Skip to content
This repository
Browse code

Updating the input files Tests/geo/soft_ex_*.txt; adding soft_ex_affy…

…_chp.txt.
  • Loading branch information...
commit 0846b5c281368b936e7963eb7dcb641246cfa513 1 parent ae8f325
authored January 21, 2008
276  Tests/Geo/soft_ex_affy.txt
... ...
@@ -1,124 +1,152 @@
1  
-^SAMPLE=body wall rep1
2  
-!Sample_title = body wall replicate 1
3  
-!Sample_source_name = body wall
4  
-!Sample_organism = Drosophila melanogaster	
5  
-!Sample_characteristics = Wild type, third instar larvae, body wall
6  
-!Sample_molecule = total RNA
7  
-!Sample_extract_protocol = Approximately 200 wild-type (Berlin strain) wandering third-instar larvae were dissected and the wing discs were collected in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presumptive hinge and the body wall regions using a 30-gauge syringe needle, and fragments were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted from the tissue lysate using an RNeasy kit (Qiagen).
8  
-!Sample_label = biotin
9  
-!Sample_label_protocol = Approximately 8 µg of total RNA was processed to produce biotinylated cRNA targets.
10  
-!Sample_hyb_protocol = standard Affymetrix procedures
11  
-!Sample_scan_protocol = standard Affymetrix procedures
12  
-!Sample_description = Wild type third instar larvae imaginal wing discs
13  
-!Sample_data_processing = Affymetrix Microarray Suite version 5.0
14  
-!Sample_platform_id = GPL72
15  
-#ID_REF = 
16  
-#VALUE = MAS5-calculated Signal intensity
17  
-#ABS_CALL = the call in an absolute analysis that indicates if the transcript was present (P), absent (A), marginal (M), or no call (NC)
18  
-#DETECTION P-VALUE = 'detection p-value', p-value that indicates the significance level of the detection call
19  
-!Sample_table_begin
20  
-ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE
21  
-141200_at	36.6	A	0.818657
22  
-141201_at	41.5	A	0.703191
23  
-141202_at	607.3	P	0.000944
24  
-141203_at	1509.1	P	0.000762
25  
-141204_at	837.3	P	0.000613
26  
-141205_at	363.2	P	0.003815
27  
-141206_at	1193.6	P	0.000491
28  
-141207_at	346.6	P	0.001165
29  
-141208_at	257.8	P	0.006575
30  
-141209_at	337.1	P	0.002607
31  
-141210_at	48	A	0.150145
32  
-141211_at	130.7	P	0.005504
33  
-141212_at	1454.3	P	0.000491
34  
-141213_at	21.2	A	0.635055
35  
-141214_at	2372.6	P	0.000491
36  
-141215_at	452.9	P	0.017732
37  
-141216_at	504.1	P	0.006575
38  
-141217_at	716.9	P	0.004591
39  
-141218_at	3248.8	P	0.000491
40  
-141219_at	223.5	P	0.007827
41  
-!Sample_table_end
42  
-^SAMPLE=body wall rep2
43  
-!Sample_title = body wall replicate 2
44  
-!Sample_source_name = body wall
45  
-!Sample_organism = Drosophila melanogaster
46  
-!Sample_characteristics = Wild type, third instar larvae, body wall
47  
-!Sample_molecule = total RNA
48  
-!Sample_extract_protocol = Approximately 200 wild-type (Berlin strain) wandering third-instar larvae were dissected and the wing discs were collected in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presumptive hinge and the body wall regions using a 30-gauge syringe needle, and fragments were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted from the tissue lysate using an RNeasy kit (Qiagen).
49  
-!Sample_label = biotin
50  
-!Sample_label_protocol = Approximately 8 µg of total RNA was processed to produce biotinylated cRNA targets.
51  
-!Sample_hyb_protocol = standard Affymetrix procedures
52  
-!Sample_scan_protocol = standard Affymetrix procedures
53  
-!Sample_description = Wild type third instar larvae imaginal wing discs
54  
-!Sample_data_processing = Affymetrix Microarray Suite version 5.0
55  
-!Sample_platform_id = GPL72
56  
-#ID_REF = 
57  
-#VALUE = MAS5-calculated Signal intensity
58  
-#ABS_CALL = the call in an absolute analysis that indicates if the transcript was present (P), absent (A), marginal (M), or no call (NC)
59  
-#DETECTION P-VALUE = 'detection p-value', p-value that indicates the significance level of the detection call
60  
-!Sample_table_begin
61  
-ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE
62  
-141200_at	70.3	A	0.216313
63  
-141201_at	38	A	0.635055
64  
-141202_at	831.8	P	0.000613
65  
-141203_at	2215.5	P	0.000944
66  
-141204_at	965.6	P	0.000491
67  
-141205_at	383.2	P	0.001432
68  
-141206_at	1195	P	0.000491
69  
-141207_at	413.7	P	0.000613
70  
-141208_at	447.3	P	0.000762
71  
-141209_at	294.4	P	0.004591
72  
-141210_at	81.7	M	0.054711
73  
-141211_at	84.9	P	0.005504
74  
-141212_at	1456.4	P	0.000491
75  
-141213_at	37	A	0.122747
76  
-141214_at	2022	P	0.000491
77  
-141215_at	690.9	P	0.004591
78  
-141216_at	525.1	P	0.000762
79  
-141217_at	643.5	P	0.000613
80  
-141218_at	2570.5	P	0.000491
81  
-141219_at	265.9	P	0.005504
82  
-!Sample_table_end
83  
-^SAMPLE=wing/hinge rep1
84  
-!Sample_title = wing/hinge replicate 1
85  
-!Sample_source_name = wing/hinge
86  
-!Sample_organism = Drosophila melanogaster
87  
-!Sample_characteristics = Wild type, third instar larvae, wing/hinge
88  
-!Sample_molecule = total RNA
89  
-!Sample_extract_protocol = Approximately 200 wild-type (Berlin strain) wandering third-instar larvae were dissected and the wing discs were collected in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presumptive hinge and the body wall regions using a 30-gauge syringe needle, and fragments were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted from the tissue lysate using an RNeasy kit (Qiagen).
90  
-!Sample_label = biotin
91  
-!Sample_label_protocol = Approximately 8 µg of total RNA was processed to produce biotinylated cRNA targets.
92  
-!Sample_hyb_protocol = standard Affymetrix procedures
93  
-!Sample_scan_protocol = standard Affymetrix procedures
94  
-!Sample_description = Wild type third instar larvae imaginal wing discs
95  
-!Sample_data_processing = Affymetrix Microarray Suite version 5.0
96  
-!Sample_platform_id = GPL72 
97  
-#ID_REF = 
98  
-#VALUE = MAS5-calculated Signal intensity
99  
-#ABS_CALL = the call in an absolute analysis that indicates if the transcript was present (P), absent (A), marginal (M), or no call (NC)
100  
-#DETECTION P-VALUE = 'detection p-value', p-value that indicates the significance level of the detection call
101  
-!Sample_table_begin
102  
-ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE
103  
-141200_at	20.8	A	0.801637
104  
-141201_at	85.8	A	0.48748
105  
-141202_at	704.8	P	0.000613
106  
-141203_at	1036.6	P	0.000944
107  
-141204_at	700.3	P	0.000491
108  
-141205_at	462.4	P	0.003159
109  
-141206_at	1301.9	P	0.000491
110  
-141207_at	454.8	P	0.000944
111  
-141208_at	438.6	P	0.000944
112  
-141209_at	264.4	P	0.004591
113  
-141210_at	65.6	A	0.150145
114  
-141211_at	72.2	A	0.070073
115  
-141212_at	1200	P	0.000491
116  
-141213_at	13.7	A	0.635055
117  
-141214_at	1944	P	0.000491
118  
-141215_at	465.5	P	0.005504
119  
-141216_at	538.9	P	0.002607
120  
-141217_at	753.9	P	0.003159
121  
-141218_at	2942.6	P	0.000491
122  
-141219_at	283.9	P	0.010972
123  
-!Sample_table_end
124  
-
  1
+^SAMPLE = Drosophila_T0-1		
  2
+!Sample_title = embryo at T0, biological rep1
  3
+!Sample_supplementary_file = Drosophila_T0-1.CEL		
  4
+!Sample_source_name_ch1 = Drosophila embryos before nuclear cycle 9 (maternal transcripts)		
  5
+!Sample_organism_ch1 = Drosophila melanogaster		
  6
+!Sample_characteristics_ch1 = Genotype: yellow white and Oregon R parents		
  7
+!Sample_characteristics_ch1 = Age: embryos younger than nuclear cycle 9, i.e. before pole cells budding		
  8
+!Sample_treatment_protocol_ch1 = Embryos were dechorionated with 50% bleach, put on a cover slip and covered with Halocarbon oil 27 (Sigma). Embryos of the appropriate stage were manually selected under the dissecting scope. Selected embryos were transferred to a basket, rinsed with PBS with 0,7% NaCl, 0,04% triton-X100 and placed on ice in the Trizol solution (GibcoBRL).		
  9
+!Sample_growth_protocol_ch1 = 30 min egg collections of OreR and yw flies at 25C were aged at room temperature (RT) according to the different temporal classes T0-T4. 		
  10
+!Sample_molecule_ch1 = total RNA		
  11
+!Sample_extract_protocol_ch1 = Trizol extraction of total RNA was performed according to the manufacturer's instructions.		
  12
+!Sample_label_ch1 = biotin		
  13
+!Sample_label_protocol_ch1 = Biotinylated cRNA were prepared according to the standard Affymetrix protocol from 6 microg total RNA (Expression Analysis Technical Manual, 2001, Affymetrix).		
  14
+!Sample_hyb_protocol = Following fragmentation, 10 microg of cRNA were hybridized for 16 hr at 45C on GeneChip Drosophila Genome Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 400.  		
  15
+!Sample_scan_protocol = GeneChips were scanned using the Hewlett-Packard GeneArray Scanner G2500A. 		
  16
+!Sample_description = Gene expression data from embryos younger than nuclear cycle 9, i.e. before zygotic genome activation.		
  17
+!Sample_data_processing = The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.		
  18
+!Sample_platform_id = GPL72		
  19
+#ID_REF = 		
  20
+#VALUE = MAS5-calculated Signal intensity		
  21
+#ABS_CALL = the call in an absolute analysis that indicates if the transcript was present (P), absent (A), marginal (M), or no call (NC)		
  22
+#DETECTION P-VALUE = 'detection p-value', p-value that indicates the significance level of the detection call		
  23
+!Sample_table_begin		
  24
+ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE
  25
+141200_at	36.6	A	0.818657
  26
+141201_at	41.5	A	0.703191
  27
+141202_at	607.3	P	0.000944
  28
+141203_at	1509.1	P	0.000762
  29
+141204_at	837.3	P	0.000613
  30
+141205_at	363.2	P	0.003815
  31
+141206_at	1193.6	P	0.000491
  32
+141207_at	346.6	P	0.001165
  33
+141208_at	257.8	P	0.006575
  34
+141209_at	337.1	P	0.002607
  35
+141210_at	48	A	0.150145
  36
+141211_at	130.7	P	0.005504
  37
+141212_at	1454.3	P	0.000491
  38
+141213_at	21.2	A	0.635055
  39
+142121_at	133.7	A	0.889551
  40
+142122_at	275.3	A	0.611218
  41
+142123_at	307.6	A	0.611218
  42
+142124_at	132.6	A	0.437646
  43
+142125_at	195.8	A	0.110449
  44
+142126_at	174.1	A	0.681117
  45
+142127_at	316.3	A	0.65838
  46
+!Sample_table_end		
  47
+^SAMPLE = Drosophila_T0-2		
  48
+!Sample_title = embryo at T0, biological rep2
  49
+!Sample_supplementary_file = Drosophila_T0-2.CEL		
  50
+!Sample_source_name_ch1 = Drosophila embryos before nuclear cycle 9 (maternal transcripts)		
  51
+!Sample_organism_ch1 = Drosophila melanogaster		
  52
+!Sample_characteristics_ch1 = Genotype: yellow white and Oregon R parents		
  53
+!Sample_characteristics_ch1 = Age: embryos younger than nuclear cycle 9, i.e. before pole cells budding		
  54
+!Sample_treatment_protocol_ch1 = Embryos were dechorionated with 50% bleach, put on a cover slip and covered with Halocarbon oil 27 (Sigma). Embryos of the appropriate stage were manually selected under the dissecting scope. Selected embryos were transferred to a basket, rinsed with PBS with 0,7% NaCl, 0,04% triton-X100 and placed on ice in the Trizol solution (GibcoBRL).		
  55
+!Sample_growth_protocol_ch1 = 30 min egg collections of OreR and yw flies at 25C were aged at room temperature (RT) according to the different temporal classes T0-T4. 		
  56
+!Sample_molecule_ch1 = total RNA		
  57
+!Sample_extract_protocol_ch1 = Trizol extraction of total RNA was performed according to the manufacturer's instructions.		
  58
+!Sample_label_ch1 = biotin		
  59
+!Sample_label_protocol_ch1 = Biotinylated cRNA were prepared according to the standard Affymetrix protocol from 6 microg total RNA (Expression Analysis Technical Manual, 2001, Affymetrix).		
  60
+!Sample_hyb_protocol = Following fragmentation, 10 microg of cRNA were hybridized for 16 hr at 45C on GeneChip Drosophila Genome Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 400.  		
  61
+!Sample_scan_protocol = GeneChips were scanned using the Hewlett-Packard GeneArray Scanner G2500A. 		
  62
+!Sample_description = Gene expression data from embryos younger than nuclear cycle 9, i.e. before zygotic genome activation.		
  63
+!Sample_data_processing = The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.		
  64
+!Sample_platform_id = GPL72		
  65
+#ID_REF = 		
  66
+#VALUE = MAS5-calculated Signal intensity		
  67
+#ABS_CALL = the call in an absolute analysis that indicates if the transcript was present (P), absent (A), marginal (M), or no call (NC)		
  68
+#DETECTION P-VALUE = 'detection p-value', p-value that indicates the significance level of the detection call		
  69
+!Sample_table_begin		
  70
+ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE
  71
+141200_at	70.3	A	0.216313
  72
+141201_at	38	A	0.635055
  73
+141202_at	831.8	P	0.000613
  74
+141203_at	2215.5	P	0.000944
  75
+141204_at	965.6	P	0.000491
  76
+141205_at	383.2	P	0.001432
  77
+141206_at	1195	P	0.000491
  78
+141207_at	413.7	P	0.000613
  79
+141208_at	447.3	P	0.000762
  80
+141209_at	294.4	P	0.004591
  81
+141210_at	81.7	M	0.054711
  82
+141211_at	84.9	P	0.005504
  83
+141212_at	1456.4	P	0.000491
  84
+141213_at	37	A	0.122747
  85
+142121_at	133.7	A	0.889551
  86
+142122_at	275.3	A	0.611218
  87
+142123_at	307.6	A	0.611218
  88
+142124_at	132.6	A	0.437646
  89
+142125_at	195.8	A	0.110449
  90
+142126_at	174.1	A	0.681117
  91
+142127_at	316.3	A	0.65838
  92
+!Sample_table_end		
  93
+^SAMPLE = Drosophila_T1-1
  94
+!Sample_supplementary_file = Drosophila_T1-1.CEL	
  95
+!Sample_title = embryo at T1, biological rep1		
  96
+!Sample_source_name_ch1 = Drosophila embryos in slow phase of cellularisation		
  97
+!Sample_organism_ch1 = Drosophila melanogaster		
  98
+!Sample_characteristics_ch1 = Genotype: yellow white and Oregon R parents		
  99
+!Sample_characteristics_ch1 = Age: embryos in slow phase of cellularisation		
  100
+!Sample_treatment_protocol_ch1 = Embryos were dechorionated with 50% bleach, put on a cover slip and covered with Halocarbon oil 27 (Sigma). Embryos of the appropriate stage were manually selected under the dissecting scope. Selected embryos were transferred to a basket, rinsed with PBS with 0,7% NaCl, 0,04% triton-X100 and placed on ice in the Trizol solution (GibcoBRL).		
  101
+!Sample_growth_protocol_ch1 = 30 min egg collections of OreR and yw flies at 25C were aged at room temperature (RT) according to the different temporal classes T0-T4. 		
  102
+!Sample_molecule_ch1 = total RNA		
  103
+!Sample_extract_protocol_ch1 = Trizol extraction of total RNA was performed according to the manufacturer's instructions.		
  104
+!Sample_label_ch1 = biotin		
  105
+!Sample_label_protocol_ch1 = Biotinylated cRNA were prepared according to the standard Affymetrix protocol from 6 microg total RNA (Expression Analysis Technical Manual, 2001, Affymetrix).		
  106
+!Sample_hyb_protocol = Following fragmentation, 10 microg of cRNA were hybridized for 16 hr at 45C on GeneChip Drosophila Genome Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 400.  		
  107
+!Sample_scan_protocol = GeneChips were scanned using the Hewlett-Packard GeneArray Scanner G2500A. 		
  108
+!Sample_description = Gene expression data from embryos in slow phase of cellularisation.		
  109
+!Sample_data_processing = The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.		
  110
+!Sample_platform_id = GPL72		
  111
+#ID_REF = 		
  112
+#VALUE = MAS5-calculated Signal intensity		
  113
+#ABS_CALL = the call in an absolute analysis that indicates if the transcript was present (P), absent (A), marginal (M), or no call (NC)		
  114
+#DETECTION P-VALUE = 'detection p-value', p-value that indicates the significance level of the detection call		
  115
+!Sample_table_begin		
  116
+ID_REF	VALUE	ABS_CALL	DETECTION P-VALUE
  117
+141200_at	20.8	A	0.801637
  118
+141201_at	85.8	A	0.48748
  119
+141202_at	704.8	P	0.000613
  120
+141203_at	1036.6	P	0.000944
  121
+141204_at	700.3	P	0.000491
  122
+141205_at	462.4	P	0.003159
  123
+141206_at	1301.9	P	0.000491
  124
+141207_at	454.8	P	0.000944
  125
+141208_at	438.6	P	0.000944
  126
+141209_at	264.4	P	0.004591
  127
+141210_at	65.6	A	0.150145
  128
+141211_at	72.2	A	0.070073
  129
+141212_at	1200	P	0.000491
  130
+141213_at	13.7	A	0.635055
  131
+142121_at	133.7	A	0.889551
  132
+142122_at	275.3	A	0.611218
  133
+142123_at	307.6	A	0.611218
  134
+142124_at	132.6	A	0.437646
  135
+142125_at	195.8	A	0.110449
  136
+142126_at	174.1	A	0.681117
  137
+142127_at	316.3	A	0.65838
  138
+!Sample_table_end		
  139
+^SERIES = Dros_embryo_timecourse
  140
+!Series_title = Expression data from early Drosophila embryo 
  141
+!Series_summary = Morphogenesis of epithelial tissues relies on the precise developmental control of cell polarity and architecture. In the early Drosophila embryo, the primary epithelium forms during cellularisation, following a tightly controlled genetic programme where specific sets of genes are up-regulated. Some of them, for instance, control membrane invagination between the nuclei anchored at the apical surface of the syncytium. 
  142
+!Series_summary = We used microarrays to detail the global programme of gene expression underlying cellularisation and identified distinct classes of up-regulated genes during this process. 
  143
+!Series_overall_design = Drosophila embryos were selected at successive stages of early development for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain homogeneous populations of embryos at each developmental stage in order to increase the temporal resolution of expression profiles. To that end, we hand-selected embryos according to morphological criteria at five time-points: before pole cell formation, i.e. before zygotic transcription (T0), during the slow phase (T1) and the fast phase (T2) of cellularisation and at the beginning (T3) and the end (T4) of gastrulation. 
  144
+!Series_type = time course
  145
+!Series_contributor = Jane,Doe
  146
+!Series_contributor = John,A,Smith
  147
+!Series_contributor = Hans,van Elton
  148
+!Series_contributor = John,Smithers Jr
  149
+!Series_contributor = Jie,D,Chen
  150
+!Series_sample_id = Drosophila_T0-1
  151
+!Series_sample_id = Drosophila_T0-2
  152
+!Series_sample_id = Drosophila_T1-1
68  Tests/Geo/soft_ex_affy_chp.txt
... ...
@@ -0,0 +1,68 @@
  1
+^SAMPLE = Drosophila_T0-1		
  2
+!Sample_title = embryo at T0, biological rep1
  3
+!Sample_supplementary_file = Drosophila_T0-1.CEL
  4
+!Sample_table=Drosophila_T0-1.CHP		
  5
+!Sample_source_name_ch1 = Drosophila embryos before nuclear cycle 9 (maternal transcripts)		
  6
+!Sample_organism_ch1 = Drosophila melanogaster		
  7
+!Sample_characteristics_ch1 = Genotype: yellow white and Oregon R parents		
  8
+!Sample_characteristics_ch1 = Age: embryos younger than nuclear cycle 9, i.e. before pole cells budding		
  9
+!Sample_treatment_protocol_ch1 = Embryos were dechorionated with 50% bleach, put on a cover slip and covered with Halocarbon oil 27 (Sigma). Embryos of the appropriate stage were manually selected under the dissecting scope. Selected embryos were transferred to a basket, rinsed with PBS with 0,7% NaCl, 0,04% triton-X100 and placed on ice in the Trizol solution (GibcoBRL).		
  10
+!Sample_growth_protocol_ch1 = 30 min egg collections of OreR and yw flies at 25C were aged at room temperature (RT) according to the different temporal classes T0-T4. 		
  11
+!Sample_molecule_ch1 = total RNA		
  12
+!Sample_extract_protocol_ch1 = Trizol extraction of total RNA was performed according to the manufacturer's instructions.		
  13
+!Sample_label_ch1 = biotin		
  14
+!Sample_label_protocol_ch1 = Biotinylated cRNA were prepared according to the standard Affymetrix protocol from 6 microg total RNA (Expression Analysis Technical Manual, 2001, Affymetrix).		
  15
+!Sample_hyb_protocol = Following fragmentation, 10 microg of cRNA were hybridized for 16 hr at 45C on GeneChip Drosophila Genome Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 400.  		
  16
+!Sample_scan_protocol = GeneChips were scanned using the Hewlett-Packard GeneArray Scanner G2500A. 		
  17
+!Sample_description = Gene expression data from embryos younger than nuclear cycle 9, i.e. before zygotic genome activation.		
  18
+!Sample_data_processing = The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.				
  19
+^SAMPLE = Drosophila_T0-2		
  20
+!Sample_title = embryo at T0, biological rep2
  21
+!Sample_supplementary_file = Drosophila_T0-2.CEL
  22
+!Sample_table=Drosophila_T0-2.CHP
  23
+!Sample_source_name_ch1 = Drosophila embryos before nuclear cycle 9 (maternal transcripts)		
  24
+!Sample_organism_ch1 = Drosophila melanogaster		
  25
+!Sample_characteristics_ch1 = Genotype: yellow white and Oregon R parents		
  26
+!Sample_characteristics_ch1 = Age: embryos younger than nuclear cycle 9, i.e. before pole cells budding		
  27
+!Sample_treatment_protocol_ch1 = Embryos were dechorionated with 50% bleach, put on a cover slip and covered with Halocarbon oil 27 (Sigma). Embryos of the appropriate stage were manually selected under the dissecting scope. Selected embryos were transferred to a basket, rinsed with PBS with 0,7% NaCl, 0,04% triton-X100 and placed on ice in the Trizol solution (GibcoBRL).		
  28
+!Sample_growth_protocol_ch1 = 30 min egg collections of OreR and yw flies at 25C were aged at room temperature (RT) according to the different temporal classes T0-T4. 		
  29
+!Sample_molecule_ch1 = total RNA		
  30
+!Sample_extract_protocol_ch1 = Trizol extraction of total RNA was performed according to the manufacturer's instructions.		
  31
+!Sample_label_ch1 = biotin		
  32
+!Sample_label_protocol_ch1 = Biotinylated cRNA were prepared according to the standard Affymetrix protocol from 6 microg total RNA (Expression Analysis Technical Manual, 2001, Affymetrix).		
  33
+!Sample_hyb_protocol = Following fragmentation, 10 microg of cRNA were hybridized for 16 hr at 45C on GeneChip Drosophila Genome Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 400.  		
  34
+!Sample_scan_protocol = GeneChips were scanned using the Hewlett-Packard GeneArray Scanner G2500A. 		
  35
+!Sample_description = Gene expression data from embryos younger than nuclear cycle 9, i.e. before zygotic genome activation.		
  36
+!Sample_data_processing = The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.
  37
+^SAMPLE = Drosophila_T1-1
  38
+!Sample_supplementary_file = Drosophila_T1-1.CEL
  39
+!Sample_table=Drosophila_T1-1.CHP
  40
+!Sample_title = embryo at T1, biological rep1		
  41
+!Sample_source_name_ch1 = Drosophila embryos in slow phase of cellularisation		
  42
+!Sample_organism_ch1 = Drosophila melanogaster		
  43
+!Sample_characteristics_ch1 = Genotype: yellow white and Oregon R parents		
  44
+!Sample_characteristics_ch1 = Age: embryos in slow phase of cellularisation		
  45
+!Sample_treatment_protocol_ch1 = Embryos were dechorionated with 50% bleach, put on a cover slip and covered with Halocarbon oil 27 (Sigma). Embryos of the appropriate stage were manually selected under the dissecting scope. Selected embryos were transferred to a basket, rinsed with PBS with 0,7% NaCl, 0,04% triton-X100 and placed on ice in the Trizol solution (GibcoBRL).		
  46
+!Sample_growth_protocol_ch1 = 30 min egg collections of OreR and yw flies at 25C were aged at room temperature (RT) according to the different temporal classes T0-T4. 		
  47
+!Sample_molecule_ch1 = total RNA		
  48
+!Sample_extract_protocol_ch1 = Trizol extraction of total RNA was performed according to the manufacturer's instructions.		
  49
+!Sample_label_ch1 = biotin		
  50
+!Sample_label_protocol_ch1 = Biotinylated cRNA were prepared according to the standard Affymetrix protocol from 6 microg total RNA (Expression Analysis Technical Manual, 2001, Affymetrix).		
  51
+!Sample_hyb_protocol = Following fragmentation, 10 microg of cRNA were hybridized for 16 hr at 45C on GeneChip Drosophila Genome Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 400.  		
  52
+!Sample_scan_protocol = GeneChips were scanned using the Hewlett-Packard GeneArray Scanner G2500A. 		
  53
+!Sample_description = Gene expression data from embryos in slow phase of cellularisation.		
  54
+!Sample_data_processing = The data were analyzed with Microarray Suite version 5.0 (MAS 5.0) using Affymetrix default analysis settings and global scaling as normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100.				
  55
+^SERIES = Dros_embryo_timecourse
  56
+!Series_title = Expression data from early Drosophila embryo 
  57
+!Series_summary = Morphogenesis of epithelial tissues relies on the precise developmental control of cell polarity and architecture. In the early Drosophila embryo, the primary epithelium forms during cellularisation, following a tightly controlled genetic programme where specific sets of genes are up-regulated. Some of them, for instance, control membrane invagination between the nuclei anchored at the apical surface of the syncytium. 
  58
+!Series_summary = We used microarrays to detail the global programme of gene expression underlying cellularisation and identified distinct classes of up-regulated genes during this process. 
  59
+!Series_overall_design = Drosophila embryos were selected at successive stages of early development for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain homogeneous populations of embryos at each developmental stage in order to increase the temporal resolution of expression profiles. To that end, we hand-selected embryos according to morphological criteria at five time-points: before pole cell formation, i.e. before zygotic transcription (T0), during the slow phase (T1) and the fast phase (T2) of cellularisation and at the beginning (T3) and the end (T4) of gastrulation. 
  60
+!Series_type = time course
  61
+!Series_contributor = Jane,Doe
  62
+!Series_contributor = John,A,Smith
  63
+!Series_contributor = Hans,van Elton
  64
+!Series_contributor = John,Smithers Jr
  65
+!Series_contributor = Jie,D,Chen
  66
+!Series_sample_id = Drosophila_T0-1
  67
+!Series_sample_id = Drosophila_T0-2
  68
+!Series_sample_id = Drosophila_T1-1
379  Tests/Geo/soft_ex_dual.txt
... ...
@@ -1,204 +1,175 @@
1  
-^SAMPLE=HS-5 cells rep 1
2  
-!Sample_title = Human bone marrow stromal cells, HS-5 cells, replicate 1
3  
-!Sample_source_name_ch1 = Human bone marrow stromal cells, HS-5 cells
4  
-!Sample_organism_ch1 = Homo sapiens
5  
-!Sample_characteristics_ch1 = Human bone marrow stromal cells, HS-5
6  
-!Sample_growth_protocol_ch1 = HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization followed by pelleting of the cells.
7  
-!Sample_molecule_ch1 = total RNA
8  
-!Sample_extract_protocol_ch1 = RNA isolation was accomplished with Qiagen RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
9  
-!Sample_label_ch1 = Cy5
10  
-!Sample_label_protocol_ch1 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
11  
-!Sample_source_name_ch2 = Universal human reference RNA
12  
-!Sample_organism_ch2 = Homo sapiens
13  
-!Sample_characteristics_ch2 = As a control RNA, Human Universal RNA (Stratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines approximating the expression profile of the majority of human genes was used.
14  
-!Sample_molecule_ch2 = total RNA
15  
-!Sample_extract_protocol_ch2 = The RNA (30 µg) was annealed with 5 µg oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
16  
-!Sample_label_ch2 = Cy3
17  
-!Sample_label_protocol_ch2 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
18  
-!Sample_scan_protocol = Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensity data were extracted and analyzed with GenePix Pro 3.0 analysis software.
19  
-!Sample_description = Human bone marrow stromal cells, HS-5 cells
20  
-!Sample_data_processing = After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear transformed to obtain the log and linear values given in the data table.
21  
-!Sample_platform_id = GPL1001
22  
-#ID_REF = 
23  
-#VALUE = Normalized log2 ratio of means defined as CH1 divided by CH2
24  
-#CH1_Median = Channel 1 median intensity
25  
-#CH1_Mean = Channel 1 mean intensity
26  
-#CH1_SD = Channel 1 mean standard deviation
27  
-#CH1_BKD_ Median = Channel 1 median background intensity
28  
-#CH1_BKD_ Mean = Channel 1 mean background intensity
29  
-#CH1_BKD_ SD = Channel 1 background standard deviation
30  
-#% > CH1_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of
31  
-#CH2_Median = Channel 2 median intensity
32  
-#CH2_Mean = Channel 2 mean intensity
33  
-#CH2_SD = Channel 2 mean standard deviation
34  
-#CH2_BKD_ Median = Channel 2 median background intensity
35  
-#CH2_BKD_ Mean = Channel 2 mean background intensity
36  
-#CH2_BKD_ SD = Channel 2 background standard deviation
37  
-#% > CH2_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of the background over the background signal
38  
-#Ratio of Means = Unnormalized, untransformed ratio of means
39  
-#AREA = Number of pixels used to calculate a feature's intensity
40  
-#BKD_AREA = Number of pixles used to calculate a feature's background
41  
-#CH1_Median - CH1_BKD_ = Channel 1 median signal
42  
-#CH2_Median - CH2_BKD_ = Channel 2 median signal
43  
-#CH1_Mean - CH1_BKD_ = Channel 1 mean signal
44  
-#CH2_Mean - CH2_BKD_ = Channel 2 mean signal
45  
-#Flags = 0 denotes satisfactory features, while <0 denotes features that did not meet
46  
-!Sample_table_begin
47  
-ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags
48  
-1	17.51	36	38	9	37	38	8	5	45	46	9	46	47	10	0	100000	80	500	-1	-1	1	0	-50
49  
-2	-0.10	42	47	19	37	39	11	12	64	65	15	45	47	10	43	0.5	32	176	5	19	10	20	-50
50  
-3	-0.42	44	48	18	36	38	8	37	75	75	17	45	46	10	71	0.4	32	176	8	30	12	30	-50
51  
-4	17.51	37	40	11	37	39	10	11	42	43	8	43	43	8	2	100000	80	498	0	-1	3	0	-50
52  
-5	0.95	147	193	125	37	39	8	98	157	194	109	43	44	9	98	1.033	52	398	110	114	156	151	0
53  
-6	0.79	57	62	21	37	39	9	55	69	71	14	44	45	8	76	0.926	52	329	20	25	25	27	-50
54  
-7	0.12	45	48	16	37	40	10	28	64	64	14	45	46	9	50	0.579	32	224	8	19	11	19	-50
55  
-8	0.68	54	54	17	36	38	9	48	63	64	13	43	44	8	57	0.857	80	510	18	20	18	21	-50
56  
-9	-0.10	51	53	16	36	38	9	44	73	77	19	43	44	9	84	0.5	52	406	15	30	17	34	-50
57  
-10	0.15	47	50	15	37	39	8	38	65	65	14	43	44	9	63	0.591	52	332	10	22	13	22	-50
58  
-11	-1.42	38	40	12	37	39	10	9	58	60	13	45	47	10	31	0.2	32	148	1	13	3	15	-50
59  
-12	-0.58	44	47	15	37	39	9	22	70	71	16	43	44	9	70	0.357	80	506	7	27	10	28	-50
60  
-13	0.08	63	63	24	36	38	9	63	85	91	21	43	44	9	94	0.563	52	382	27	42	27	48	0
61  
-14	-1.05	63	69	23	37	38	9	69	168	167	32	43	45	8	100	0.258	52	382	26	125	32	124	0
62  
-15	1.02	439	452	225	37	39	9	98	428	425	198	43	44	8	93	1.086	80	546	402	385	415	382	0
63  
-16	2.07	86	91	30	37	39	9	88	66	67	15	43	44	8	70	2.25	80	540	49	23	54	24	0
64  
-17	-0.79	40	44	14	36	39	10	11	67	69	15	43	44	9	73	0.308	52	384	4	24	8	26	-50
65  
-18	-0.57	50	51	16	37	39	10	37	79	82	22	43	44	9	83	0.359	80	570	13	36	14	39	-50
66  
-19	1.90	37	39	10	37	39	10	5	44	44	8	43	44	9	1	2	80	475	0	1	2	1	-50
67  
-20	-0.99	42	44	11	37	39	9	9	65	69	16	43	45	9	61	0.269	52	388	5	22	7	26	-50
68  
-!Sample_table_end
69  
-^SAMPLE=HS-27a cells
70  
-!Sample_title = HS-27a cells.
71  
-!Sample_source_name_ch1 = Human bone marrow stromal cells, HS-27a
72  
-!Sample_organism_ch1 = Homo sapiens
73  
-!Sample_characteristics_ch1 = Human bone marrow stromal cells, HS-27a
74  
-!Sample_growth_protocol_ch1 = HS-27a cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization followed by pelleting of the cells.
75  
-!Sample_molecule_ch1 = total RNA
76  
-!Sample_extract_protocol_ch1 = RNA isolation was accomplished with Qiagen RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
77  
-!Sample_label_ch1 = Cy5
78  
-!Sample_label_protocol_ch1 = The cDNA from HS-27a RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
79  
-!Sample_source_name_ch2 = Universal human reference RNA
80  
-!Sample_organism_ch2 = Homo sapiens
81  
-!Sample_characteristics_ch2 = As a control RNA, Human Universal RNA (Stratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines approximating the expression profile of the majority of human genes was used.
82  
-!Sample_molecule_ch2 = total RNA
83  
-!Sample_extract_protocol_ch2 = The RNA (30 µg) was annealed with 5 µg oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
84  
-!Sample_label_ch2 = Cy3
85  
-!Sample_label_protocol_ch2 = The cDNA from HS-27a RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
86  
-!Sample_scan_protocol = Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensity data were extracted and analyzed with GenePix Pro 3.0 analysis software.
87  
-!Sample_description = Human bone marrow stromal cells, HS-27a cells
88  
-!Sample_data_processing = After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear transformed to obtain the log and linear values given in the data table.
89  
-!Sample_platform_id = GPL1001
90  
-#ID_REF = 
91  
-#VALUE = Normalized log2 ratio of means defined as CH1 divided by CH2
92  
-#CH1_Median = Channel 1 median intensity
93  
-#CH1_Mean = Channel 1 mean intensity
94  
-#CH1_SD = Channel 1 mean standard deviation
95  
-#CH1_BKD_ Median = Channel 1 median background intensity
96  
-#CH1_BKD_ Mean = Channel 1 mean background intensity
97  
-#CH1_BKD_ SD = Channel 1 background standard deviation
98  
-#% > CH1_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of
99  
-#CH2_Median = Channel 2 median intensity
100  
-#CH2_Mean = Channel 2 mean intensity
101  
-#CH2_SD = Channel 2 mean standard deviation
102  
-#CH2_BKD_ Median = Channel 2 median background intensity
103  
-#CH2_BKD_ Mean = Channel 2 mean background intensity
104  
-#CH2_BKD_ SD = Channel 2 background standard deviation
105  
-#% > CH2_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of the background over the background signal
106  
-#Ratio of Means = Unnormalized, untransformed ratio of means
107  
-#AREA = Number of pixels used to calculate a feature's intensity
108  
-#BKD_AREA = Number of pixles used to calculate a feature's background
109  
-#CH1_Median - CH1_BKD_ = Channel 1 median signal
110  
-#CH2_Median - CH2_BKD_ = Channel 2 median signal
111  
-#CH1_Mean - CH1_BKD_ = Channel 1 mean signal
112  
-#CH2_Mean - CH2_BKD_ = Channel 2 mean signal
113  
-#Flags = 0 denotes satisfactory features, while <0 denotes features that did not meet
114  
-!Sample_table_begin
115  
-ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags
116  
-1	17.07	36	40	11	37	40	12	5	39	38	5	38	39	6	1	100000	80	540	-1	1	3	0	-50
117  
-2	-0.25	47	51	18	37	39	10	30	60	62	15	39	39	6	71	0.609	52	408	10	21	14	23	-50
118  
-3	-0.53	46	49	16	37	40	12	15	62	62	13	38	39	5	86	0.5	52	318	9	24	12	24	-50
119  
-4	17.07	36	40	12	36	40	12	10	39	39	6	39	39	6	5	100000	80	489	0	0	4	0	-50
120  
-5	1.28	178	251	175	36	41	12	95	116	161	103	39	39	6	95	1.762	80	476	142	77	215	122	0
121  
-6	0.83	56	64	31	37	41	18	32	57	60	18	39	39	7	57	1.286	80	514	19	18	27	21	-50
122  
-7	0.86	59	63	32	38	40	12	32	55	58	14	39	39	7	57	1.316	52	382	21	16	25	19	-50
123  
-8	2.12	124	144	75	37	40	12	95	72	73	15	39	39	6	88	3.147	80	554	87	33	107	34	0
124  
-9	-0.24	59	66	26	36	40	12	48	92	87	19	38	39	6	96	0.612	52	400	23	54	30	49	-50
125  
-10	0.64	63	63	20	37	40	11	53	58	61	12	38	39	6	75	1.13	80	502	26	20	26	23	-50
126  
-11	0.39	50	57	21	38	41	12	31	57	58	11	38	39	7	62	0.95	32	171	12	19	19	20	-50
127  
-12	-0.05	57	59	21	38	42	15	25	69	69	13	39	40	6	96	0.7	52	330	19	30	21	30	-50
128  
-13	-0.30	76	77	28	37	40	13	67	106	107	20	39	40	6	100	0.588	52	390	39	67	40	68	0
129  
-14	0.11	166	170	60	36	39	12	100	210	210	38	39	39	7	100	0.784	52	380	130	171	134	171	0
130  
-15	0.92	1356	1345	447	38	42	15	100	1004	993	331	39	40	10	100	1.37	52	380	1318	965	1307	954	0
131  
-16	2.92	183	193	62	39	42	12	100	66	67	14	39	39	6	88	5.5	80	476	144	27	154	28	0
132  
-17	-0.12	54	58	17	36	39	12	36	70	71	14	38	39	6	93	0.667	80	535	18	32	22	33	-50
133  
-18	-1.08	59	62	24	36	39	11	51	109	114	36	38	39	5	100	0.342	80	466	23	71	26	76	-50
134  
-19	17.07	36	41	13	38	41	11	11	39	38	5	38	39	5	1	100000	80	485	-2	1	3	0	-50
135  
-20	0.05	50	52	20	37	41	24	5	56	58	16	38	39	7	63	0.75	52	371	13	18	15	20	-50
136  
-!Sample_table_end
137  
-^SAMPLE=HS-5 cells rep2
138  
-!Sample_title = HS-5 cells, replicate 2
139  
-!Sample_source_name_ch1 = Human bone marrow stromal cells, HS-5
140  
-!Sample_organism_ch1 = Homo sapiens
141  
-!Sample_characteristics_ch1 = Human bone marrow stromal cells, HS-5
142  
-!Sample_growth_protocol_ch1 = HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization followed by pelleting of the cells.
143  
-!Sample_molecule_ch1 = total RNA
144  
-!Sample_extract_protocol_ch1 = RNA isolation was accomplished with Qiagen RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
145  
-!Sample_label_ch1 = Cy5
146  
-!Sample_label_protocol_ch1 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
147  
-!Sample_source_name_ch2 = Universal human reference RNA
148  
-!Sample_organism_ch2 = Homo sapiens
149  
-!Sample_characteristics_ch2 = As a control RNA, Human Universal RNA (Stratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines approximating the expression profile of the majority of human genes was used.
150  
-!Sample_molecule_ch2 = total RNA
151  
-!Sample_extract_protocol_ch2 = The RNA (30 µg) was annealed with 5 µg oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
152  
-!Sample_label_ch2 = Cy3
153  
-!Sample_label_protocol_ch2 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
154  
-!Sample_scan_protocol = Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensity data were extracted and analyzed with GenePix Pro 3.0 analysis software.
155  
-!Sample_description = Human bone marrow stromal cells, HS-5 cells
156  
-!Sample_data_processing = After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear transformed to obtain the log and linear values given in the data table.
157  
-!Sample_platform_id = GPL1001
158  
-#ID_REF = 
159  
-#VALUE = Normalized log2 ratio of means defined as CH1 divided by CH2
160  
-#CH1_Median = Channel 1 median intensity
161  
-#CH1_Mean = Channel 1 mean intensity
162  
-#CH1_SD = Channel 1 mean standard deviation
163  
-#CH1_BKD_ Median = Channel 1 median background intensity
164  
-#CH1_BKD_ Mean = Channel 1 mean background intensity
165  
-#CH1_BKD_ SD = Channel 1 background standard deviation
166  
-#% > CH1_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of
167  
-#CH2_Median = Channel 2 median intensity
168  
-#CH2_Mean = Channel 2 mean intensity
169  
-#CH2_SD = Channel 2 mean standard deviation
170  
-#CH2_BKD_ Median = Channel 2 median background intensity
171  
-#CH2_BKD_ Mean = Channel 2 mean background intensity
172  
-#CH2_BKD_ SD = Channel 2 background standard deviation
173  
-#% > CH2_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of the background over the background signal
174  
-#Ratio of Means = Unnormalized, untransformed ratio of means
175  
-#AREA = Number of pixels used to calculate a feature's intensity
176  
-#BKD_AREA = Number of pixles used to calculate a feature's background
177  
-#CH1_Median - CH1_BKD_ = Channel 1 median signal
178  
-#CH2_Median - CH2_BKD_ = Channel 2 median signal
179  
-#CH1_Mean - CH1_BKD_ = Channel 1 mean signal
180  
-#CH2_Mean - CH2_BKD_ = Channel 2 mean signal
181  
-#Flags = 0 denotes satisfactory features, while <0 denotes features that did not meet
182  
-!Sample_table_begin
183  
-ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags
184  
-1	3.74	39	44	16	37	40	13	10	42	42	8	41	42	8	2	7	80	473	2	1	7	1	-50
185  
-2	-0.14	46	46	15	37	40	13	10	57	58	14	39	40	7	53	0.474	80	549	9	18	9	19	-50
186  
-3	-0.31	47	47	18	36	40	13	16	65	66	18	40	41	7	75	0.423	80	554	11	25	11	26	-50
187  
-4	3.74	40	43	12	36	40	12	10	40	40	7	39	40	8	1	7	80	480	4	1	7	1	-50
188  
-5	0.60	74	91	55	37	41	14	60	95	108	45	40	41	8	93	0.794	80	532	37	55	54	68	0
189  
-6	0.86	60	58	19	38	42	14	33	59	60	14	39	40	8	60	0.952	80	555	22	20	20	21	-50
190  
-7	0.67	47	48	14	38	42	14	7	50	52	11	40	41	8	30	0.833	52	392	9	10	10	12	-50
191  
-8	0.71	51	56	22	38	41	13	31	62	61	14	40	41	7	66	0.857	80	516	13	22	18	21	-50
192  
-9	0.09	49	52	18	37	40	13	21	67	67	18	40	41	7	75	0.556	120	699	12	27	15	27	-50
193  
-10	-0.29	45	49	16	40	44	16	9	62	62	14	41	42	10	53	0.429	32	232	5	21	9	21	-50
194  
-11	-0.18	42	46	15	40	44	15	10	52	52	11	39	40	8	33	0.462	80	488	2	13	6	13	-50
195  
-12	-0.87	45	49	18	39	42	15	10	75	75	15	40	41	8	88	0.286	80	521	6	35	10	35	-50
196  
-13	-0.04	64	69	27	37	41	13	51	100	102	23	39	41	8	98	0.508	80	467	27	61	32	63	-50
197  
-14	-1.75	58	63	22	37	41	14	38	206	208	43	40	41	8	100	0.155	80	468	21	166	26	168	-50
198  
-15	1.32	643	731	413	38	42	15	100	543	569	218	40	41	7	100	1.31	80	537	605	503	693	529	0
199  
-16	2.58	162	168	74	37	41	13	98	80	83	22	41	42	8	93	3.119	80	458	125	39	131	42	0
200  
-17	-0.75	42	46	15	37	40	12	12	67	69	16	40	41	8	82	0.31	80	470	5	27	9	29	-50
201  
-18	-1.39	41	45	16	38	41	13	8	67	75	29	40	41	9	68	0.2	80	555	3	27	7	35	-50
202  
-19	0.00	40	42	14	37	40	12	10	39	39	7	40	40	7	2	-5	80	464	3	-1	5	-1	-50
203  
-20	-0.65	38	42	15	37	40	14	3	53	55	13	40	41	8	37	0.333	80	549	1	13	5	15	-50
204  
-!Sample_table_end
  1
+^SAMPLE = Control Embyronic Stem Cell Replicate 1
  2
+!Sample_title = Control Embyronic Stem Cell Replicate 1
  3
+!Sample_supplementary_file = file1.gpr
  4
+!Sample_source_name_ch1 = Total RNA from murine ES-D3 embryonic stem cells labeled with Cyanine-5 (red).
  5
+!Sample_organism_ch1 = Mus musculus
  6
+!Sample_characteristics_ch1 = ES-D3 cell line (CRL-1934)
  7
+!Sample_characteristics_ch1 = Age: day 4 
  8
+!Sample_characteristics_ch1 = Tissue: blastocytes
  9
+!Sample_characteristics_ch1 = Strain: 129/Sv mice
  10
+!Sample_growth_protocol_ch1 = ES cells were kept in an undifferentiated, pluripotent state by using 1000 IU/ml leukemia inhibitory factor (LIF; Chemicon, ESGRO, ESG1107), and grown on top of murine embryonic fibroblasts feeder layer inactivated by 10 ug/ml of mitomycin C (Sigma, St. Louis). ES cells were cultured on 0.1% gelatin-coated plastic dishes in ES medium containing Dulbecco modified Eagle medium supplemented with 15% fetal calf serum, 0.1 mM beta-mercaptoethanol, 2 mM glutamine, and 0.1 mN non-essential amino acids.
  11
+!Sample_extract_protocol_ch1 = TriZol procedure
  12
+!Sample_molecule_ch1 = total RNA
  13
+!Sample_label_ch1 = Cy5
  14
+!Sample_label_protocol_ch1 = 10 µg of total RNA were primed with 2 µl of 100 µM T16N2 DNA primer at 70°C for 10 min, then reversed transcribed at 42°C for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 µM each dATP, dTTP, dGTP, with 25 µM dCTP, 25 µM Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).
  15
+!Sample_source_name_ch2 = Total RNA from pooled whole mouse embryos e17.5, labeled with Cyanine-3 (green).
  16
+!Sample_organism_ch2 = Mus musculus
  17
+!Sample_characteristics_ch2 = Strain: C57BL/6
  18
+!Sample_characteristics_ch2 = Age: e17.5 d
  19
+!Sample_characteristics_ch2 = Tissue: whole embryo
  20
+!Sample_extract_protocol_ch2 = TriZol procedure
  21
+!Sample_molecule_ch2 = total RNA
  22
+!Sample_label_ch2 = Cy3
  23
+!Sample_label_protocol_ch2 = 10 µg of total RNA were primed with 2 µl of 100 µM T16N2 DNA primer at 70°C for 10 min, then reversed transcribed at 42°C for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 µM each dATP, dTTP, dGTP, with 25 µM dCTP, 25 µM Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).
  24
+!Sample_hyb_protocol = Oligoarray control targets and hybridization buffer (Agilent In Situ Hybridization Kit Plus) were added, and samples were applied to microarrays enclosed in Agilent SureHyb-enabled hybridization chambers. After hybridization, slides were washed sequentially with 6x SSC/0.005% Triton X-102 and 0.1x SSC/0.005% Triton X-102 before scanning. Slides were hybridized for 17 h at 60°C in a rotating oven, and washed.
  25
+!Sample_scan_protocol = Scanned on an Agilent G2565AA scanner.
  26
+!Sample_scan_protocol = Images were quantified using Agilent Feature Extraction Software (version A.7.5). 
  27
+!Sample_description = Biological replicate 1 of 4. Control embryonic stem cells, untreated, harvested after several passages.
  28
+!Sample_data_processing = LOWESS normalized, background subtracted VALUE data obtained from log of processed Red signal/processed Green signal.
  29
+!Sample_platform_id = GPL3759
  30
+#ID_REF = 
  31
+#VALUE = log(REDsignal/GREENsignal) per feature (processed signals used).
  32
+#LogRatioError = error of the log ratio calculated according to the error model chosen.
  33
+#PValueLogRatio = Significance level of the Log Ratio computed for a feature.
  34
+#gProcessedSignal = Dye-normalized signal after surrogate "algorithm," green "channel," used for computation of log ratio.
  35
+#rProcessedSignal = Dye-normalized signal after surrogate "algorithm," red "channel," used for computation of log ratio.
  36
+!sample_table_begin	
  37
+ID_REF	VALUE	LogRatioError	PValueLogRatio	gProcessedSignal	rProcessedSignal
  38
+1	-1.6274758	1.36E-01	6.41E-33	9.13E+03	2.15E+02
  39
+2	0.1412248	1.34E+00	1.00E+00	4.14E+01	5.72E+01
  40
+3	0.1827684	5.19E-02	4.33E-04	5.13E+03	7.81E+03
  41
+4	-0.3932267	6.08E-02	1.02E-10	4.65E+03	1.88E+03
  42
+5	-0.9865994	1.05E-01	6.32E-21	2.91E+03	3.01E+02
  43
+6	0.0238812	1.02E-01	8.15E-01	7.08E+02	7.48E+02
  44
+7	-1.4841822	1.25E-01	1.42E-32	1.02E+04	3.36E+02
  45
+8	-1.8261356	4.15E-01	1.10E-05	7.19E+02	1.07E+01
  46
+9	-1.0344779	1.78E+00	1.00E+00	9.62E+01	8.89E+00
  47
+10	0.2405891	3.09E-01	4.36E-01	1.61E+02	2.80E+02
  48
+11	0.3209366	3.59E-01	3.71E-01	1.25E+02	2.61E+02
  49
+12	0.358304	2.06E+00	1.00E+00	2.04E+01	4.66E+01
  50
+13	-0.0122072	3.64E-01	9.73E-01	1.84E+02	1.79E+02
  51
+14	-1.5480396	1.30E-01	7.21E-33	1.02E+04	2.90E+02
  52
+15	0.0073419	2.98E-01	9.80E-01	2.21E+02	2.25E+02
  53
+16	-0.2267015	9.44E-01	8.10E-01	8.90E+01	5.28E+01
  54
+17	-0.1484023	8.01E-01	8.53E-01	9.65E+01	6.86E+01
  55
+18	-0.6122195	1.28E-01	1.69E-06	1.12E+03	2.73E+02
  56
+19	0.0796905	8.78E-02	3.64E-01	8.21E+02	9.87E+02
  57
+20	-0.084895	9.38E-01	9.28E-01	7.68E+01	6.32E+01
  58
+!sample_table_end	
  59
+^SAMPLE = Control Embyronic Stem Cell Replicate 2	
  60
+!Sample_title = Control Embyronic Stem Cell Replicate 2
  61
+!Sample_supplementary_file = file2.gpr	
  62
+!Sample_source_name_ch1 = Total RNA from murine ES-D3 embryonic stem cells labeled with Cyanine-5 (red).	
  63
+!Sample_organism_ch1 = Mus musculus	
  64
+!Sample_characteristics_ch1 = ES-D3 cell line (CRL-1934)	
  65
+!Sample_characteristics_ch1 = Age: day 4 	
  66
+!Sample_characteristics_ch1 = Tissue: blastocytes	
  67
+!Sample_characteristics_ch1 = Strain: 129/Sv mice	
  68
+!Sample_growth_protocol_ch1 = ES cells were kept in an undifferentiated, pluripotent state by using 1000 IU/ml leukemia inhibitory factor (LIF; Chemicon, ESGRO, ESG1107), and grown on top of murine embryonic fibroblasts feeder layer inactivated by 10 ug/ml of mitomycin C (Sigma, St. Louis). ES cells were cultured on 0.1% gelatin-coated plastic dishes in ES medium containing Dulbecco modified Eagle medium supplemented with 15% fetal calf serum, 0.1 mM beta-mercaptoethanol, 2 mM glutamine, and 0.1 mN non-essential amino acids.
  69
+!Sample_extract_protocol_ch1 = TriZol procedure	
  70
+!Sample_molecule_ch1 = total RNA	
  71
+!Sample_label_ch1 = Cy5	
  72
+!Sample_label_protocol_ch1 = 10 µg of total RNA were primed with 2 µl of 100 µM T16N2 DNA primer at 70°C for 10 min, then reversed transcribed at 42°C for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 µM each dATP, dTTP, dGTP, with 25 µM dCTP, 25 µM Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).
  73
+!Sample_source_name_ch2 = Total RNA from pooled whole mouse embryos e17.5, labeled with Cyanine-3 (green).	
  74
+!Sample_organism_ch2 = Mus musculus	
  75
+!Sample_characteristics_ch2 = Strain: C57BL/6	
  76
+!Sample_characteristics_ch2 = Age: e17.5 d	
  77
+!Sample_characteristics_ch2 = Tissue: whole embryo	
  78
+!Sample_extract_protocol_ch2 = TriZol procedure	
  79
+!Sample_molecule_ch2 = total RNA	
  80
+!Sample_label_ch2 = Cy3
  81
+!Sample_label_protocol_ch2 = 10 µg of total RNA were primed with 2 µl of 100 µM T16N2 DNA primer at 70°C for 10 min, then reversed transcribed at 42°C for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 µM each dATP, dTTP, dGTP, with 25 µM dCTP, 25 µM Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).
  82
+!Sample_hyb_protocol = Oligoarray control targets and hybridization buffer (Agilent In Situ Hybridization Kit Plus) were added, and samples were applied to microarrays enclosed in Agilent SureHyb-enabled hybridization chambers. After hybridization, slides were washed sequentially with 6x SSC/0.005% Triton X-102 and 0.1x SSC/0.005% Triton X-102 before scanning. Slides were hybridized for 17 h at 60°C in a rotating oven, and washed.
  83
+!Sample_scan_protocol = Scanned on an Agilent G2565AA scanner.	
  84
+!Sample_scan_protocol = Images were quantified using Agilent Feature Extraction Software (version A.7.5). 	
  85
+!Sample_description = Biological replicate 2 of 4. Control embryonic stem cells, untreated, harvested after several passages.	
  86
+!Sample_data_processing = LOWESS normalized, background subtracted VALUE data obtained from log of processed Red signal/processed Green signal.	
  87
+!Sample_platform_id = GPL3759
  88
+#ID_REF = 	
  89
+#VALUE = log(REDsignal/GREENsignal) per feature (processed signals used).	
  90
+#LogRatioError = error of the log ratio calculated according to the error model chosen.	
  91
+#PValueLogRatio = Significance level of the Log Ratio computed for a feature.	
  92
+#gProcessedSignal = Dye-normalized signal after surrogate "algorithm," green "channel," used for computation of log ratio.	
  93
+#rProcessedSignal = Dye-normalized signal after surrogate "algorithm," red "channel," used for computation of log ratio.	
  94
+!sample_table_begin	
  95
+ID_REF	VALUE	LogRatioError	PValueLogRatio	gProcessedSignal	rProcessedSignal
  96
+1	-1.1697263	1.23E-01	2.14E-21	3.17E+03	2.14E+02
  97
+2	-0.1111353	1.63E+00	9.46E-01	5.43E+01	4.20E+01
  98
+3	0.1400597	5.11E-02	6.17E-03	6.72E+03	9.28E+03
  99
+4	-0.4820633	6.38E-02	4.06E-14	6.46E+03	2.13E+03
  100
+5	-1.2116196	1.22E-01	2.31E-23	3.62E+03	2.22E+02
  101
+6	-0.0230528	1.04E-01	8.24E-01	8.76E+02	8.31E+02
  102
+7	-1.1380152	1.13E-01	9.23E-24	3.94E+03	2.86E+02
  103
+8	-1.834596	5.40E-01	6.74E-04	6.44E+02	9.43E+00
  104
+9	-0.9747637	2.14E+00	1.00E+00	9.17E+01	9.72E+00
  105
+10	0.3874005	2.92E-01	1.85E-01	1.69E+02	4.11E+02
  106
+11	0.5340442	3.29E-01	1.04E-01	1.23E+02	4.20E+02
  107
+12	0.3260696	1.92E+00	8.65E-01	2.73E+01	5.77E+01
  108
+13	0.3010618	2.84E-01	2.90E-01	1.93E+02	3.87E+02
  109
+14	-1.0760413	1.08E-01	1.63E-23	4.06E+03	3.41E+02
  110
+15	-0.1167371	3.87E-01	7.63E-01	2.32E+02	1.77E+02
  111
+16	-0.1936322	9.44E-01	8.38E-01	1.02E+02	6.56E+01
  112
+17	-0.3275898	7.87E-01	6.77E-01	1.41E+02	6.65E+01
  113
+18	-0.4805853	1.14E-01	2.41E-05	1.34E+03	4.42E+02
  114
+19	0.1109524	9.56E-02	2.46E-01	8.38E+02	1.08E+03
  115
+20	0.1677912	6.51E-01	7.97E-01	9.84E+01	1.45E+02
  116
+!sample_table_end	
  117
+^SAMPLE = Triple-Fusion Transfected Embryonic Stem Cells Replicate 1
  118
+!Sample_supplementary_file = file3.gpr	
  119
+!Sample_title = Triple-Fusion Transfected Embryonic Stem Cells Replicate 1	
  120
+!Sample_source_name_ch1 = Total RNA from murine ES-D3 triple-transfected embryonic stem cells labeled with Cyanine-5 (red).	
  121
+!Sample_organism_ch1 = Mus musculus	
  122
+!Sample_characteristics_ch1 = ES-D3 cell line (CRL-1934)	
  123
+!Sample_characteristics_ch1 = Transfected with pUb-fluc-mrfp-ttk triple fusion reporter gene.	
  124
+!Sample_characteristics_ch1 = Age: day 4 	
  125
+!Sample_characteristics_ch1 = Tissue: blastocytes	
  126
+!Sample_characteristics_ch1 = Strain: 129/Sv mice	
  127
+!Sample_treatment_protocol_ch1 = PCR amplification and standard cloning techniques were used to insert fluc and mrfp genes from plasmids pCDNA 3.1-CMV-fluc (Promega, Madison, WI) and pCDNA3.1-CMV-mrfp in frame with the ttk gene into the pCDNA3.1-truncated	sr39tk. This triple fusion (TF) reporter gene fragment (3.3 kbp) was released from the plasmid with Not1 and BamH1 restriction enzymes before blunt-end ligation into the multiple cloning site of lentiviral transfer vector, FUG, driven by the human ubiquitin-C promoter. Self-inactivating (SIN) lentivirus was prepared by transient transfection of 293T cells. Briefly, pFUG-TF containing the triple fusion reporter gene was co-transfected into 293T cells with HIV-1 packaging vector (?8.9) and vesicular stomatitis virus G glycoprotein-pseudotyped envelop vector (pVSVG). Lentivirus supernatant was concentrated by sediment centrifugation using a SW29 rotor at 50,000 x g for two hours. Concentrated virus was titered on 293T cells. Murine ES cells were transfected with LV-pUb-fluc-mrfp-ttk at a multiplicity of infection (MOI) of 10.
  128
+!Sample_growth_protocol_ch1 = ES cells were kept in an undifferentiated, pluripotent state by using 1000 IU/ml leukemia inhibitory factor (LIF; Chemicon, ESGRO, ESG1107), and grown on top of murine embryonic fibroblasts feeder layer inactivated by 10 ug/ml of mitomycin C (Sigma, St. Louis). ES cells were cultured on 0.1% gelatin-coated plastic dishes in ES medium containing Dulbecco modified Eagle medium supplemented with 15% fetal calf serum, 0.1 mM beta-mercaptoethanol, 2 mM glutamine, and 0.1 mN non-essential amino acids.
  129
+!Sample_extract_protocol_ch1 = TriZol procedure	
  130
+!Sample_molecule_ch1 = total RNA	
  131
+!Sample_label_ch1 = Cy5	
  132
+!Sample_label_protocol_ch1 = 10 µg of total RNA were primed with 2 µl of 100 µM T16N2 DNA primer at 70°C for 10 min, then reversed transcribed at 42°C for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 µM each dATP, dTTP, dGTP with 25 µM dCTP, 25 µM Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).	
  133
+!Sample_source_name_ch2 = Total RNA from pooled whole mouse embryos e17.5, labeled with Cyanine-3 (green).	
  134
+!Sample_organism_ch2 = Mus musculus	
  135
+!Sample_characteristics_ch2 = Strain: C57BL/6	
  136
+!Sample_characteristics_ch2 = Age: e17.5 d	
  137
+!Sample_characteristics_ch2 = Tissue: whole embryo	
  138
+!Sample_extract_protocol_ch2 = TriZol procedure	
  139
+!Sample_molecule_ch2 = total RNA	
  140
+!Sample_label_ch2 = Cy3	
  141
+!Sample_label_protocol_ch2 = 10 µg of total RNA were primed with 2 µl of 100 µM T16N2 DNA primer at 70°C for 10 min, then reversed transcribed at 42°C for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 µM each dATP, dTTP, dGTP, with 25 µM dCTP, 25 µM Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).
  142
+!Sample_hyb_protocol = Oligoarray control targets and hybridization buffer (Agilent In Situ Hybridization Kit Plus) were added, and samples were applied to microarrays enclosed in Agilent SureHyb-enabled hybridization chambers. After hybridization, slides were washed sequentially with 6x SSC/0.005% Triton X-102 and 0.1x SSC/0.005% Triton X-102 before scanning. Slides were hybridized for 17 h at 60°C in a rotating oven, and washed.
  143
+!Sample_scan_protocol = Scanned on an Agilent G2565AA scanner.	
  144
+!Sample_description = Biological replicate 1 of 3. Stable triple-fusion-reporter-gene transfected embryonic stem cells, harvested after several passages.	
  145
+!Sample_data_processing = LOWESS normalized, background subtracted VALUE data obtained from log of processed Red signal/processed Green signal.	
  146
+!Sample_platform_id = GPL3759
  147
+#ID_REF = 	
  148
+#VALUE = log(REDsignal/GREENsignal) per feature (processed signals used).	
  149
+#LogRatioError = error of the log ratio calculated according to the error model chosen.	
  150
+#PValueLogRatio = Significance level of the Log Ratio computed for a feature.	
  151
+#gProcessedSignal = Dye-normalized signal after surrogate "algorithm," green "channel," used for computation of log ratio.	
  152
+#rProcessedSignal = Dye-normalized signal after surrogate "algorithm," red "channel," used for computation of log ratio.	
  153
+!sample_table_begin	
  154
+ID_REF	VALUE	LogRatioError	PValueLogRatio	gProcessedSignal	rProcessedSignal
  155
+1	-0.7837546	1.30E-01	1.70E-09	2.10E+03	3.46E+02
  156
+2	0.3797837	1.15E+00	7.41E-01	5.59E+01	1.34E+02
  157
+3	0.2079269	5.38E-02	1.12E-04	5.04E+03	8.14E+03
  158
+4	-0.4730291	6.71E-02	1.86E-12	5.66E+03	1.91E+03
  159
+5	-0.9481128	1.19E-01	1.30E-15	3.10E+03	3.49E+02
  160
+6	-0.0159867	1.33E-01	9.05E-01	8.45E+02	8.14E+02
  161
+7	-0.819922	1.14E-01	7.01E-13	2.75E+03	4.16E+02
  162
+8	-0.1559774	9.16E-01	8.65E-01	1.34E+02	9.34E+01
  163
+9	0.145267	3.90E+00	1.00E+00	2.22E+01	3.10E+01
  164
+10	0.3611211	3.40E-01	2.88E-01	1.97E+02	4.52E+02
  165
+11	0.5092089	4.39E-01	2.46E-01	1.24E+02	4.01E+02
  166
+12	0.3715387	1.69E+00	8.26E-01	3.84E+01	9.04E+01
  167
+13	0.1734934	3.57E-01	6.27E-01	2.37E+02	3.53E+02
  168
+14	-0.9340707	1.20E-01	6.90E-15	2.96E+03	3.45E+02
  169
+15	-0.2956317	5.78E-01	6.09E-01	2.46E+02	1.25E+02
  170
+16	-0.2321102	1.22E+00	8.49E-01	1.09E+02	6.37E+01
  171
+17	-0.1603561	1.16E+00	8.90E-01	1.06E+02	7.34E+01
  172
+18	-0.5063897	1.63E-01	1.95E-03	1.15E+03	3.58E+02
  173
+19	0.1990761	1.32E-01	1.32E-01	6.65E+02	1.05E+03
  174
+20	0.2985912	8.89E-01	7.37E-01	8.06E+01	1.60E+02
  175
+!sample_table_end
516  Tests/Geo/soft_ex_family.txt
... ...
@@ -1,268 +1,248 @@
1  
-^PLATFORM=GEO Human 15K v2.0
2  
-!Platform_title = Human 15K long oligo array version 2.0
3  
-!Platform_distribution = non-commercial
4  
-!Platform_description = This set includes 13971 oligonucleotides, mostly 70-mers, designed based upon representative sequences in build 155 of the human UniGene database.
5  
-!Platform_technology = spotted oligonucleotide
6  
-!Platform_organism = Homo sapiens
7  
-!Platform_manufacturer = GEO Labs
8  
-!Platform_manufacture_protocol = as described in GEO Labs manual
9  
-!Platform_support = glass
10  
-!Platform_coating = unknown
11  
-!Platform_pubmed_id = 123456789
12  
-!Platform_web_link = http://geo.best-arrays.org
13  
-!Platform_contributor = Jane,Doe
14  
-!Platform_contributor = John,A,Smith
15  
-!Platform_contributor = Hans,van Elton
16  
-!Platform_contributor = John,Smithers Jr
17  
-!Platform_contributor = Jie,D,Chen
18  
-#ID =
19  
-#GB_ACC = GenBank accession number of sequence used to design oligonucleotide probe   LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term=" 
20  
-#GENE_NAME = Descriptive gene name, from UniGene Build 155
21  
-#UNIGENE = UniGene cluster ID, Build 155   LINK_PRE:"http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID="
22  
-#LOCUSLINK = LocusLink identifier   LINK_PRE:"http://www.ncbi.nlm.nih.gov/LocusLink/LocRpt.cgi?l="
23  
-#GENE_SYMBOL = Gene symbol, from UniGene Build 155
24  
-#TIP_ID = Print tip ID
25  
-#ROW = Row within array
26  
-#COLUMN = Column within array
27  
-#PLATE_ID = Plate identifier
28  
-#FLAG = Passed validation
29  
-#SEQUENCE = Sequence of oligonucleotide probe
30  
-!Platform_table_begin
31  
-ID	GB_ACC	GENE_NAME	UNIGENE	LOCUSLINK	GENE_SYMBOL	TIP_ID	ROW	COLUMN	PLATE_ID	FLAG	SEQUENCE
32  
-1	NM_012115	CASP8 associated protein 2	122843	9994	CASP8AP2	1	1	1	HK1A1	1	GAGGGCCATCATTTAAAACATTTGCATATTTAGCCGCCAAGTTGGATAAAAATCCAAATCAGGTCTCAGA
33  
-2	AF035444	tumor suppressing subtransferable candidate 3	154036	7262	TSSC3	5	1	1	HK1A2	1	CTCATCCAGTCATGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGT
34  
-3	AK001420	PEF protein with a long N-terminal hydrophobic domain (peflin)	241531	23578	PEF	1	3	1	HK1A3	1	AATCTGACCAAGCATGAGAGAGATCTGTCTATGGGACCAGTGGCTTGGATTCTGCCACACCCATAAATCC
35  
-4	M55150	fumarylacetoacetate hydrolase (fumarylacetoacetase)	73875	2184	FAH	5	3	1	HK1A4	1	TCCTGCCATCATGAGATTTTCTCTGCTCTTCTGGAAACAAAGGGCTCAAGCACCCCTTTCAACCCTGTGA
36  
-5	AL121964					1	5	1	HK1A5	1	TCCCTGTGAAACTTTGGTTTCTTTCTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATG
37  
-6	NM_012094	peroxiredoxin 5	31731	25824	PRDX5	5	5	1	HK1A6	1	AATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCA
38  
-7	AK001917	programmed cell death 6	80019	10016	PDCD6	1	7	1	HK1A7	1	TGTCACGTGGGGACCCAGCTGTACATATGTGGATAAGCTGATTAATGGTTTTGCAACTGTAATAGTAGCT
39  
-8	AF135794	v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)	278582	10000	AKT3	5	7	1	HK1A8	1	CTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGC
40  
-9	U43342	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	248037	4773	NFATC2	1	9	1	HK1A9	1	CTACTTGGATGATGTTAATGAAATTATCAGGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAA
41  
-10	AF067724	non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)	72050	8382	NME5	5	9	1	HK1A10	1	TTTCATGCTCATGTGTCAGATATGCTTCCCTCAAACCTTGTTACAGCATCATCACATTACCTGTTTGATG
42  
-11	M13452	lamin A/C	77886	4000	LMNA	1	11	1	HK1A11	1	GAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAATACACTAGTTGTTTCT
43  
-12	AJ242832	calpain 11	225953	11131	CAPN11	5	11	1	HK1A12	1	TGAACAACAAGGTAATGCAGGTCCTGGTGGCCAGGTATGCAGATGATGACCTGATCATAGACTTTGACAG
44  
-13	AF041378	cell death-inducing DFFA-like effector a	249129	1149	CIDEA	2	1	1	HK1B1	1	AGGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTACGACATCCG
45  
-14	AF014955	programmed cell death 5	166468	9141	PDCD5	6	1	1	HK1B2	1	GAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGG
46  
-15	D50857	dedicator of cyto-kinesis 1	82295	1793	DOCK1	2	3	1	HK1B3	1	TGTTCCAGCCGGTGGTGTGACTTCGTTGGTTGAGGTGTGTCTCCAACCTACATCAGACCATGAAGTTCAA
47  
-16	AB011414	Kruppel-type zinc finger (C2H2)	142150	10224	ZK1	6	3	1	HK1B4	1	TGATACCTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATGTT
48  
-17	AF064019	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	133089	1677	DFFB	2	5	1	HK1B5	1	CGGTCTGGAAGGAAACACGCGGATCTGAACAGCAGTAATCCTGGGGGATACGGGGGTTGGGCTAGATTAC
49  
-18	U83857	apoptosis inhibitor 5	227913	8539	API5	6	5	1	HK1B6	1	TCACCGTTCCCCTTCCCTTTCGTAAGGCAATAGTGCACAACTTAGGTTATTTTTGCTTCCGAATTTGAAT
50  
-19	J05243	spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	77196	6709	SPTAN1	2	7	1	HK1B7	1	TAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGACCCAG
51  
-20	AB014541	apoptosis-associated tyrosine kinase	128316	9625	AATK	6	7	1	HK1B8	1	ATGTAAAGTTTATTGTTGCTTCGCAGGGGGATTTGTTTTGTGTTTTGTTTGAGGCTTAGAACGCTGGTGC
52  
-!Platform_table_end
53  
-^SAMPLE=HS-5 cells rep 1
54  
-!Sample_title = Human bone marrow stromal cells, HS-5 cells, replicate 1
55  
-!Sample_source_name_ch1 = Human bone marrow stromal cells, HS-5 cells
56  
-!Sample_organism_ch1 = Homo sapiens
57  
-!Sample_characteristics_ch1 = Human bone marrow stromal cells, HS-5
58  
-!Sample_growth_protocol_ch1 = HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization followed by pelleting of the cells.
59  
-!Sample_molecule_ch1 = total RNA
60  
-!Sample_extract_protocol_ch1 = RNA isolation was accomplished with Qiagen RNeasy Mini Kit reagents. The RNA (30 痢) was annealed with 5 痢 oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42蚓 in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
61  
-!Sample_label_ch1 = Cy5
62  
-!Sample_label_protocol_ch1 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 痞 of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
63  
-!Sample_source_name_ch2 = Universal human reference RNA
64  
-!Sample_organism_ch2 = Homo sapiens
65  
-!Sample_characteristics_ch2 = As a control RNA, Human Universal RNA (Stratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines approximating the expression profile of the majority of human genes was used.
66  
-!Sample_molecule_ch2 = total RNA
67  
-!Sample_extract_protocol_ch2 = The RNA (30 痢) was annealed with 5 痢 oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42蚓 in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
68  
-!Sample_label_ch2 = Cy3
69  
-!Sample_label_protocol_ch2 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 痞 of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
70  
-!Sample_scan_protocol = Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensity data were extracted and analyzed with GenePix Pro 3.0 analysis software.
71  
-!Sample_description = Human bone marrow stromal cells, HS-5 cells
72  
-!Sample_data_processing = After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear transformed to obtain the log and linear values given in the data table.
73  
-!Sample_platform_id = GEO Human 15K v2.0
74  
-#ID_REF = 
75  
-#VALUE = Normalized log2 ratio of means defined as CH1 divided by CH2
76  
-#CH1_Median = Channel 1 median intensity
77  
-#CH1_Mean = Channel 1 mean intensity
78  
-#CH1_SD = Channel 1 mean standard deviation
79  
-#CH1_BKD_ Median = Channel 1 median background intensity
80  
-#CH1_BKD_ Mean = Channel 1 mean background intensity
81  
-#CH1_BKD_ SD = Channel 1 background standard deviation
82  
-#% > CH1_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of
83  
-#CH2_Median = Channel 2 median intensity
84  
-#CH2_Mean = Channel 2 mean intensity
85  
-#CH2_SD = Channel 2 mean standard deviation
86  
-#CH2_BKD_ Median = Channel 2 median background intensity
87  
-#CH2_BKD_ Mean = Channel 2 mean background intensity
88  
-#CH2_BKD_ SD = Channel 2 background standard deviation
89  
-#% > CH2_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of the background over the background signal
90  
-#Ratio of Means = Unnormalized, untransformed ratio of means
91  
-#AREA = Number of pixels used to calculate a feature's intensity
92  
-#BKD_AREA = Number of pixles used to calculate a feature's background
93  
-#CH1_Median - CH1_BKD_ = Channel 1 median signal
94  
-#CH2_Median - CH2_BKD_ = Channel 2 median signal
95  
-#CH1_Mean - CH1_BKD_ = Channel 1 mean signal
96  
-#CH2_Mean - CH2_BKD_ = Channel 2 mean signal
97  
-#Flags = 0 denotes satisfactory features, while <0 denotes features that did not meet
98  
-!Sample_table_begin
99  
-ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags
100  
-1	17.51	36	38	9	37	38	8	5	45	46	9	46	47	10	0	100000	80	500	-1	-1	1	0	-50
101  
-2	-0.10	42	47	19	37	39	11	12	64	65	15	45	47	10	43	0.5	32	176	5	19	10	20	-50
102  
-3	-0.42	44	48	18	36	38	8	37	75	75	17	45	46	10	71	0.4	32	176	8	30	12	30	-50
103  
-4	17.51	37	40	11	37	39	10	11	42	43	8	43	43	8	2	100000	80	498	0	-1	3	0	-50
104  
-5	0.95	147	193	125	37	39	8	98	157	194	109	43	44	9	98	1.033	52	398	110	114	156	151	0
105  
-6	0.79	57	62	21	37	39	9	55	69	71	14	44	45	8	76	0.926	52	329	20	25	25	27	-50
106  
-7	0.12	45	48	16	37	40	10	28	64	64	14	45	46	9	50	0.579	32	224	8	19	11	19	-50
107  
-8	0.68	54	54	17	36	38	9	48	63	64	13	43	44	8	57	0.857	80	510	18	20	18	21	-50
108  
-9	-0.10	51	53	16	36	38	9	44	73	77	19	43	44	9	84	0.5	52	406	15	30	17	34	-50
109  
-10	0.15	47	50	15	37	39	8	38	65	65	14	43	44	9	63	0.591	52	332	10	22	13	22	-50
110  
-11	-1.42	38	40	12	37	39	10	9	58	60	13	45	47	10	31	0.2	32	148	1	13	3	15	-50
111  
-12	-0.58	44	47	15	37	39	9	22	70	71	16	43	44	9	70	0.357	80	506	7	27	10	28	-50
112  
-13	0.08	63	63	24	36	38	9	63	85	91	21	43	44	9	94	0.563	52	382	27	42	27	48	0
113  
-14	-1.05	63	69	23	37	38	9	69	168	167	32	43	45	8	100	0.258	52	382	26	125	32	124	0
114  
-15	1.02	439	452	225	37	39	9	98	428	425	198	43	44	8	93	1.086	80	546	402	385	415	382	0
115  
-16	2.07	86	91	30	37	39	9	88	66	67	15	43	44	8	70	2.25	80	540	49	23	54	24	0
116  
-17	-0.79	40	44	14	36	39	10	11	67	69	15	43	44	9	73	0.308	52	384	4	24	8	26	-50
117  
-18	-0.57	50	51	16	37	39	10	37	79	82	22	43	44	9	83	0.359	80	570	13	36	14	39	-50
118  
-19	1.90	37	39	10	37	39	10	5	44	44	8	43	44	9	1	2	80	475	0	1	2	1	-50
119  
-20	-0.99	42	44	11	37	39	9	9	65	69	16	43	45	9	61	0.269	52	388	5	22	7	26	-50
120  
-!Sample_table_end
121  
-^SAMPLE=HS-27a cells
122  
-!Sample_title = HS-27a cells.
123  
-!Sample_source_name_ch1 = Human bone marrow stromal cells, HS-27a
124  
-!Sample_organism_ch1 = Homo sapiens
125  
-!Sample_characteristics_ch1 = Human bone marrow stromal cells, HS-27a
126  
-!Sample_growth_protocol_ch1 = HS-27a cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization followed by pelleting of the cells.
127  
-!Sample_molecule_ch1 = total RNA
128  
-!Sample_extract_protocol_ch1 = RNA isolation was accomplished with Qiagen RNeasy Mini Kit reagents. The RNA (30 痢) was annealed with 5 痢 oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42蚓 in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
129  
-!Sample_label_ch1 = Cy5
130  
-!Sample_label_protocol_ch1 = The cDNA from HS-27a RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 痞 of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
131  
-!Sample_source_name_ch2 = Universal human reference RNA
132  
-!Sample_organism_ch2 = Homo sapiens
133  
-!Sample_characteristics_ch2 = As a control RNA, Human Universal RNA (Stratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines approximating the expression profile of the majority of human genes was used.
134  
-!Sample_molecule_ch2 = total RNA
135  
-!Sample_extract_protocol_ch2 = The RNA (30 痢) was annealed with 5 痢 oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42蚓 in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
136  
-!Sample_label_ch2 = Cy3
137  
-!Sample_label_protocol_ch2 = The cDNA from HS-27a RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 痞 of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
138  
-!Sample_scan_protocol = Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensity data were extracted and analyzed with GenePix Pro 3.0 analysis software.
139  
-!Sample_description = Human bone marrow stromal cells, HS-27a cells
140  
-!Sample_data_processing = After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear transformed to obtain the log and linear values given in the data table.
141  
-!Sample_platform_id = GEO Human 15K v2.0
142  
-#ID_REF = 
143  
-#VALUE = Normalized log2 ratio of means defined as CH1 divided by CH2
144  
-#CH1_Median = Channel 1 median intensity
145  
-#CH1_Mean = Channel 1 mean intensity
146  
-#CH1_SD = Channel 1 mean standard deviation
147  
-#CH1_BKD_ Median = Channel 1 median background intensity
148  
-#CH1_BKD_ Mean = Channel 1 mean background intensity
149  
-#CH1_BKD_ SD = Channel 1 background standard deviation
150  
-#% > CH1_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of
151  
-#CH2_Median = Channel 2 median intensity
152  
-#CH2_Mean = Channel 2 mean intensity
153  
-#CH2_SD = Channel 2 mean standard deviation
154  
-#CH2_BKD_ Median = Channel 2 median background intensity
155  
-#CH2_BKD_ Mean = Channel 2 mean background intensity
156  
-#CH2_BKD_ SD = Channel 2 background standard deviation
157  
-#% > CH2_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of the background over the background signal
158  
-#Ratio of Means = Unnormalized, untransformed ratio of means
159  
-#AREA = Number of pixels used to calculate a feature's intensity
160  
-#BKD_AREA = Number of pixles used to calculate a feature's background
161  
-#CH1_Median - CH1_BKD_ = Channel 1 median signal
162  
-#CH2_Median - CH2_BKD_ = Channel 2 median signal
163  
-#CH1_Mean - CH1_BKD_ = Channel 1 mean signal
164  
-#CH2_Mean - CH2_BKD_ = Channel 2 mean signal
165  
-#Flags = 0 denotes satisfactory features, while <0 denotes features that did not meet
166  
-!Sample_table_begin
167  
-ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags
168  
-1	17.07	36	40	11	37	40	12	5	39	38	5	38	39	6	1	100000	80	540	-1	1	3	0	-50
169  
-2	-0.25	47	51	18	37	39	10	30	60	62	15	39	39	6	71	0.609	52	408	10	21	14	23	-50
170  
-3	-0.53	46	49	16	37	40	12	15	62	62	13	38	39	5	86	0.5	52	318	9	24	12	24	-50
171  
-4	17.07	36	40	12	36	40	12	10	39	39	6	39	39	6	5	100000	80	489	0	0	4	0	-50
172  
-5	1.28	178	251	175	36	41	12	95	116	161	103	39	39	6	95	1.762	80	476	142	77	215	122	0
173  
-6	0.83	56	64	31	37	41	18	32	57	60	18	39	39	7	57	1.286	80	514	19	18	27	21	-50
174  
-7	0.86	59	63	32	38	40	12	32	55	58	14	39	39	7	57	1.316	52	382	21	16	25	19	-50
175  
-8	2.12	124	144	75	37	40	12	95	72	73	15	39	39	6	88	3.147	80	554	87	33	107	34	0
176  
-9	-0.24	59	66	26	36	40	12	48	92	87	19	38	39	6	96	0.612	52	400	23	54	30	49	-50
177  
-10	0.64	63	63	20	37	40	11	53	58	61	12	38	39	6	75	1.13	80	502	26	20	26	23	-50
178  
-11	0.39	50	57	21	38	41	12	31	57	58	11	38	39	7	62	0.95	32	171	12	19	19	20	-50
179  
-12	-0.05	57	59	21	38	42	15	25	69	69	13	39	40	6	96	0.7	52	330	19	30	21	30	-50
180  
-13	-0.30	76	77	28	37	40	13	67	106	107	20	39	40	6	100	0.588	52	390	39	67	40	68	0
181  
-14	0.11	166	170	60	36	39	12	100	210	210	38	39	39	7	100	0.784	52	380	130	171	134	171	0
182  
-15	0.92	1356	1345	447	38	42	15	100	1004	993	331	39	40	10	100	1.37	52	380	1318	965	1307	954	0
183  
-16	2.92	183	193	62	39	42	12	100	66	67	14	39	39	6	88	5.5	80	476	144	27	154	28	0
184  
-17	-0.12	54	58	17	36	39	12	36	70	71	14	38	39	6	93	0.667	80	535	18	32	22	33	-50
185  
-18	-1.08	59	62	24	36	39	11	51	109	114	36	38	39	5	100	0.342	80	466	23	71	26	76	-50
186  
-19	17.07	36	41	13	38	41	11	11	39	38	5	38	39	5	1	100000	80	485	-2	1	3	0	-50
187  
-20	0.05	50	52	20	37	41	24	5	56	58	16	38	39	7	63	0.75	52	371	13	18	15	20	-50
188  
-!Sample_table_end
189  
-^SAMPLE=HS-5 cells rep2
190  
-!Sample_title = HS-5 cells, replicate 2
191  
-!Sample_source_name_ch1 = Human bone marrow stromal cells, HS-5
192  
-!Sample_organism_ch1 = Homo sapiens
193  
-!Sample_characteristics_ch1 = Human bone marrow stromal cells, HS-5
194  
-!Sample_growth_protocol_ch1 = HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization followed by pelleting of the cells.
195  
-!Sample_molecule_ch1 = total RNA
196  
-!Sample_extract_protocol_ch1 = RNA isolation was accomplished with Qiagen RNeasy Mini Kit reagents. The RNA (30 痢) was annealed with 5 痢 oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42蚓 in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
197  
-!Sample_label_ch1 = Cy5
198  
-!Sample_label_protocol_ch1 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 痞 of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
199  
-!Sample_source_name_ch2 = Universal human reference RNA
200  
-!Sample_organism_ch2 = Homo sapiens
201  
-!Sample_characteristics_ch2 = As a control RNA, Human Universal RNA (Stratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines approximating the expression profile of the majority of human genes was used.
202  
-!Sample_molecule_ch2 = total RNA
203  
-!Sample_extract_protocol_ch2 = The RNA (30 痢) was annealed with 5 痢 oligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse transcriptase for 2h at 42蚓 in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator.
204  
-!Sample_label_ch2 = Cy3
205  
-!Sample_label_protocol_ch2 = The cDNA from HS-5 RNA and Human Universal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 痞 of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray.
206  
-!Sample_scan_protocol = Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensity data were extracted and analyzed with GenePix Pro 3.0 analysis software.
207  
-!Sample_description = Human bone marrow stromal cells, HS-5 cells
208  
-!Sample_data_processing = After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear transformed to obtain the log and linear values given in the data table.
209  
-!Sample_platform_id = GEO Human 15K v2.0
210  
-#ID_REF = 
211  
-#VALUE = Normalized log2 ratio of means defined as CH1 divided by CH2
212  
-#CH1_Median = Channel 1 median intensity
213  
-#CH1_Mean = Channel 1 mean intensity
214  
-#CH1_SD = Channel 1 mean standard deviation
215  
-#CH1_BKD_ Median = Channel 1 median background intensity
216  
-#CH1_BKD_ Mean = Channel 1 mean background intensity
217  
-#CH1_BKD_ SD = Channel 1 background standard deviation
218  
-#% > CH1_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of
219  
-#CH2_Median = Channel 2 median intensity
220  
-#CH2_Mean = Channel 2 mean intensity
221  
-#CH2_SD = Channel 2 mean standard deviation
222  
-#CH2_BKD_ Median = Channel 2 median background intensity
223  
-#CH2_BKD_ Mean = Channel 2 mean background intensity
224  
-#CH2_BKD_ SD = Channel 2 background standard deviation
225  
-#% > CH2_BKD_+2SD = Percent of feature pixels that were greater than two standard deviations of the background over the background signal
226  
-#Ratio of Means = Unnormalized, untransformed ratio of means
227  
-#AREA = Number of pixels used to calculate a feature's intensity
228  
-#BKD_AREA = Number of pixles used to calculate a feature's background
229  
-#CH1_Median - CH1_BKD_ = Channel 1 median signal
230  
-#CH2_Median - CH2_BKD_ = Channel 2 median signal
231  
-#CH1_Mean - CH1_BKD_ = Channel 1 mean signal
232  
-#CH2_Mean - CH2_BKD_ = Channel 2 mean signal
233  
-#Flags = 0 denotes satisfactory features, while <0 denotes features that did not meet
234  
-!Sample_table_begin
235  
-ID_REF	VALUE	CH1_Median	CH1_Mean	CH1_SD	CH1_BKD_ Median	CH1_BKD_ Mean	CH1_BKD_ SD	% > CH1_BKD_+2SD	CH2_Median	CH2_Mean	CH2_SD	CH2_BKD_ Median	CH2_BKD_ Mean	CH2_BKD_ SD	% > CH2_BKD_+2SD	Ratio of Means	AREA	BKD_AREA	CH1_Median - CH1_BKD_	CH2_Median - CH2_BKD_	CH1_Mean - CH1_BKD_	CH2_Mean - CH2_BKD_	Flags
236  
-1	3.74	39	44	16	37	40	13	10	42	42	8	41	42	8	2	7	80	473	2	1	7	1	-50
237  
-2	-0.14	46	46	15	37	40	13	10	57	58	14	39	40	7	53	0.474	80	549	9	18	9	19	-50
238  
-3	-0.31	47	47	18	36	40	13	16	65	66	18	40	41	7	75	0.423	80	554	11	25	11	26	-50
239  
-4	3.74	40	43	12	36	40	12	10	40	40	7	39	40	8	1	7	80	480	4	1	7	1	-50
240  
-5	0.60	74	91	55	37	41	14	60	95	108	45	40	41	8	93	0.794	80	532	37	55	54	68	0
241  
-6	0.86	60	58	19	38	42	14	33	59	60	14	39	40	8	60	0.952	80	555	22	20	20	21	-50
242  
-7	0.67	47	48	14	38	42	14	7	50	52	11	40	41	8	30	0.833	52	392	9	10	10	12	-50
243  
-8	0.71	51	56	22	38	41	13	31	62	61	14	40	41	7	66	0.857	80	516	13	22	18	21	-50
244  
-9	0.09	49	52	18	37	40	13	21	67	67	18	40	41	7	75	0.556	120	699	12	27	15	27	-50
245  
-10	-0.29	45	49	16	40	44	16	9	62	62	14	41	42	10	53	0.429	32	232	5	21	9	21	-50
246  
-11	-0.18	42	46	15	40	44	15	10	52	52	11	39	40	8	33	0.462	80	488	2	13	6	13	-50
247  
-12	-0.87	45	49	18	39	42	15	10	75	75	15	40	41	8	88	0.286	80	521	6	35	10	35	-50
248  
-13	-0.04	64	69	27	37	41	13	51	100	102	23	39	41	8	98	0.508	80	467	27	61	32	63	-50
249  
-14	-1.75	58	63	22	37	41	14	38	206	208	43	40	41	8	100	0.155	80	468	21	166	26	168	-50
250  
-15	1.32	643	731	413	38	42	15	100	543	569	218	40	41	7	100	1.31	80	537	605	503	693	529	0
251  
-16	2.58	162	168	74	37	41	13	98	80	83	22	41	42	8	93	3.119	80	458	125	39	131	42	0
252  
-17	-0.75	42	46	15	37	40	12	12	67	69	16	40	41	8	82	0.31	80	470	5	27	9	29	-50
253  
-18	-1.39	41	45	16	38	41	13	8	67	75	29	40	41	9	68	0.2	80	555	3	27	7	35	-50
254  
-19	0.00	40	42	14	37	40	12	10	39	39	7	40	40	7	2	-5	80	464	3	-1	5	-1	-50
255  
-20	-0.65	38	42	15	37	40	14	3	53	55	13	40	41	8	37	0.333	80	549	1	13	5	15	-50
256  
-!Sample_table_end
257  
-^SERIES=Bone_marrow_stromal_cells
258  
-!Series_title = Profiling of the functionally distinct human bone marrow stromal cell lines HS-5 and HS-27a.
259  
-!Series_type = other
260  
-!Series_summary = Two human stromal cell lines, HS-5 and HS-27a, represent functionally distinct components of the bone marrow microenvironment.1,2 HS-27a supports cobblestone area formation by early hematopoietic progenitors, whereas HS-5 secretes multiple cytokines that support the proliferation of committed progenitors. These cell lines have been distributed to research groups worldwide for use as a tool to understand interactions between hematopoietic cells and their microenvironment. We have used DNA microarray technology to characterize and compare the expression of over 17 000 genes in these cell lines. Gene expression differences in cytokines/chemokines, G-protein signaling molecules, and multiple extracellular matrix proteins add to the known protein and functional characterization of the lines, leading to new insight into the differences in their support function for hematopoietic progenitors.
261  
-!Series_overall_design = We analyzed 2 arrays for HS-5 cell line and 1 array for HS-27a cell line
262  
-!Series_pubmed_id = 123456789
263  
-!Series_contributor = Jane,,Doe
264  
-!Series_contributor = John,A,Smith
265  
-!Series_web_link = http://geo.best-arrays.org
266  
-!Series_sample_id = HS-5 cells rep1
267  
-!Series_sample_id = HS-27a cells
268  
-!Series_sample_id = HS-5 cells rep2
  1
+^PLATFORM = Murine 15K long oligo array version 2.0
  2
+!Platform_title = Murine 15K long oligo array version 2.0
  3
+!Platform_technology = spotted oligonucleotide
  4
+!Platform_distribution = non-commercial
  5
+!Platform_organism = Mus musculus
  6
+!Platform_manufacturer = Un. London microarray facility
  7
+!Platform_manufacture_protocol =    1.  Oligos are arrayed in Greiner 384-well flat-bottom plates. Each well contains 600 pmol of 70-mer oligo.
  8
+!Platform_manufacture_protocol =    2. Resuspend oligos in water to 20 uM and rearray 5 無 into 384-well, Genetix polystyrene V-bottom plates (cat# X6004).
  9
+!Platform_manufacture_protocol =    3. Allow Genetix plates to dry through passive water evaporation in a protected environment (e.g., chemical hood).
  10
+!Platform_manufacture_protocol =    4. Before printing, add 5 無 of 1X Printing Buffer to each well. This can be done the night before a print run is started.
  11
+!Platform_manufacture_protocol =    5. Seal plates with Corning seals.
  12
+!Platform_manufacture_protocol =    6. Incubate at 37蚓 for 30 minutes to aid resuspension of DNA.
  13
+!Platform_manufacture_protocol =    7. Shake plates near maximum rotational speed on flat-bed shaker for 1 minute.
  14
+!Platform_manufacture_protocol =    8. Centrifuge plates at 2000 rpm for 3 minutes.
  15
+!Platform_manufacture_protocol =    9. Remove seals and cover with plate lids. Place in appropriate location of plate cassette. This should be done with first plates just before print run is started to minimize evaporation time before printing. For second and third cassettes, wait until 30 minutes before next cassette is needed to begin centrifugation.
  16
+!Platform_manufacture_protocol =   10. Make sure plates rest behind both holding clips in the cassettes. Push plates back into the cassettes as far as they will go, putting them in the proper position for the server arm.
  17
+!Platform_manufacture_protocol =   11. After the print run is completed, allow plates to dry through passive evaporation in a protected environment.	
  18
+!Platform_manufacture_protocol =   12. For each subsequent preparation of these plates for a print run, add water to the wells instead of sodium phosphate buffer. The amount of water should be decreased by 0.25 無 per print run, as this is the amount drawn up by the pin capillary during each dip.	
  19
+!Platform_support = glass
  20
+!Platform_coating = polysine	
  21
+!Platform_web_link = http://www.microarray.protocols.html
  22
+!Platform_contributor = Jane,Doe
  23
+!Platform_contributor = John,A,Smith
  24
+!Platform_contributor = Hans,van Elton
  25
+!Platform_contributor = John,Smithers Jr
  26
+!Platform_contributor = Jie,D,Chen
  27
+#ID = 
  28
+#GB_ACC = GenBank accession number of sequence used to design oligonucleotide probe   LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term=" 
  29
+#Gene_Desc = Gene description
  30
+#Gene_Sym = Gene symbols
  31
+#SEQUENCE = Probe sequence information
  32
+#SPOT_ID = alternative identifier
  33
+!platform_table_begin
  34
+ID	GB_ACC	Gene_Desc	Gene_Sym	SPOT_ID	SEQUENCE
  35
+1	U02079	nuclear factor of activated T-cells, cytoplasmic 2	Nfatc2		ACCTGGATGACGCAGCCACTTCAGAAAGCTGGGTTGGGACAGAAAGGTATATAGAGAGAAAATTTTGGAA
  36
+2	NM_008154	G-protein coupled receptor 3	Gpr3		CTGTACAATGCTCTCACTTACTACTCAGAGACAACGGTAACTCGGACTTATGTGATGCTGGCCTTGGTGT
  37
+3	AK015719	tropomodulin 2	Tmod2		CACCAGGCTCAGTGCCTAGTATCGGCTTCACCTAGTGTGGTTACTCAGGGCACGCAGAGCTACAGAACAC
  38
+4	AK003367	mitochondrial ribosomal protein L15	Mrpl15		CAAGAAGTCTAGAAATTCTGTGCAAGCCTATTCCATTCTTTCTGCGGGGACAACCAATTCCGAAAAGAAT
  39
+5	BC003333	RIKEN cDNA 0610033I05 gene	0610033I05Rik		AGAACTGGGTGGCAGATATCCTAGAGTTTTGACCAACGTTCACAGCACACATATTGATCTTATAGGACCT
  40
+6	NM_008462	killer cell lectin-like receptor, subfamily A, member 2	Klra2		TGAATTGAAGTTCCTTAAATCCCAACTTCAAAGAAACACATACTGGATTTCACTGACACATCATAAAAGC
  41
+7	NM_008029	FMS-like tyrosine kinase 4	Flt4		GAGGTGCTGTGGGATGACCGCCGGGGCATGCGGGTGCCCACTCAACTGTTGCGCGATGCCCTGTACCTGC
  42
+8	NM_054088	adiponutrin	Adpn		GTCTGAGTTCCATTCCAAAGACGAAGTCGTGGATGCCCTGGTGTGTTCCTGCTTCATTCCCCTCTTCTCT
  43
+9	NM_009750	nerve growth factor receptor (TNFRSF16) associated protein 1	Ngfrap1		TACAGCTGAGAAATTGTCTACGCATCCTTATGGGGGAGCTGTCTAACCACCACGATCACCATGATGAATT
  44
+10	AB045323	DNA segment, Chr 8, ERATO Doi 594, expressed	D8Ertd594e		GATTCAGACTCGGGAGGAGCATCCCAACCTCTCCTTGAGGATAAAGGCCTGAGCGATTGCCCTGGGGAGC
  45
+11	AK005789	dynein, cytoplasmic, light chain 2B	Dncl2b		TGCAGAAGGCATTCCAATCCGAACAACCCTGGACAACTCCACAACGGTTCAGTATGCGGGTCTTCTCCAC
  46
+12	NM_010517	insulin-like growth factor binding protein 4	Igfbp4		GGAGAAGCTGGCGCGCTGCCGCCCCCCCGTGGGTTGCGAGGAGTTGGTGCGGGAGCCAGGCTGCGGTTGT
  47
+13	AK010722	RIKEN cDNA 2410075D05 gene	2410075D05Rik		GGAGCATCTGGAGTTCCGCTTACCGGAAATAAAGTCTTTACTATCGGTGATTGGAGGGCAGTTCACTAAC
  48
+14	AK003755	DNA segment, Chr 4, ERATO Doi 421, expressed	D4Ertd421e		AGCAAAGAGATCTCCCTCAGTGTGCCCATAGGTGGCGGTGCGAGCTTGCGGTTATTGGCCAGTGACTTGC
  49
+15	BC003241	cleavage stimulation factor, 3' pre-RNA, subunit 3	Cstf3		AAATTAGAAGAAAATCCATATGACCTTGATGCTTGGAGCATTCTCATTCGAGAGGCACAGAATCAACCTA
  50
+16	AK004937	RIKEN cDNA 1300007O09 gene	1300007O09Rik		CAGACACAAACCCTAGGTTGTATTGTAGACCGGAGTTTAAGCAGGCACTACCTGTCTGTCTTTTCTTCAT
  51
+17	AK004524	unnamed protein product; hypothetical SOCS domain			CGGAGCCCTGCGCGCCCAGAGCCCCCTCCCACCCGCTTCCACCAAGTGCATGGAGCCAACATCCGCATGG
  52
+18	NM_025999	RIKEN cDNA 2610110L04 gene	2610110L04Rik		TGCATTGATAAATGGAGTGATCGACACAGGAACTGCCCCATTTGTCGCCTACAGATGACTGGAGCAAATG
  53
+19				-- CONTROL	
  54
+20	NM_023120	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	Gnb1l		ACCGCCTGGTCCCAGATTTGTCCTCCGAGGCACACAGTCGGCTGTGAACACGCTCCATTTCTGCCCACCA
  55
+!platform_table_end	
  56
+^SAMPLE = Control Embyronic Stem Cell Replicate 1
  57
+!Sample_title = Control Embyronic Stem Cell Replicate 1
  58
+!Sample_supplementary_file = file1.gpr
  59
+!Sample_source_name_ch1 = Total RNA from murine ES-D3 embryonic stem cells labeled with Cyanine-5 (red).
  60
+!Sample_organism_ch1 = Mus musculus
  61
+!Sample_characteristics_ch1 = ES-D3 cell line (CRL-1934)
  62
+!Sample_characteristics_ch1 = Age: day 4 
  63
+!Sample_characteristics_ch1 = Tissue: blastocytes
  64
+!Sample_characteristics_ch1 = Strain: 129/Sv mice
  65
+!Sample_growth_protocol_ch1 = ES cells were kept in an undifferentiated, pluripotent state by using 1000 IU/ml leukemia inhibitory factor (LIF; Chemicon, ESGRO, ESG1107), and grown on top of murine embryonic fibroblasts feeder layer inactivated by 10 ug/ml of mitomycin C (Sigma, St. Louis). ES cells were cultured on 0.1% gelatin-coated plastic dishes in ES medium containing Dulbecco modified Eagle medium supplemented with 15% fetal calf serum, 0.1 mM beta-mercaptoethanol, 2 mM glutamine, and 0.1 mN non-essential amino acids.
  66
+!Sample_extract_protocol_ch1 = TriZol procedure
  67
+!Sample_molecule_ch1 = total RNA
  68
+!Sample_label_ch1 = Cy5
  69
+!Sample_label_protocol_ch1 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP, with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).
  70
+!Sample_source_name_ch2 = Total RNA from pooled whole mouse embryos e17.5, labeled with Cyanine-3 (green).
  71
+!Sample_organism_ch2 = Mus musculus
  72
+!Sample_characteristics_ch2 = Strain: C57BL/6
  73
+!Sample_characteristics_ch2 = Age: e17.5 d
  74
+!Sample_characteristics_ch2 = Tissue: whole embryo
  75
+!Sample_extract_protocol_ch2 = TriZol procedure
  76
+!Sample_molecule_ch2 = total RNA
  77
+!Sample_label_ch2 = Cy3
  78
+!Sample_label_protocol_ch2 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP, with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen).
  79
+!Sample_hyb_protocol = Oligoarray control targets and hybridization buffer (Agilent In Situ Hybridization Kit Plus) were added, and samples were applied to microarrays enclosed in Agilent SureHyb-enabled hybridization chambers. After hybridization, slides were washed sequentially with 6x SSC/0.005% Triton X-102 and 0.1x SSC/0.005% Triton X-102 before scanning. Slides were hybridized for 17 h at 60蚓 in a rotating oven, and washed.
  80
+!Sample_scan_protocol = Scanned on an Agilent G2565AA scanner.
  81
+!Sample_scan_protocol = Images were quantified using Agilent Feature Extraction Software (version A.7.5). 
  82
+!Sample_description = Biological replicate 1 of 4. Control embryonic stem cells, untreated, harvested after several passages.
  83
+!Sample_data_processing = LOWESS normalized, background subtracted VALUE data obtained from log of processed Red signal/processed Green signal.
  84
+!Sample_platform_id = Murine 15K long oligo array version 2.0
  85
+#ID_REF = 
  86
+#VALUE = log(REDsignal/GREENsignal) per feature (processed signals used).
  87
+#LogRatioError = error of the log ratio calculated according to the error model chosen.
  88
+#PValueLogRatio = Significance level of the Log Ratio computed for a feature.
  89
+#gProcessedSignal = Dye-normalized signal after surrogate "algorithm," green "channel," used for computation of log ratio.
  90
+#rProcessedSignal = Dye-normalized signal after surrogate "algorithm," red "channel," used for computation of log ratio.
  91
+!sample_table_begin	
  92
+ID_REF	VALUE	LogRatioError	PValueLogRatio	gProcessedSignal	rProcessedSignal
  93
+1	-1.6274758	1.36E-01	6.41E-33	9.13E+03	2.15E+02
  94
+2	0.1412248	1.34E+00	1.00E+00	4.14E+01	5.72E+01
  95
+3	0.1827684	5.19E-02	4.33E-04	5.13E+03	7.81E+03
  96
+4	-0.3932267	6.08E-02	1.02E-10	4.65E+03	1.88E+03
  97
+5	-0.9865994	1.05E-01	6.32E-21	2.91E+03	3.01E+02
  98
+6	0.0238812	1.02E-01	8.15E-01	7.08E+02	7.48E+02
  99
+7	-1.4841822	1.25E-01	1.42E-32	1.02E+04	3.36E+02
  100
+8	-1.8261356	4.15E-01	1.10E-05	7.19E+02	1.07E+01
  101
+9	-1.0344779	1.78E+00	1.00E+00	9.62E+01	8.89E+00
  102
+10	0.2405891	3.09E-01	4.36E-01	1.61E+02	2.80E+02