAGGT")
        self.assertEqual(targets[0].primers[3].forward_seq,
                         "GTACATCAACATCCGCAACG")
        self.assertEqual(targets[0].primers[4].forward_seq,
                         "CGTACATCAACATCCGCAAC")

        self.assertEqual(targets[1].primers[0].forward_seq,
                         "GGAAGTGCTTCTCGTTTTCG")
        self.assertEqual(targets[1].primers[1].forward_seq,
                         "TACAGAGCGTCACGGATGAG")
        self.assertEqual(targets[1].primers[2].forward_seq,
                         "TTGTCATCGTGCTCTTCGTC")
        self.assertEqual(targets[1].primers[3].forward_seq,
                         "GACTCCAACCTCAGCTTTCG")
        self.assertEqual(targets[1].primers[4].forward_seq,
                         "GGCACGAAGAAGGACAGAAG")

        self.assertEqual(targets[15].primers[0].forward_seq,
                         "TGCTTGAAAATGACGCACTC")
        self.assertEqual(targets[15].primers[1].forward_seq,
                         "CTCGCTGGCTAGGTCATAGG")
        self.assertEqual(targets[15].primers[2].forward_seq,
                         "TATCGCACCAAACACGGTAA")
        self.assertEqual(targets[15].primers[3].forward_seq,
                         "CGATTACCCTCACCGTCACT")
        self.assertEqual(targets[15].primers[4].forward_seq,
                         "TATCGCAACCACTGAGCAAG")

    def test_mutli_record_full(self):
        """Test parsing multiple primer sets (NirK full)"""
        h = open(os.path.join("Emboss", "NirK_full.primer3"))
        targets = list(Primer3.parse(h))
        h.close()

        self.assertEqual(len(targets), 16)
        for target in targets:
            self.assertEqual(len(target.primers), 5)

        self.assertEqual(targets[15].primers[0].forward_seq,
                         "ACTCACTTCGGCTGAATGCT")
        self.assertEqual(targets[15].primers[1].forward_seq,
                         "GGCGATTAGCGCTGTCTATC")
        self.assertEqual(targets[15].primers[2].forward_seq,
                         "ACTCACTTCGGCTGAATGCT")
        self.assertEqual(targets[15].primers[3].forward_seq,
                         "TAGGCGTATAGACCGGGTTG")
        self.assertEqual(targets[15].primers[4].forward_seq,
                         "AGCAAGCTGACCACTGGTTT")

        self.assertEqual(targets[15].primers[0].reverse_seq,
                         "CATTTAATCCGGATGCCAAC")
        self.assertEqual(targets[15].primers[1].reverse_seq,
                         "TGGCCTTTCTCTCCTCTTCA")
        self.assertEqual(targets[15].primers[2].reverse_seq,
                         "ATTTAATCCGGATGCCAACA")
        self.assertEqual(targets[15].primers[3].reverse_seq,
                         "CACACATTATTGGCGGTCAC")
        self.assertEqual(targets[15].primers[4].reverse_seq,
                         "TCTGAAACCACCAAGGAAGC")

        self.assertEqual(targets[15].primers[0].internal_seq,
                         "CCCACCAATATTTGGCTAGC")
        self.assertEqual(targets[15].primers[1].internal_seq,
                         "AATCTTCTGTGCACCTTGCC")
        self.assertEqual(targets[15].primers[2].internal_seq,
                         "CCCACCAATATTTGGCTAGC")
        self.assertEqual(targets[15].primers[3].internal_seq,
                         "TGAGCCTGTGTTCCACACAT")
        self.assertEqual(targets[15].primers[4].internal_seq,
                         "CTATGCCCTTCTGCCACAAT")


class PrimersearchParseTest(unittest.TestCase):
    def setUp(self):
        self.test_files = \
          [os.path.join("Emboss", "bac_find.psearch")]

    def test_simple_parse(self):
        """Make sure that we can parse all primersearch files.
"""
        for file in self.test_files:
            h = open(file, "r")
            PrimerSearch.read(h)
            h.close()

    def test_in_depth_normal_parse(self):
        """Make sure the output from a simple primersearch file is correct.
"""
        file = self.test_files[0]
        h = open(file, "r")
        amp_info = PrimerSearch.read(h)
        h.close()

        self.assertEqual(len(amp_info.amplifiers), 1)
        self.assertTrue("Test" in amp_info.amplifiers)
        self.assertEqual(len(amp_info.amplifiers["Test"]), 1)

        self.assertEqual(amp_info.amplifiers["Test"][0].length, 218)
        self.assertEqual(amp_info.amplifiers["Test"][0].hit_info,
          "AC074298 AC074298 \n"
          "\tTelomere associated sequence for Arabidopsis thaliana "
          "TEL1N from chromosome I, complete sequence.\n"
          "\tCCGGTTTCTCTGGTTGAAAA hits forward strand at 114 with "
          "0 mismatches\n"
          "\tTCACATTCCCAAATGTAGATCG hits reverse strand at [114] with "
          "0 mismatches")


class PrimerSearchInputTest(unittest.TestCase):
    """Test creating input files for primersearch.
"""
    def setUp(self):
        pass

    def test_primer_representation(self):
        """Make sure we can output primer information correctly.
"""
        p_info = PrimerSearch.InputRecord()
        p_info.add_primer_set("Test", "GATC", "CATG")
        p_info.add_primer_set("Test2", "AATA", "TTAT")

        output = str(p_info)
        self.assertEqual(output,
                         "Test GATC CATG\n"
                         "Test2 AATA TTAT\n")

if __name__ == "__main__":
    runner = unittest.TextTestRunner(verbosity = 2)
    unittest.main(testRunner=runner)
Something went wrong with that request. Please try again.