Permalink
Browse files

Adding two eprimer3 files used in the unit tests (should have been co…

…mmitted earlier today)
  • Loading branch information...
1 parent 8e6c2d0 commit 093de7db4c7e5f27ea7865afb8b2fc802c759979 @peterjc peterjc committed Mar 3, 2010
Showing with 1,686 additions and 0 deletions.
  1. +336 −0 Tests/Emboss/NirK.primer3
  2. +1,350 −0 Tests/Emboss/NirK_full.primer3
@@ -0,0 +1,336 @@
+
+# EPRIMER3 RESULTS FOR NirK00001
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 8882 20 60.00 50.00 GCAAACTGAAAAGCGGACTC
+
+
+ FORWARD PRIMER 2467 20 60.00 50.00 GGGACGTACTTTCGCACAAT
+
+
+ FORWARD PRIMER 1458 20 60.00 55.00 GTCTTATGCGTGGTGGAGGT
+
+
+ FORWARD PRIMER 9314 20 59.99 50.00 GTACATCAACATCCGCAACG
+
+
+ FORWARD PRIMER 9313 20 59.99 50.00 CGTACATCAACATCCGCAAC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00002
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 3429 20 59.99 50.00 GGAAGTGCTTCTCGTTTTCG
+
+
+ FORWARD PRIMER 1522 20 60.01 55.00 TACAGAGCGTCACGGATGAG
+
+
+ FORWARD PRIMER 9692 20 59.99 50.00 TTGTCATCGTGCTCTTCGTC
+
+
+ FORWARD PRIMER 9626 20 59.99 55.00 GACTCCAACCTCAGCTTTCG
+
+
+ FORWARD PRIMER 3026 20 59.99 55.00 GGCACGAAGAAGGACAGAAG
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00003
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 2688 20 59.99 50.00 GAGCAGGAAAAAGCTTGTGG
+
+
+ FORWARD PRIMER 2710 20 59.99 55.00 CTCTGACCCTGCTCGAAAAC
+
+
+ FORWARD PRIMER 8144 20 59.99 50.00 TACTCAACACCCGGCACATA
+
+
+ FORWARD PRIMER 8418 20 60.01 50.00 AAGGTGGTTCGTGTTTCGTC
+
+
+ FORWARD PRIMER 8417 20 60.01 50.00 GAAGGTGGTTCGTGTTTCGT
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00004
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 5168 20 60.00 50.00 GTCGTATTCAACGGCAAGGT
+
+
+ FORWARD PRIMER 7441 20 59.99 50.00 GACGTCGAGCAGATGAAACA
+
+
+ FORWARD PRIMER 7445 20 59.98 50.00 TCGAGCAGATGAAACAGGTG
+
+
+ FORWARD PRIMER 5963 20 60.02 50.00 ATGCTGCATCAAGTCAGTGC
+
+
+ FORWARD PRIMER 2750 20 59.97 55.00 TTACCTGACACCGGGAGAAC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00005
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 9667 20 60.00 50.00 ACCTTCGCGTCATGTTTACC
+
+
+ FORWARD PRIMER 3542 20 60.00 50.00 GTTGCGGTATCGAAGTGGTT
+
+
+ FORWARD PRIMER 6535 20 60.01 60.00 CTGACAGAGCGGGTAGAAGG
+
+
+ FORWARD PRIMER 2130 20 59.99 50.00 CGCCAAACCACAGAGGTAAT
+
+
+ FORWARD PRIMER 3642 20 60.01 55.00 TCGTGATGAGCAGGACGTAG
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00006
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 3183 20 60.00 50.00 CACAAACTTGTGACGGATGG
+
+
+ FORWARD PRIMER 2333 20 60.01 50.00 TCATCGTAATAGCGCACAGC
+
+
+ FORWARD PRIMER 896 20 59.99 55.00 AGGGTGACTGGCAGGTATTG
+
+
+ FORWARD PRIMER 7499 20 59.99 45.00 TGCACATCAGCAGGAAAAAG
+
+
+ FORWARD PRIMER 177 20 59.99 55.00 GCAAGGCCATAGAGCTGAAC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00007
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 1710 20 60.00 50.00 CCTTCCAGATTGATGGAGGA
+
+
+ FORWARD PRIMER 3695 20 59.99 55.00 ACGGTCTGGTTACGATCCTG
+
+
+ FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC
+
+
+ FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA
+
+
+ FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00008
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 1711 20 60.00 50.00 CCTTCCAGATTGATGGAGGA
+
+
+ FORWARD PRIMER 3696 20 59.99 55.00 ACGGTCTGGTTACGATCCTG
+
+
+ FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC
+
+
+ FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA
+
+
+ FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00009
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 1711 20 60.00 50.00 CCTTCCAGATTGATGGAGGA
+
+
+ FORWARD PRIMER 3696 20 59.99 55.00 ACGGTCTGGTTACGATCCTG
+
+
+ FORWARD PRIMER 9806 20 59.99 55.00 GTTCAGCTCTATGGCCTTGC
+
+
+ FORWARD PRIMER 5044 20 60.02 55.00 GAGGTGCGCAGTGATAGACA
+
+
+ FORWARD PRIMER 8188 20 60.02 55.00 GGCGAGACTTGCGTCTTTAC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00010
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 3183 20 60.00 50.00 CACAAACTTGTGACGGATGG
+
+
+ FORWARD PRIMER 896 20 59.99 55.00 AGGGTGACTGGCAGGTATTG
+
+
+ FORWARD PRIMER 7389 20 59.99 45.00 TGCACATCAGCAGGAAAAAG
+
+
+ FORWARD PRIMER 177 20 59.99 55.00 GCAAGGCCATAGAGCTGAAC
+
+
+ FORWARD PRIMER 4939 20 60.02 55.00 TGTCTATCACTGCGCACCTC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00011
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 9096 20 60.00 55.00 GACAACTTCTTCGCCGAGAC
+
+
+ FORWARD PRIMER 4778 20 60.01 45.00 AACAACACCATGCCTCACAA
+
+
+ FORWARD PRIMER 7330 20 60.01 45.00 CGTCAATCGTAAAGCTGCAA
+
+
+ FORWARD PRIMER 3785 20 60.02 45.00 AAATTCGTGCTGAGCTTCGT
+
+
+ FORWARD PRIMER 9188 20 59.97 55.00 CCGCAACTTCTCCTATCTCG
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00012
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 1336 20 59.99 50.00 CCAGCCTGAAAGCAAGAAAC
+
+
+ FORWARD PRIMER 2867 20 60.02 55.00 GGCACGTGCAGATAGAGTGA
+
+
+ FORWARD PRIMER 9952 20 60.02 50.00 AACAGGCAGCTGTTCGATCT
+
+
+ FORWARD PRIMER 7634 20 59.98 55.00 CGCTCGAGAAATACGAGGTC
+
+
+ FORWARD PRIMER 4641 20 59.94 55.00 CACGATCGAGGAGAAGAAGG
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00013
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 7492 20 60.00 55.00 GGCAGAAACTTCTGGTCTGC
+
+
+ FORWARD PRIMER 8959 20 59.99 50.00 TCTTCACGCATGTCGAGTTC
+
+
+ FORWARD PRIMER 4780 20 59.99 50.00 GAGTTCACGCTCACGATCAA
+
+
+ FORWARD PRIMER 8201 20 59.99 55.00 GAGGTGAAGAAACCGAGCAG
+
+
+ FORWARD PRIMER 4479 20 60.01 50.00 CTCCGCTACAAATGCTGTGA
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00014
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 5270 20 59.99 50.00 TTGATCGTGAGCGTGAACTC
+
+
+ FORWARD PRIMER 1849 20 59.99 55.00 CTGCTCGGTTTCTTCACCTC
+
+
+ FORWARD PRIMER 8508 20 60.01 45.00 TCGGTTCATCGAAATCCTTC
+
+
+ FORWARD PRIMER 8991 20 59.98 50.00 AATCCCATTCGGGATAGGTC
+
+
+ FORWARD PRIMER 2803 20 59.98 55.00 CTTCAAGACGCTGGCCTATC
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00015
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 5078 20 60.00 55.00 ATCGGCGAGCAGGACTACTA
+
+
+ FORWARD PRIMER 4026 20 60.00 55.00 GCCTTCTGCAACTTCCTCAC
+
+
+ FORWARD PRIMER 251 20 60.01 55.00 CTTTCGCCTCGGTGACTTAG
+
+
+ FORWARD PRIMER 460 20 59.99 40.00 TTGTTGCGAATGAAGCTTTG
+
+
+ FORWARD PRIMER 423 20 59.99 50.00 ACTCAAGAGGCTCACCGAAA
+
+
+
+
+# EPRIMER3 RESULTS FOR NirK00016
+
+# Start Len Tm GC% Sequence
+
+ FORWARD PRIMER 6133 20 59.99 45.00 TGCTTGAAAATGACGCACTC
+
+
+ FORWARD PRIMER 136 20 59.99 60.00 CTCGCTGGCTAGGTCATAGG
+
+
+ FORWARD PRIMER 195 20 59.99 45.00 TATCGCACCAAACACGGTAA
+
+
+ FORWARD PRIMER 4937 20 59.99 55.00 CGATTACCCTCACCGTCACT
+
+
+ FORWARD PRIMER 6802 20 60.01 50.00 TATCGCAACCACTGAGCAAG
+
+
+
Oops, something went wrong.

0 comments on commit 093de7d

Please sign in to comment.